ID: 1143636153

View in Genome Browser
Species Human (GRCh38)
Location 17:8164613-8164635
Sequence CCTTGTGCACTGACAGTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143636142_1143636153 10 Left 1143636142 17:8164580-8164602 CCTCCCCCTCAGAGGAGCAGCCG No data
Right 1143636153 17:8164613-8164635 CCTTGTGCACTGACAGTCCCGGG No data
1143636144_1143636153 6 Left 1143636144 17:8164584-8164606 CCCCTCAGAGGAGCAGCCGCGTC No data
Right 1143636153 17:8164613-8164635 CCTTGTGCACTGACAGTCCCGGG No data
1143636145_1143636153 5 Left 1143636145 17:8164585-8164607 CCCTCAGAGGAGCAGCCGCGTCC No data
Right 1143636153 17:8164613-8164635 CCTTGTGCACTGACAGTCCCGGG No data
1143636143_1143636153 7 Left 1143636143 17:8164583-8164605 CCCCCTCAGAGGAGCAGCCGCGT No data
Right 1143636153 17:8164613-8164635 CCTTGTGCACTGACAGTCCCGGG No data
1143636148_1143636153 -10 Left 1143636148 17:8164600-8164622 CCGCGTCCCTGGTCCTTGTGCAC No data
Right 1143636153 17:8164613-8164635 CCTTGTGCACTGACAGTCCCGGG No data
1143636146_1143636153 4 Left 1143636146 17:8164586-8164608 CCTCAGAGGAGCAGCCGCGTCCC No data
Right 1143636153 17:8164613-8164635 CCTTGTGCACTGACAGTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143636153 Original CRISPR CCTTGTGCACTGACAGTCCC GGG Intergenic
No off target data available for this crispr