ID: 1143637731

View in Genome Browser
Species Human (GRCh38)
Location 17:8176064-8176086
Sequence CAGGCTGCAGGGCAGGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1070
Summary {0: 1, 1: 2, 2: 13, 3: 107, 4: 947}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143637717_1143637731 30 Left 1143637717 17:8176011-8176033 CCTGTATGTTGCTGTCCTGGGAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG 0: 1
1: 2
2: 13
3: 107
4: 947
1143637721_1143637731 15 Left 1143637721 17:8176026-8176048 CCTGGGAGCAGGGCACAGGAAGA 0: 2
1: 1
2: 6
3: 56
4: 517
Right 1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG 0: 1
1: 2
2: 13
3: 107
4: 947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143637731 Original CRISPR CAGGCTGCAGGGCAGGCCTG GGG Intronic
900089700 1:914511-914533 CAGGCTGTGGTGCAGGCGTGGGG + Intergenic
900164656 1:1239866-1239888 CAGGCAGCAGGGTCGGCCTGCGG + Intergenic
900228396 1:1543564-1543586 CAAGCAGCAGGGCCGGCCTCAGG + Intronic
900246783 1:1640038-1640060 CAAGCCGCAGAGCAGTCCTGCGG + Intronic
900258005 1:1707170-1707192 CAAGCCGCAGAGCAGTCCTGCGG + Intronic
900373706 1:2343920-2343942 CTGGCAGCAGGGGAGGCCTACGG - Intronic
900464487 1:2818432-2818454 CAGGCAGCAGGGAGAGCCTGGGG - Intergenic
900507745 1:3038208-3038230 CAGGCTGCTGGGCAGGAAGGGGG - Intergenic
900531431 1:3155318-3155340 CAGGCTGCAGGGCTTGGCCGCGG + Intronic
900601518 1:3504767-3504789 CTGGGTGCAGTGCCGGCCTGGGG - Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
900684349 1:3938506-3938528 CAGGCTGCGGTGCAGGGATGGGG - Intergenic
900796926 1:4713575-4713597 CAGGCTTCACAGCAGGCCTGCGG + Intronic
901039679 1:6356400-6356422 GAGGGTGCTGGGCAGGGCTGAGG - Intronic
901613740 1:10520201-10520223 CAGGCTGGAGTGCAGTGCTGCGG + Intronic
901749527 1:11397364-11397386 CTGGGTCCAGGGCTGGCCTGGGG - Intergenic
901907450 1:12426240-12426262 CAGGCGGGAGGAAAGGCCTGGGG - Intronic
902512653 1:16974749-16974771 CAGGCTGAAGGAGGGGCCTGAGG + Exonic
902575011 1:17372223-17372245 AGGGCTGCGGTGCAGGCCTGAGG + Exonic
902611744 1:17601995-17602017 CAGGCTGCTGGGGAGACCTGAGG - Intronic
902717230 1:18281075-18281097 CCTCCTGCAGGCCAGGCCTGTGG - Intronic
903648131 1:24906866-24906888 CAGGCTGTGGGGCAGGGGTGGGG + Intronic
903649531 1:24914378-24914400 CAGGCCGCAGAGCCGGCCTCGGG - Intronic
903945971 1:26962910-26962932 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
903960255 1:27052572-27052594 CAGGGACCAGGGCAGTCCTGTGG + Intergenic
903981460 1:27191626-27191648 CAGGCTGCAGTGCGGTGCTGCGG - Intergenic
904244142 1:29174147-29174169 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
904314804 1:29653225-29653247 GGGGCTGCAGGGCAGGCCATGGG + Intergenic
904752816 1:32751549-32751571 CGGGGTGCAGGGGAGCCCTGGGG + Intronic
904762662 1:32817175-32817197 GAACCTGCAGGTCAGGCCTGGGG - Exonic
904873360 1:33635504-33635526 CAGGCTACATGCCAGGCCAGGGG - Intronic
905034502 1:34908764-34908786 CAGGCTCCAGGGTGGGCCAGGGG - Intronic
905233589 1:36530422-36530444 CTGGCGGCAGGGCAGGGGTGTGG - Intergenic
905714351 1:40135267-40135289 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
905770688 1:40636214-40636236 CAGGCTGCAGACCAGCTCTGAGG - Intronic
906010239 1:42516525-42516547 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
906220879 1:44078475-44078497 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
906640767 1:47439181-47439203 CAGGAAGGCGGGCAGGCCTGCGG - Exonic
907245073 1:53103281-53103303 CAGGCTGCTGGGAGGGGCTGGGG + Intronic
907394356 1:54178912-54178934 CACGCTGCTGGACAGGGCTGAGG - Intronic
908301153 1:62761818-62761840 CAGGCTGCAGGGGAGCCCATGGG - Intergenic
908636971 1:66177787-66177809 AAGGCTTCAGGGCATTCCTGTGG - Intronic
908902307 1:68969674-68969696 CAGACTGCGAGGAAGGCCTGTGG + Intergenic
908905177 1:69000272-69000294 CAGCGTGCTGGGGAGGCCTGAGG + Intergenic
910243094 1:85109579-85109601 CAGGATGCAGTGCAGGCCCAGGG + Intronic
911469938 1:98305857-98305879 CAGGCAGCTGGGCAGGTTTGAGG - Intergenic
912507317 1:110165244-110165266 CAGGCAACACGGCAGCCCTGGGG + Intronic
912552343 1:110492353-110492375 CTGTTTGCAGGGCAGGCCCGTGG - Intergenic
912554771 1:110508136-110508158 CAGGCTCCTGGGCGGGGCTGGGG + Intergenic
912775191 1:112502316-112502338 CGGGGTGCAGGGCAGGGCTCTGG - Intronic
913163743 1:116167613-116167635 AAGGCTGCAAGGCAGGCCAGAGG - Intergenic
913210130 1:116575532-116575554 CAGACTGCAGGGGAGGCCATGGG - Exonic
913526456 1:119698048-119698070 CAGGCTACAGGGCAGGAATGAGG - Intronic
913538267 1:119795045-119795067 CAGGCTGCTGGCCTGTCCTGCGG + Intronic
914754898 1:150557088-150557110 GAGGCTGCAGGGCTGGCTCGGGG + Intronic
914876184 1:151514018-151514040 AAGGCAGCAGGGCAGCTCTGAGG - Intronic
914896356 1:151678073-151678095 CAGGCTGGAGTGCAGTGCTGCGG + Intronic
915298981 1:154941445-154941467 CAGGTTGCAGGGTAGGGGTGTGG - Intergenic
915312418 1:155011247-155011269 CAGGGTCCAGTGCAGGGCTGGGG - Intronic
915558908 1:156675337-156675359 CCAGCTGCAGGGCAGGCGAGAGG + Exonic
915587948 1:156854457-156854479 CAGGCTGCAGGTGAGCCCTCCGG - Intronic
915594420 1:156888072-156888094 CAGGCTGGTGGGCAGGCCAAAGG + Intergenic
915631150 1:157154927-157154949 AGGGGTGGAGGGCAGGCCTGAGG - Intergenic
915636120 1:157188091-157188113 CAGGCTGCAGCTCAGGGCTCGGG + Intergenic
916813630 1:168328751-168328773 CAGACCTTAGGGCAGGCCTGTGG - Intergenic
917342964 1:173999047-173999069 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
917452084 1:175155759-175155781 CTGGCTTCAGGACAGGCCGGGGG - Intergenic
917974662 1:180230912-180230934 CGAGCTGTAGGCCAGGCCTGAGG + Intronic
918005641 1:180539887-180539909 GGGCCTGCAGGGCAGGCCTATGG + Intergenic
918185946 1:182127911-182127933 AAGGCTGCTGTCCAGGCCTGCGG + Intergenic
918510840 1:185312484-185312506 CAGCCTGCAGTGGAGTCCTGTGG - Intronic
918786336 1:188769065-188769087 CAGGCTGCTGTGCTGGCCAGTGG - Intergenic
919742916 1:200991374-200991396 CAGGCTGCAGGGCAGACTGCAGG - Intronic
919756448 1:201069107-201069129 AAGGCTGTGGGGCAGCCCTGGGG - Intronic
919795391 1:201318612-201318634 CAGGTTCCAGAGCAGCCCTGGGG - Exonic
920045453 1:203129446-203129468 GAGGCTGCCTGTCAGGCCTGGGG + Intronic
920127730 1:203706958-203706980 CAGGCTGGAGGGCAGTCCTAGGG - Intronic
920312494 1:205056819-205056841 CCTGCTGCAGGGCAGGGCAGGGG - Intronic
920501858 1:206490557-206490579 CAGCCTGCAGTGCAGGGCCGGGG - Intronic
921182510 1:212642896-212642918 CAGGCTGGAGTGCAGTCATGTGG + Intergenic
921266477 1:213424901-213424923 CAAGCTGAGGGACAGGCCTGAGG - Intergenic
921391299 1:214617089-214617111 CAGGCTGGAGTGCAGTGCTGTGG + Intronic
921549987 1:216523675-216523697 TAGGCTGCAGTGCAGGCATTTGG + Intronic
921918674 1:220642195-220642217 CAGGCTGCTGTGCTGGCCAGTGG - Intronic
922166112 1:223117087-223117109 CTGCCTGCAGGGCAGGGCTCGGG - Intronic
922167329 1:223127178-223127200 CAGGCTCGCTGGCAGGCCTGGGG + Intronic
922176570 1:223202263-223202285 CAGGTTGCAGGCCAGCCCTGGGG + Intergenic
922295132 1:224243414-224243436 CAGGCTGGAGGGCAGTGGTGCGG - Intronic
922432320 1:225567906-225567928 CAGACTTTAGGGCAAGCCTGAGG - Intronic
922567438 1:226610157-226610179 AAGGGTGCTGGGCTGGCCTGAGG - Intergenic
922767379 1:228163072-228163094 CAGGCAGCAGGAAAGGCGTGCGG - Intergenic
922977229 1:229795268-229795290 CAGGCTGGAGTGCAGGGCAGTGG - Intergenic
923325337 1:232875483-232875505 CAGGATGCAGGGGAGCCCAGGGG - Intergenic
923493732 1:234507044-234507066 AGGGCAGCAGGGCAGGGCTGAGG - Intergenic
924582585 1:245335211-245335233 CAGGCTGCAGGGCCCATCTGGGG - Intronic
924692611 1:246365914-246365936 CAGGGTTCAGAGCAGCCCTGGGG - Intronic
924744327 1:246818329-246818351 CAGGCTGAAGGAGGGGCCTGAGG - Intergenic
924836389 1:247651903-247651925 CAGGCTCCTGGGGAGGCCTCAGG - Intergenic
1063114897 10:3066802-3066824 CAGGCTGCAGAGGAAACCTGGGG + Intronic
1063130356 10:3172646-3172668 GAGGGTCCAGGGCAGGCCGGAGG - Intronic
1063244021 10:4199946-4199968 CAGGCTGGAGAGAAGGCATGGGG - Intergenic
1063889581 10:10615774-10615796 CAGGCTTCTGGGGAGGCCTCAGG - Intergenic
1064044865 10:12003878-12003900 CAGGCTGGAGTGCAGTCATGTGG - Intronic
1064453840 10:15468572-15468594 CACACTTCAGGGCAGGCATGAGG - Intergenic
1064480618 10:15736870-15736892 CAGGCTGCAGTGCAGTGGTGCGG - Intergenic
1065265107 10:23966535-23966557 CAAACTGCAGGGCAGGGCAGGGG - Intronic
1065503779 10:26408999-26409021 CAGGCTGGAGGGCAGTGATGTGG - Intergenic
1066590540 10:36989423-36989445 CTCCCTGCAGGGCAGGGCTGAGG - Intergenic
1067218751 10:44326170-44326192 CTGGCTGGAGACCAGGCCTGTGG - Intergenic
1067497606 10:46774139-46774161 CAAGTTGCAGGCCAGGCCTGGGG - Intergenic
1067498012 10:46776105-46776127 CCTGCTGCGGGGCGGGCCTGGGG - Intergenic
1067596634 10:47564309-47564331 CCTGCTGCGGGGCGGGCCTGGGG + Intergenic
1067597045 10:47566275-47566297 CAAGTTGCAGGCCAGGCCTGGGG + Intergenic
1067682346 10:48449041-48449063 CAGGCCTCAGAGCAGGCCAGAGG + Intronic
1068700039 10:60009908-60009930 CAGGCTGCTGCAGAGGCCTGGGG - Intergenic
1069055779 10:63843477-63843499 CAGACTGCAGTGCAGTCCTATGG - Intergenic
1069568444 10:69479395-69479417 CAGGCTGCAGAGGAGCCCTGTGG - Intronic
1069630930 10:69896660-69896682 GAAGCTGGAAGGCAGGCCTGAGG + Intronic
1069840585 10:71337083-71337105 CAGGCTGAAGGGGAGGCCAGAGG - Intronic
1069852988 10:71422676-71422698 CAAGCAGTTGGGCAGGCCTGTGG - Intronic
1069906794 10:71736659-71736681 GAGGCTGCAAGGCAGGGGTGAGG - Intronic
1070129574 10:73647374-73647396 AAGGCTGCAGGGCAGGGGTGGGG - Exonic
1070752385 10:78971987-78972009 CAGGGTTCAAGGCAGGGCTGGGG + Intergenic
1070856311 10:79610494-79610516 CAGGCTGGTGGGGGGGCCTGGGG + Intergenic
1071305422 10:84295138-84295160 AAGTCTGCAGGGCAGACCAGTGG + Intergenic
1071574319 10:86714888-86714910 ATGGCTCCAGGGCAGGGCTGTGG + Intronic
1072503692 10:96043741-96043763 CGGGCGGCCCGGCAGGCCTGGGG + Intronic
1072578971 10:96723525-96723547 CAGGCTGCAGTGCAGTGCAGTGG - Intergenic
1072717413 10:97760999-97761021 CAGGCTGAGGGGCGGGCCTTTGG + Intergenic
1072733516 10:97864115-97864137 CATGCCACAGGGCAGCCCTGAGG - Intronic
1072785463 10:98276841-98276863 CAGGCTCCAGGACAGTGCTGGGG + Intergenic
1072984195 10:100125432-100125454 CAGACAGCAGGGGAGGCCTCAGG + Intergenic
1073016334 10:100402527-100402549 CAGGCTGGAGTGCAGCACTGTGG - Intergenic
1073061666 10:100737162-100737184 CTGCCTGCATTGCAGGCCTGAGG + Intronic
1073099128 10:100997884-100997906 CCGGCTGCTGGGCAGGGCTGGGG + Intronic
1073124510 10:101141143-101141165 CAGGCTGCAGGGCAACCGGGAGG + Intergenic
1073773507 10:106761060-106761082 CAGGCTGCAGTGCAGTGGTGCGG - Intronic
1073955168 10:108862305-108862327 CAGGCTGCCGGCCAGACCTACGG - Intergenic
1073982475 10:109170332-109170354 CAGGCTGGAGTGCAGTGCTGTGG + Intergenic
1074340041 10:112619524-112619546 CAAGCGACAGGGCTGGCCTGGGG + Intronic
1075037818 10:119083807-119083829 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
1075096291 10:119473781-119473803 CAGGCAGCACAGCAGGGCTGCGG - Intergenic
1075178071 10:120184250-120184272 AATGCTGCAGGGGAGGCTTGGGG - Intergenic
1075541339 10:123316933-123316955 CAGGGAGCATGGCAGGCCTTAGG + Intergenic
1075629569 10:123992609-123992631 TAGGCTGCTGGGGTGGCCTGGGG - Intergenic
1075631659 10:124004177-124004199 CAGGGTCCTTGGCAGGCCTGAGG - Intergenic
1075751370 10:124774328-124774350 CAGGCTGGAGGGCTGGAGTGCGG - Intronic
1075860013 10:125667224-125667246 CTGGATGCAGGGATGGCCTGGGG + Intronic
1076143326 10:128096870-128096892 CAGCCTGGAGGACAGGCATGGGG + Exonic
1076736422 10:132461183-132461205 CTGAGAGCAGGGCAGGCCTGGGG - Intergenic
1076759503 10:132594814-132594836 CAGCCTGCAGGGCTGGCAGGGGG - Intronic
1076839706 10:133040018-133040040 CAGCCTCCGGGGCAGGACTGAGG - Intergenic
1076994683 11:292238-292260 CGGGCTGCAGGGCACTGCTGAGG - Intronic
1077010691 11:377884-377906 CAGGCTGGTGGGCAGGAGTGGGG + Intronic
1077050021 11:562400-562422 CAGGCTGCTGCACAGACCTGCGG + Exonic
1077101498 11:824504-824526 CAGCCTGCGGGGCAGGGATGCGG - Exonic
1077107613 11:848822-848844 TAGGCTGCAGGGCACAGCTGGGG + Intronic
1077129417 11:962936-962958 CAGCTGGCAGGGCAGGCCTCAGG - Intronic
1077144180 11:1037338-1037360 CAGGCTGCCCTGGAGGCCTGAGG + Intergenic
1077190575 11:1254471-1254493 CAGGGGGCAGGGAAGGCCTGTGG + Intronic
1077221579 11:1420374-1420396 CAGAGTGCAGGGCAGGCCTCAGG - Intronic
1077252212 11:1565751-1565773 CCTGCTGCGGGGCGGGCCTGGGG - Exonic
1077351743 11:2096293-2096315 CACGCTGCAGCCCAGGCATGGGG - Intergenic
1077392622 11:2307105-2307127 CAGCCTCCAGGGCAGGCAGGAGG + Intronic
1077414353 11:2417924-2417946 CAGGCTGCAAGGCTCACCTGGGG - Intronic
1077485106 11:2834968-2834990 CAGGTTGGAGGCCAGGCCTGGGG - Intronic
1077497377 11:2892674-2892696 CGGGCTGCCGGCCGGGCCTGCGG - Intronic
1077536485 11:3127178-3127200 ATGGCTGCAGGGGAAGCCTGAGG + Intronic
1077540584 11:3144787-3144809 CTGGCGGGAGGTCAGGCCTGGGG + Intronic
1077650203 11:3964574-3964596 CAGGCTGCACCACTGGCCTGAGG - Intronic
1077730600 11:4725151-4725173 CATGGTGCTGGGCAGGCCTCAGG - Intronic
1077842991 11:5994952-5994974 CTGGCTGCAGGGATGGCCGGGGG - Intergenic
1077868935 11:6245311-6245333 CAGGCTCCAGGGCTGGCCAGAGG - Intergenic
1078371211 11:10747091-10747113 CAGGCTGGAGGGCAGTGATGTGG - Intergenic
1078447195 11:11413249-11413271 CTGGCTGCTGTGCATGCCTGAGG + Intronic
1078895912 11:15597082-15597104 CAAGTTGCAGGGCTGGGCTGAGG - Intergenic
1078934738 11:15941033-15941055 CAGGCTGCTGGGCAGGCAGAGGG - Intergenic
1080466255 11:32500165-32500187 AAGGGAGTAGGGCAGGCCTGAGG - Intergenic
1081502815 11:43682826-43682848 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1081810064 11:45909544-45909566 GAGCCTGCAGGGCAAGCATGGGG + Intergenic
1082798193 11:57393900-57393922 CAGGCTGCAGAACAGGTCTAGGG - Intronic
1083062782 11:59891887-59891909 CAGGCTGCTGTGCTGGCCAGTGG + Intergenic
1083299301 11:61732009-61732031 TAGGCTGCAGGCCAGGTCTGGGG - Intronic
1083738793 11:64696802-64696824 AAGGCAGCAGAGCAGGCATGAGG - Intronic
1083761637 11:64821906-64821928 CTAGCTTCAGGGCACGCCTGGGG - Intergenic
1083827478 11:65211688-65211710 CAGTCTGCAGTCCAGGCGTGTGG + Exonic
1083848801 11:65353520-65353542 AAGGCTGCAGGGCTGCACTGCGG - Intergenic
1083881114 11:65548711-65548733 CAGGCTGCATGGCAGGAGTGAGG - Intronic
1083961185 11:66015877-66015899 CAGGGTGCAGTTCAGGCCGGAGG - Intergenic
1084114317 11:67033038-67033060 CAGACAGCAGGGCAGGCTAGAGG + Intronic
1084220458 11:67674534-67674556 CAGTCAGCAGAGCAGGGCTGAGG - Exonic
1084420326 11:69057519-69057541 CTGGCTGCAGGGCCAGCGTGTGG + Intronic
1084442143 11:69180642-69180664 AAGGCTGGAGGGAAGGCCGGGGG + Intergenic
1084681763 11:70670493-70670515 CTGGCTGCAGGGCAGCACAGAGG + Intronic
1084717432 11:70882898-70882920 CAAACTGCAGGGCAGGCAGGAGG + Intronic
1084727138 11:70949323-70949345 CGGGCAGCATGCCAGGCCTGGGG - Intronic
1084957022 11:72696966-72696988 CGGGCTGCAGGGCCCACCTGAGG + Exonic
1084961818 11:72720905-72720927 CAGACAGCAGGGCTGGCCTGTGG - Intronic
1085259396 11:75195694-75195716 CAGGCTGCAGAGGAGGCCAAAGG - Intronic
1085308567 11:75502188-75502210 CAGGTGGCAGGGCTGCCCTGAGG - Intronic
1085401671 11:76239494-76239516 GAGTCTTCAGGGCAGGCCTCAGG - Intergenic
1085765075 11:79275581-79275603 CAGGAATCAGGGAAGGCCTGGGG - Intronic
1085786352 11:79454740-79454762 CAGGCTGGAGTGCAGTGCTGTGG + Intergenic
1087155294 11:94895916-94895938 CAGCCTGGAGGGCTGGGCTGGGG - Intergenic
1087233974 11:95697729-95697751 AAGGCTGCAGGGCCTGCCTATGG + Intergenic
1088020381 11:105111682-105111704 CAGGCTGCTATGCTGGCCTGTGG - Intergenic
1088055236 11:105567424-105567446 CAGGCTGGAGTGCAGCCGTGTGG + Intergenic
1089014269 11:115153880-115153902 CAGGCAGCCGGGGCGGCCTGGGG + Intergenic
1089070036 11:115692787-115692809 CATCCAGCAGGGCTGGCCTGGGG - Intergenic
1089700526 11:120241359-120241381 CAAGAAGCAGAGCAGGCCTGAGG + Intronic
1089879704 11:121762069-121762091 CAGGCTGCAGGGGAGCTCTGTGG + Intergenic
1090239970 11:125174982-125175004 CAGGCTTCAGGGAAGGCTGGAGG - Intronic
1090868969 11:130726236-130726258 CTGGCTGCAGGGCAGGATGGGGG - Intergenic
1091332167 11:134738143-134738165 CAGGGTGGAGCCCAGGCCTGGGG - Intergenic
1091669057 12:2439337-2439359 CAACCTACAGGGCAGGCATGGGG - Intronic
1091766020 12:3120421-3120443 CAGGCTCCAGGGGAAGGCTGTGG - Intronic
1092126840 12:6080532-6080554 TAGGCTGCAGGGCAGGAGGGAGG + Intronic
1092154754 12:6274843-6274865 GGGGCTGCAGAGCAGGGCTGAGG - Intergenic
1092713584 12:11364748-11364770 CAGGCTGCAGTGCAGTGGTGCGG + Intronic
1092931310 12:13318397-13318419 GAGGCTGCATGCCATGCCTGAGG + Intergenic
1093147899 12:15588624-15588646 CATGCTGTAAGGCAGGTCTGGGG + Intronic
1093981072 12:25476385-25476407 GAGGTTGCAGAGCAGGCCTCAGG + Exonic
1094100880 12:26761059-26761081 CAGGCTTCAGGCCAGGCCCATGG + Intronic
1094199172 12:27779949-27779971 CAGCCGGCAGGTCAGGCCGGCGG + Intergenic
1094273802 12:28646031-28646053 CAGGCTGCTGTGCTGGCCCGCGG + Intergenic
1095444933 12:42273833-42273855 CTCCCTGCAGGGCAGGGCTGAGG - Intronic
1096149720 12:49301270-49301292 CAGGTGGCAGAGCAGGCCAGGGG - Intergenic
1096824480 12:54264200-54264222 CAGGCTGCAGTGCAGTGGTGCGG + Intronic
1097055065 12:56244181-56244203 CAGGGTGCAGGGCAGGAGTTGGG + Intronic
1097180998 12:57171901-57171923 CAGGCTGGAGGGCAGGGCCAGGG - Intronic
1097250277 12:57628678-57628700 CAGGCTGAACGGCAGGCCAGAGG - Intronic
1097773978 12:63624434-63624456 CATACTGCAGGGCTGGGCTGTGG - Intronic
1098142352 12:67463011-67463033 CTGGATGCAGGGCAGGTGTGTGG + Intergenic
1099882118 12:88479858-88479880 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1101446296 12:104739003-104739025 CAGCCTGCTGGGCAGGGGTGAGG + Intronic
1101736785 12:107469174-107469196 ATGTCTGCAGGGGAGGCCTGTGG - Intronic
1102260258 12:111439010-111439032 CAGGCTGCAGTGCAGTGCAGTGG + Intronic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1102927014 12:116833955-116833977 AAGGCTGGAGGGCCGGCCTAAGG + Intronic
1103010513 12:117455089-117455111 AGGGATGCAGAGCAGGCCTGAGG + Exonic
1103217009 12:119209309-119209331 CAGGCTGAAGGGCAGTGGTGCGG + Intronic
1103363807 12:120368739-120368761 CAGGGCGCAGGGCCGGGCTGGGG + Intronic
1103809434 12:123601941-123601963 CAGGCGGCGGGGCAGGCCTGGGG - Intergenic
1103943734 12:124514775-124514797 CAGGCTGGAGTGCAGAGCTGTGG - Intronic
1103949341 12:124542647-124542669 CAGCCTGCAGGGAAGGCTTCTGG - Intronic
1104331025 12:127845188-127845210 CAGGCTGGAGTGCAGTGCTGTGG + Intergenic
1104444811 12:128824225-128824247 CAGGCTGGAGCGCAGTCATGCGG + Intergenic
1104648509 12:130514141-130514163 CAGGCTGCAGGACAGATCTGGGG + Intronic
1104948652 12:132428788-132428810 CAGCCTGCAGCTCAGCCCTGCGG - Intergenic
1104966992 12:132512772-132512794 CAGGCTGCCAGGGAGGGCTGAGG + Intronic
1105471235 13:20696672-20696694 CAGGCTGCAGTGCAGTGGTGCGG - Intergenic
1105740402 13:23317148-23317170 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
1105743025 13:23348630-23348652 CAGACTGCAGGGCAGGGGTGAGG + Intronic
1106033325 13:26021978-26022000 CAGGATGCAGAGAGGGCCTGAGG + Exonic
1106234791 13:27852689-27852711 CAGGCTCCAGCGCAGACCTGTGG - Intergenic
1106760014 13:32858991-32859013 AAGGGTGCAGGCCAGGCCTGGGG + Intergenic
1107707870 13:43124793-43124815 CTGCCTGCAGCACAGGCCTGGGG + Intergenic
1108211026 13:48139897-48139919 CAGGATGCAGGGGAGCTCTGGGG - Intergenic
1108394699 13:49980943-49980965 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1108510076 13:51148211-51148233 CAGGCTGCTGGCAAGGCCTGGGG - Intergenic
1110860620 13:80341480-80341502 CGGGCGGCAGGACCGGCCTGGGG - Intergenic
1113789743 13:113022047-113022069 CAGTCAGCAGGGCAGCCTTGGGG - Intronic
1113922999 13:113924812-113924834 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1113951865 13:114076405-114076427 CTGGCTCCAGGCCAGGCCTCAGG + Intronic
1114132121 14:19803020-19803042 CAGGCTGGAGGGCAGTGGTGCGG + Intronic
1114529945 14:23389346-23389368 CAGGCTTGATGGCAGCCCTGGGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1114815592 14:25954366-25954388 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1116312354 14:43342563-43342585 CAGGCTGCTGTGCTGGCCAGCGG + Intergenic
1116487410 14:45467199-45467221 CTGGCTGCAGGGTTGGCCTTTGG + Intergenic
1117277920 14:54208295-54208317 CAGACTGCAGAGGAAGCCTGCGG - Intergenic
1117513164 14:56473004-56473026 CAGGCTGGATGGAAGGACTGTGG + Intergenic
1117656478 14:57961339-57961361 CAGGCTGCATTGCAGAGCTGAGG + Intronic
1118049032 14:62005801-62005823 CAGTCTGAAGGAGAGGCCTGTGG - Intronic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1118585412 14:67347954-67347976 CAGGCTGCAGTGCAGTGGTGTGG + Intronic
1118599821 14:67464287-67464309 GAGGCTGCAGGGAGAGCCTGGGG - Intronic
1118722559 14:68604642-68604664 GAGGCAGGAGGGCAGCCCTGGGG - Intronic
1118864698 14:69693767-69693789 AAGGCTGCAGAGCAGGCCCCTGG + Intronic
1118999831 14:70871954-70871976 CAGGCCCCAGGGCAGTCTTGGGG - Intergenic
1119465802 14:74857332-74857354 TGGACTGCATGGCAGGCCTGGGG + Intronic
1119480272 14:74954392-74954414 CCTGCTGCAGGGCTGGCCAGAGG - Intronic
1119700864 14:76753583-76753605 CAGGCTGCAGTGCAGGCTGGGGG - Intergenic
1119780109 14:77271492-77271514 TGGCCTGCAGGTCAGGCCTGGGG + Intergenic
1119780871 14:77276121-77276143 CAGGCTTAAGGGCTGGCCTTGGG + Exonic
1120039810 14:79739602-79739624 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1120206017 14:81588602-81588624 AAGGGAGCAGGGCAGGGCTGGGG + Intergenic
1121520190 14:94581008-94581030 CAGTCAGCATAGCAGGCCTGTGG + Intronic
1121642792 14:95497082-95497104 GAGGCTCCAGGGCTGGGCTGAGG + Intergenic
1121733029 14:96199527-96199549 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1121798356 14:96754040-96754062 CAGGCTGTTGGACAGGTCTGTGG - Intergenic
1122044277 14:99012204-99012226 AAGTGTGCAGGGCAGGCCTTTGG - Intergenic
1122119814 14:99546253-99546275 CAGGCTCCGGGGCAGAGCTGTGG - Intronic
1122328070 14:100894604-100894626 CTGGCAGCAGGTGAGGCCTGGGG + Intergenic
1122503271 14:102215905-102215927 CAGGCAGGGGGGTAGGCCTGCGG - Intronic
1122599511 14:102914385-102914407 GAGGCTGGAGGCCAGGCCTGGGG + Intergenic
1122599835 14:102915704-102915726 CAGGCTGCAGCCCTGGCCTGGGG - Intergenic
1122642596 14:103169035-103169057 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1122786817 14:104167797-104167819 CTGGCTGCAGAGCAGGCCGAGGG - Intronic
1122815426 14:104309796-104309818 TTGGCATCAGGGCAGGCCTGTGG - Intergenic
1122909379 14:104819618-104819640 CAGGCAGGGTGGCAGGCCTGGGG + Intergenic
1122986273 14:105213069-105213091 CAGGCTGGAGGCCTGGCCTGAGG - Intronic
1123017885 14:105384244-105384266 AAGGCAGCAGCACAGGCCTGGGG + Intronic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1202888950 14_KI270722v1_random:137211-137233 CAGGCTGGAGTGCAGTCGTGTGG + Intergenic
1202892082 14_KI270722v1_random:168249-168271 CAGCCAGCAGGACAGGCCAGGGG - Intergenic
1123473172 15:20569528-20569550 CACCCTCCAGGGCAGTCCTGTGG + Intergenic
1123575202 15:21658738-21658760 CAGGCTGGAGGGCAGTGGTGCGG + Intergenic
1123611819 15:22101227-22101249 CAGGCTGGAGGGCAGTGGTGCGG + Intergenic
1123644834 15:22430825-22430847 CACCCTCCAGGGCAGTCCTGTGG - Intergenic
1123733473 15:23164539-23164561 CACCCTCCAGGGCAGTCCTGTGG + Intergenic
1123751603 15:23361914-23361936 CACCCTCCAGGGCAGTCCTGTGG + Intronic
1124283976 15:28385839-28385861 CACCCTCCAGGGCAGTCCTGTGG + Intronic
1124298721 15:28525775-28525797 CACCCTCCAGGGCAGTCCTGTGG - Intronic
1124378398 15:29143431-29143453 CAGGCTGCAGGGCTGCCTTGGGG + Intronic
1124426958 15:29570667-29570689 CAGGCTGCGGGGCAGCGCGGCGG + Exonic
1124435496 15:29645600-29645622 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1124690047 15:31814315-31814337 CTTGCGGCAGGGCAGGCCTAGGG - Intronic
1124960001 15:34386835-34386857 GAGGTTGGAGGGCTGGCCTGCGG + Intronic
1124976630 15:34533056-34533078 GAGGTTGGAGGGCTGGCCTGCGG + Intronic
1125301531 15:38259294-38259316 CAGGCTGGAGGGCAGTACAGTGG + Intronic
1125348123 15:38740319-38740341 CAGGCTGCAGTGGAAGCATGGGG + Intergenic
1125404893 15:39341897-39341919 CAGGCAGGTGGGCAGGCCTTTGG - Intergenic
1126478009 15:49087608-49087630 CAGGCTGGAGGGCAGTGGTGTGG + Intergenic
1128281625 15:66399493-66399515 CAGGCTGCAGCGCAGTGGTGTGG + Intronic
1128310984 15:66631741-66631763 CAGGCCCCAGGGCAGGGATGTGG + Intronic
1128338488 15:66803470-66803492 AAGCCTGCAGGAGAGGCCTGTGG + Intergenic
1128517075 15:68349064-68349086 CAGGGTGCTGGGGAGGGCTGAGG - Intronic
1128705999 15:69837814-69837836 CAGGGAGCAGAGCAGGCGTGAGG - Intergenic
1128736408 15:70056321-70056343 CAGGCTTGAGGGGAGGCCTGTGG + Exonic
1128762553 15:70227314-70227336 GAGGGAGCAGGGCAGGGCTGGGG - Intergenic
1129206766 15:74041888-74041910 CAGAGTCCAGGGCAGGCCTTGGG - Intronic
1129274387 15:74435417-74435439 CAGGCTTAGGTGCAGGCCTGAGG - Intergenic
1129446983 15:75625574-75625596 CAGAGTGCAGGGCCGGCCAGAGG + Exonic
1129952054 15:79600644-79600666 CAGTCTGAAGGGCAGGCGTGGGG - Intergenic
1130086791 15:80784379-80784401 CAGGCTCCTGGGGAAGCCTGTGG - Intronic
1130531209 15:84748766-84748788 CAGGCTGCAGGGCCGGGCCCCGG - Intronic
1130957710 15:88639136-88639158 CAGGCTGCGGGGCAGGCCAGAGG + Intronic
1131061414 15:89406995-89407017 GAGGCATCCGGGCAGGCCTGAGG + Intergenic
1131260314 15:90884415-90884437 CAGGCCCCGGGGCGGGCCTGTGG - Exonic
1131392005 15:92057261-92057283 CAGGCTGCAGGGCTGCCCTAGGG - Intronic
1131675849 15:94669204-94669226 CAGGATGGAGGGCAGAGCTGTGG + Intergenic
1131872578 15:96777274-96777296 GAGCCTGCAGGGCAGGGCTGTGG + Intergenic
1132347330 15:101116204-101116226 CACGCAGCAGGGCCAGCCTGGGG + Intergenic
1132381417 15:101369175-101369197 CAGGCTGCTGGGCAGTGCTGTGG + Intronic
1132381724 15:101370858-101370880 CAGGCTGCTGGGCAGTGCTGTGG + Intronic
1132410786 15:101577063-101577085 GAGGCTGCTGGGAAGGGCTGGGG - Intergenic
1202984070 15_KI270727v1_random:392982-393004 CAGGCTGGAGGGCAGTGGTGCGG + Intergenic
1132571367 16:645784-645806 CAGGCTGAGGGGCTGGCTTGGGG + Intronic
1132597641 16:760629-760651 CAGGCAGCGGGCCAGGCCTGGGG - Intronic
1132631391 16:919347-919369 CAGGGGGCAGGGCAGCCCTGTGG + Intronic
1132748754 16:1447711-1447733 CAGGCTGCAAGACAGGCCCGCGG + Exonic
1132806620 16:1777970-1777992 CAGCCTGCTGGGCAGGGATGAGG - Exonic
1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG + Intronic
1132987322 16:2774368-2774390 CTGGCAGCAGGCCAGACCTGGGG + Intronic
1133024079 16:2980178-2980200 CGGGCCGCCGGGGAGGCCTGAGG + Intronic
1133162339 16:3920421-3920443 CTGGCTGCAGGGAAGTCCAGGGG + Intergenic
1133219538 16:4313944-4313966 TCGGCTGCAGGGCAGGGCTCCGG + Intergenic
1133229324 16:4359239-4359261 CAGGGGGCAGGGCAGCCTTGTGG + Intronic
1133291159 16:4722087-4722109 CAGGGTGGGGGACAGGCCTGCGG + Intronic
1133623148 16:7545479-7545501 AAGGCTGCAGGGAAGGTCGGGGG - Intronic
1134410805 16:14001800-14001822 CAGGCTGCAGATCAAGCTTGGGG - Intergenic
1134634848 16:15784446-15784468 CAGGCTGGAGCGCAACCCTGGGG + Intronic
1135335015 16:21593979-21594001 CAGGCTGGAGTGCAGTGCTGTGG + Intergenic
1135991342 16:27220615-27220637 CAGGATGCAGGACAGGAATGGGG - Exonic
1136247223 16:28983053-28983075 GAGGTCGCAGGGCAGGCCGGGGG - Intronic
1136273773 16:29165891-29165913 CAGGCGGCAGGGAGGGCCTGGGG + Intergenic
1136399730 16:30010873-30010895 CAGGGGGCTGGGCAGGCCGGGGG - Intronic
1137341739 16:47614099-47614121 CAGGCTTCTGGGGAGGCCTCAGG + Intronic
1137636701 16:49993045-49993067 CAGGCCGCAGGGGAGGCCGGAGG + Intergenic
1137821490 16:51449663-51449685 CAGACTGTGGGGGAGGCCTGGGG - Intergenic
1138452751 16:57103570-57103592 GATGGTGAAGGGCAGGCCTGAGG - Intronic
1138591153 16:58000411-58000433 CCGCCTGCAGGGCAGGCGCGGGG + Intronic
1138651681 16:58464471-58464493 CCGGCTGCGGGGCAGGCGGGCGG - Intronic
1139254943 16:65531700-65531722 CAGGCTCCAGGGCAGGTATTGGG - Intergenic
1139447981 16:67009996-67010018 CGGGCTGCAGGAGAGGCCAGAGG - Intergenic
1139562141 16:67749893-67749915 CAAGCTGGTGGGCATGCCTGGGG - Intronic
1139692496 16:68650151-68650173 CGGGCCCCTGGGCAGGCCTGAGG + Intronic
1140209686 16:72960329-72960351 CAGGGCGGAGGGCGGGCCTGGGG + Intronic
1140818044 16:78638644-78638666 CAGGCTGGAGGGAAGGGCGGGGG + Intronic
1140866748 16:79068764-79068786 CAGGCTGCAGGGCAGTGGTGAGG - Intronic
1141085932 16:81095880-81095902 CAGCCGGGAGGGGAGGCCTGCGG - Intronic
1141297326 16:82782220-82782242 CAGGATTCAGGGTGGGCCTGTGG + Intronic
1141427014 16:83951245-83951267 CTGACTCCAGGGCAGGGCTGTGG + Exonic
1141439775 16:84022468-84022490 CAGGCAGCAGGGCTGGGGTGTGG + Intronic
1141624289 16:85253262-85253284 CAGACTCCAGGGCAGGACTGGGG - Intergenic
1141702108 16:85647240-85647262 GAGGGTGCAGGGCAGGCAGGAGG - Intronic
1141873509 16:86805961-86805983 GAGGCTGCAGGGTTGGCCTATGG + Intergenic
1142077315 16:88127636-88127658 GAGGCGGCAGGGAGGGCCTGGGG + Intergenic
1142120118 16:88383017-88383039 CTGGCTGCAGGGCTGGCCCGCGG + Intergenic
1142312360 16:89321385-89321407 GGGGCTGCAGGGCGGGACTGTGG + Intronic
1142721238 17:1777305-1777327 CAGGCTGCAGCCCTGGGCTGGGG - Exonic
1142812245 17:2400776-2400798 CAGGCTGGCGGGCAGGCAGGAGG + Exonic
1143094950 17:4473833-4473855 CAGGATGCAGGGGATGGCTGTGG + Intronic
1143395262 17:6589558-6589580 AAGGCTGCAGAGCACCCCTGTGG + Intronic
1143499837 17:7332176-7332198 CAGGCTGCAGGACAGTTTTGAGG + Intergenic
1143586538 17:7853426-7853448 CAGGCTGCAGGGACGGGCTTCGG + Exonic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1143779969 17:9224313-9224335 CAGGGCGCAGGGAAGGCCTAAGG - Intronic
1144659131 17:17057139-17057161 CAGTCTGCAGGGCTGACATGTGG - Intronic
1144769961 17:17754108-17754130 CAGGCTGCACAGCTGGCCAGTGG - Intronic
1144807690 17:17978598-17978620 CTGGCAGCAGGGCTGGACTGAGG - Intronic
1145781971 17:27569392-27569414 CAGTCAGCAGGACAGGCTTGCGG - Intronic
1146054623 17:29574896-29574918 CTGGCTCCAGGGCTGGCCTCTGG + Exonic
1146295839 17:31649682-31649704 CAGCCTGCAGGACTGCCCTGTGG - Intergenic
1146579563 17:34024706-34024728 AGGGGTGCAGGGCAGGCCTGAGG + Intronic
1146886544 17:36474680-36474702 CAGGCCCCAGGGCAGTCTTGGGG - Intergenic
1147320626 17:39643717-39643739 ATGGCTTCAGGGCAGGGCTGGGG - Intronic
1147427362 17:40352242-40352264 CTGGGTAGAGGGCAGGCCTGTGG + Intronic
1147575567 17:41597101-41597123 CAGGCTGGAGTGCAGTGCTGTGG - Intergenic
1147578926 17:41617797-41617819 CAGGAAGCAGGGAGGGCCTGGGG - Intergenic
1147626767 17:41905462-41905484 CAGCCTGCTGGGCTGTCCTGGGG + Intronic
1147651081 17:42062416-42062438 CAGGCTCCAGCTCAGGTCTGTGG - Intronic
1147871759 17:43592454-43592476 TAGGCCCCAGGGGAGGCCTGGGG + Intergenic
1147911652 17:43859676-43859698 CTTGGTGCAGGGCAGACCTGGGG - Intronic
1147955944 17:44134598-44134620 CAGGCTGGAGGGAAGGCATTTGG - Intergenic
1147970527 17:44217312-44217334 CAGGATACAGGGCAGCTCTGAGG + Intronic
1147997559 17:44369033-44369055 CTTCCTGCAGGGCAGGGCTGGGG + Intergenic
1148512812 17:48187309-48187331 CTGGCTGAAGGGCATGCCTTGGG + Intronic
1148742769 17:49902123-49902145 CAGACGGCAGGGCTGCCCTGTGG + Intergenic
1148861079 17:50604624-50604646 TGGGCTGCAGGCCAGGTCTGGGG + Intronic
1149224544 17:54454046-54454068 CTGGCTGCACTGCAGCCCTGGGG - Intergenic
1149833275 17:59890286-59890308 CAGGCTGGAGGGCAGTGGTGCGG + Intronic
1150003481 17:61456019-61456041 CAGGCTGGAGGGCAGGGCCCAGG - Intronic
1150480307 17:65503989-65504011 GAGGATGCAGGGAAAGCCTGGGG + Intergenic
1150765398 17:67997953-67997975 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1151218005 17:72591188-72591210 CAGGCTGCAGGAGAGGGGTGAGG + Intergenic
1151351482 17:73534589-73534611 AAGGCAGCAGGGAAGGCCGGTGG + Intronic
1151386678 17:73759342-73759364 CAGGCTGAAGGGCAGGAGAGTGG - Intergenic
1151387004 17:73761130-73761152 AAGGCTGCAGGACAGGGCTTGGG - Intergenic
1151445488 17:74160848-74160870 CATCCTGGGGGGCAGGCCTGAGG + Intergenic
1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG + Intronic
1152092777 17:78256321-78256343 CCAGCTCCAGGTCAGGCCTGGGG + Intergenic
1152228523 17:79103566-79103588 CAGGGGGCAGGCCTGGCCTGTGG - Intronic
1152228912 17:79105078-79105100 CAGGCTTCAGGACAGGCCCTGGG - Intronic
1152260186 17:79262604-79262626 CAGGCTGGTGGGAAGGGCTGTGG + Intronic
1152355972 17:79807490-79807512 CAGGGGGCAGGGCAGGGCAGAGG + Intergenic
1152457969 17:80426943-80426965 CAGGCTGCAGGGCAAGCGGTGGG - Intronic
1152476228 17:80520200-80520222 GAGGCTGCAGCGCAGGCTTGGGG + Intergenic
1152546094 17:81000744-81000766 CAGGCTGCCTGGCAGTCCTGGGG - Intronic
1152762055 17:82113966-82113988 CAAGCTGCAGGGCAGGCAAGGGG - Intronic
1152836839 17:82538753-82538775 CTGGCCCCAGGGCAGGCCTGGGG + Intronic
1153808702 18:8733155-8733177 CAGGGCGCAGGGCAGCCCTCGGG + Intronic
1153926617 18:9840153-9840175 CAGGGGACAGGGCTGGCCTGGGG + Intronic
1154048184 18:10927390-10927412 CAGGTTGCAGCGCAGGCCGTGGG + Intronic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1155871723 18:31037851-31037873 CAGGCTGGAGTGCAGGCTGGAGG - Intronic
1156459672 18:37314706-37314728 CAAGCTGCAGGGGAGGCTGGAGG - Intronic
1156970450 18:43147860-43147882 CAGGCTGGAGTGCAGGGCAGTGG - Intergenic
1157239083 18:45992760-45992782 CAGGCTGCAGTGCAGTGCAGTGG + Intronic
1157474414 18:48012159-48012181 CAGGCAGGAGGGGAGGCCAGGGG + Intergenic
1157591985 18:48841664-48841686 CAGGCTGGTGGGCAGGCAGGCGG + Intronic
1157744260 18:50120961-50120983 CGGGCTGGAGGGCAGGCTGGAGG - Intronic
1157894061 18:51447576-51447598 CAGGCTGCAGGGCTGTGCTCTGG - Intergenic
1158936886 18:62373051-62373073 CAGGCCGCAGGTCAGGGATGGGG - Intronic
1159308693 18:66679605-66679627 CAGGCTGGAGTGCAGTGCTGTGG + Intergenic
1159586872 18:70289631-70289653 CAGGCGCGAGGGCGGGCCTGGGG + Intronic
1159725605 18:71953805-71953827 CAGGCTGCAGTGCAGCGCAGTGG + Intergenic
1160135033 18:76264550-76264572 CAGGGTGGAGGGCAGGGCAGAGG + Intergenic
1160262257 18:77305505-77305527 CAGTCTGTAGAGCAGACCTGAGG + Intergenic
1160342342 18:78100459-78100481 CATTCTGCAGGGCTGGCCCGAGG - Intergenic
1160462296 18:79048335-79048357 TAGGCTGCAGAGAAGGCCAGGGG + Intergenic
1160590903 18:79944185-79944207 GAGGCTGCAGGGAGGGCCTGGGG - Intronic
1160724671 19:612772-612794 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1160731807 19:644624-644646 CTGGGTGCAGGGCAGGCCTGGGG + Intergenic
1160797962 19:954409-954431 GGGGCCACAGGGCAGGCCTGGGG - Intronic
1160822535 19:1065205-1065227 CAGGCTGGGGGCCAGGCCCGTGG + Intronic
1160930209 19:1566836-1566858 CAGCCTGCTGGGCAGGCCGGCGG - Intronic
1161035139 19:2080205-2080227 CAGGGTGCTGGGCAGGGCGGGGG + Intronic
1161326804 19:3668037-3668059 CAGGAGCCAGGGCAGGGCTGGGG - Intronic
1161380273 19:3961158-3961180 CAGGCTGCGAGACAGGCGTGGGG + Exonic
1161527248 19:4764029-4764051 CAGGCTGCAGGTCAGGTTTCGGG + Intergenic
1161765590 19:6206430-6206452 CAGGCTGGAGTGCAGTCGTGCGG - Intergenic
1161932524 19:7350204-7350226 AATGCTGCAGGGCAGGCTTCAGG + Intronic
1162531241 19:11237565-11237587 GAGGCTGGAGGTCAGGTCTGCGG + Exonic
1162926610 19:13933377-13933399 CAGGGTCCGGGGCAGGCCGGCGG + Exonic
1163528655 19:17836707-17836729 GAGGCTGCTGGGCCAGCCTGGGG - Intronic
1163706294 19:18815546-18815568 CAGGCTGGAGTGCAGGCTGGTGG - Intergenic
1163715079 19:18868702-18868724 CACGCAGCAGGGCAGGTCGGCGG + Exonic
1163786314 19:19276775-19276797 GAGGTGGCAGGGCAGGCTTGGGG + Intronic
1164320258 19:24137924-24137946 CAGGCAGCAGGGAGGCCCTGGGG - Intergenic
1164402106 19:27909741-27909763 CAGGGGGCAGGGCAGAGCTGAGG - Intergenic
1164780084 19:30884884-30884906 CAAGCTACAGGGCAAGGCTGTGG + Intergenic
1165169375 19:33880371-33880393 CAGGATGCCCGGGAGGCCTGTGG - Intergenic
1165309678 19:35022633-35022655 CAGGCTTCTGGGCAGGAGTGTGG - Intronic
1165421573 19:35724674-35724696 CAGGCTGCAGGGTAGGTTTGCGG - Exonic
1165461020 19:35944529-35944551 CATCCTGCAGGGCAGGCAGGTGG - Exonic
1165495255 19:36148945-36148967 CAAGTTTCAGGGCAGGCGTGGGG + Intronic
1166302981 19:41922620-41922642 GAGGCAGTGGGGCAGGCCTGAGG + Intronic
1166356834 19:42232374-42232396 CAGGGTACAAGGCAGGCCTGGGG - Intronic
1166500495 19:43337607-43337629 AAGTCTGCAGGGCAGGCCCTGGG + Intergenic
1166509629 19:43396092-43396114 AAGTCTGCAGGGCAGGCCCTGGG - Intergenic
1166820363 19:45575649-45575671 CAGGCTGGAGTGCAGGGGTGCGG + Intronic
1166859294 19:45800517-45800539 GAGGCTGCAGGACAGGCGGGTGG + Exonic
1167078635 19:47264516-47264538 CGGGCTGCCCAGCAGGCCTGAGG - Intronic
1167348733 19:48962456-48962478 GAGGCTGGAGGGCAGGGCAGAGG + Intergenic
1167369013 19:49069986-49070008 CAGGGTGGAGGGCAAGGCTGGGG - Exonic
1167418714 19:49390464-49390486 CAGACTGGAGGACAAGCCTGGGG + Intronic
1167608912 19:50496799-50496821 CAGCCAGCTGGGGAGGCCTGTGG - Intergenic
1167660525 19:50793606-50793628 CAGGGGGCAGCACAGGCCTGCGG + Intronic
1168148037 19:54430429-54430451 CGGGCTCCAGGGCTGGGCTGAGG + Intronic
1168409066 19:56127365-56127387 CAGACAGCGGGCCAGGCCTGGGG - Intergenic
1202664347 1_KI270708v1_random:104005-104027 CAGGCTGGAGTGCAGTCGTGTGG + Intergenic
925097687 2:1220355-1220377 CAGGATCCAGGCCAGGCTTGTGG + Intronic
925133526 2:1511162-1511184 CAGTCTGCAGGGCTGTGCTGTGG - Intronic
925133533 2:1511191-1511213 CAGTCTGCAGGGCTGTGCTGTGG - Intronic
925133547 2:1511249-1511271 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133554 2:1511278-1511300 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133561 2:1511307-1511329 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133568 2:1511336-1511358 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133575 2:1511365-1511387 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133582 2:1511394-1511416 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133589 2:1511423-1511445 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133596 2:1511452-1511474 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133603 2:1511481-1511503 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925133610 2:1511510-1511532 CAGTCTGCAGGGCTGCGCTGTGG - Intronic
925183286 2:1830706-1830728 CAGGAGGAAGGCCAGGCCTGGGG + Intronic
925812495 2:7714071-7714093 AAGGCTGCTGGGCAGGACAGAGG - Intergenic
925924315 2:8659455-8659477 CTGGCTGCTGAGCAGGCCTCTGG + Intergenic
926163029 2:10501606-10501628 CGGGGTGGAGGGCAGGCCTGGGG - Intergenic
926277810 2:11418203-11418225 CAGGCTGCGGGTCAAGCCTGTGG - Intergenic
926303316 2:11618975-11618997 CCATCTGGAGGGCAGGCCTGGGG + Intronic
927143819 2:20147427-20147449 CAGTCTGCAGGGCTGTCCAGGGG - Intergenic
927683432 2:25154959-25154981 CAGGATGCAGGGCTGGCAGGAGG + Exonic
927706112 2:25297430-25297452 CAGGCTGGGGTGCAGGCCTATGG - Intronic
927719230 2:25372448-25372470 GTGGCCGCACGGCAGGCCTGAGG - Intergenic
927842976 2:26457045-26457067 CAGGGTTCAAGGCAGGCCTCAGG - Intergenic
927940505 2:27100309-27100331 CAGGCTGGTGGGCAGGGCAGAGG - Exonic
928001401 2:27525994-27526016 CAGGCTGCAGTGCAGTGGTGCGG + Intergenic
928071613 2:28222917-28222939 CAGAGTGCGGGGCGGGCCTGCGG - Intronic
928225440 2:29444299-29444321 CAAGATGCAGGGCAGGCAGGTGG + Intronic
928632539 2:33208669-33208691 AAAGCTCCAGGGCAGGGCTGAGG - Intronic
929441452 2:41968405-41968427 CAGGTTGCAGGGCAGGACTCAGG - Intergenic
929803070 2:45120912-45120934 CATGCTGCATGGCTGGGCTGGGG + Intergenic
930166060 2:48204885-48204907 CAGGCAGCAGTGAAGCCCTGCGG + Intergenic
930448610 2:51505941-51505963 CAGGCTCCAGGCCAGTACTGGGG - Intergenic
931482393 2:62654676-62654698 CAGTCTGCAAGACTGGCCTGAGG - Intergenic
931731453 2:65157101-65157123 CAGGCTGGAGTGCAGTGCTGCGG - Intergenic
931804454 2:65790482-65790504 GAGGCTGGAGGGCTGGGCTGGGG + Intergenic
932091949 2:68813741-68813763 CAGGCTGGAAGGCAGGTGTGAGG + Intronic
932417114 2:71580195-71580217 CAGGCAGCTTGGCAGTCCTGGGG + Intronic
932433767 2:71691070-71691092 CAGGCACCAGGGCAGGACAGGGG - Intergenic
932461281 2:71883453-71883475 CAGACTGCAGGTTTGGCCTGTGG + Intergenic
932592204 2:73074338-73074360 CAGGCGGGCAGGCAGGCCTGGGG - Exonic
932620189 2:73260585-73260607 CTGGCTGCAGGGGTGACCTGGGG - Intronic
932737551 2:74265017-74265039 CAGACTTGAGGGCAGGCATGAGG + Intronic
932781320 2:74560395-74560417 CAGCCTTCATGGCAGCCCTGGGG - Intronic
932967017 2:76488487-76488509 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
933719354 2:85387620-85387642 CAGGCTGGAGTGCAGGGCAGTGG - Intronic
934559733 2:95306953-95306975 CAGGCTGCTGGGGAGGCGGGAGG - Intronic
934561749 2:95317210-95317232 CTGGCTGCAGAGAAGCCCTGGGG + Intronic
934774626 2:96929231-96929253 GAGGGTACAGGGCAGGACTGTGG + Exonic
934855015 2:97724308-97724330 CAGGTTGCAGGGCAGCCCGTCGG - Exonic
935285430 2:101560174-101560196 CAGGCTGGAGTGCAGCCGTGCGG - Intergenic
935464968 2:103385409-103385431 CAGGATGCAGGGCAGAGATGGGG - Intergenic
935498283 2:103807826-103807848 CAATCTGCAGGGCAGGCTGGTGG + Intergenic
935675977 2:105595311-105595333 GAGGATGGAGGGCAGGCCAGTGG - Intergenic
935959762 2:108413459-108413481 CACCCTGCAGGGAATGCCTGAGG - Intergenic
936093403 2:109515013-109515035 CAGGCCCCAGGGCAGGGCTCTGG - Intergenic
936152338 2:110028673-110028695 GAGCCGGCAGGGCAGGGCTGTGG + Intergenic
936192341 2:110342739-110342761 GAGCCAGCAGGGCAGGGCTGTGG - Intergenic
936260939 2:110959236-110959258 CATGGTGCAGGGCAGGGCTGTGG - Intronic
936623898 2:114127689-114127711 CAGGCTGGAGGGCAGTGGTGTGG + Intergenic
937297470 2:120818218-120818240 AAGCCTGCAGGGCAGGGGTGTGG + Intronic
937333542 2:121046716-121046738 CAGGCTGCAGTGCAGTGATGTGG + Intergenic
937904874 2:127048231-127048253 CTGGCCGCAGGGCGGGGCTGGGG - Exonic
938050227 2:128163040-128163062 CAAGCTTCAGGGCAGCCTTGGGG - Intronic
938085275 2:128395838-128395860 CAGGCTGCTGGACAGGCCTTGGG + Intergenic
938255792 2:129858802-129858824 CAGGCTTTGGGGCAGGCGTGGGG + Intergenic
938457429 2:131475791-131475813 CAGGGAGAGGGGCAGGCCTGGGG + Intronic
938662834 2:133504991-133505013 CAGGCTGGATGACTGGCCTGAGG - Intronic
941879231 2:170464492-170464514 AAGGCTGAAGGGCAGGACTTGGG + Intronic
943081248 2:183261230-183261252 CCGGGAGCAGGGCAGGGCTGTGG - Intergenic
943293127 2:186101392-186101414 CAGGCTGGAGGGCAGTGCAGTGG - Intergenic
944225340 2:197343884-197343906 CAGACTGCAGTGCAGCTCTGAGG + Intergenic
944411453 2:199447185-199447207 CAGGCAGCAGGGGCTGCCTGGGG - Intronic
945069657 2:205977413-205977435 CTCCCTGCAGGGCAGGGCTGGGG + Intergenic
946145219 2:217725515-217725537 CAGGCAGCAGGGCAGGCTGATGG - Intronic
946241996 2:218362063-218362085 CCGGCTGAAGGCCAGGCGTGTGG + Intronic
946351868 2:219160585-219160607 CGGGGTCCAGGGCAGGCCTCCGG - Intronic
946966573 2:225042757-225042779 CAGGCTGCGGGGGAGGGCGGGGG + Intergenic
946989095 2:225307957-225307979 CAGGCTGGAGTGCAGGGCGGTGG - Intergenic
947288988 2:228550635-228550657 TTGGCTTCAGGGCAGGACTGAGG - Intergenic
947899905 2:233712620-233712642 CAGGCTGCAGCTGAGGTCTGAGG - Intronic
947900601 2:233718451-233718473 CAGGCTGCAGCTGAGGTCTGAGG - Intronic
948149311 2:235732649-235732671 AAGGCTGAAGAGCAGGGCTGGGG - Intronic
948198512 2:236112841-236112863 CCGCCTTCAGGACAGGCCTGGGG - Intronic
948362143 2:237429848-237429870 AAGGCTGCTGAGCAGCCCTGTGG + Intergenic
948449509 2:238060637-238060659 GAGGCGGCTGGGCAGTCCTGCGG - Intronic
948592395 2:239059831-239059853 CAGCCTGCAGGACAGTCCTCTGG + Intronic
948592409 2:239059874-239059896 CAGCCTGCAGGACAGTCCTCTGG + Intronic
948644413 2:239394854-239394876 CAGGGTACAGAGCAGGCATGAGG + Intronic
948766944 2:240227249-240227271 CAGGCTGCTGGGTAGGAGTGAGG + Intergenic
948807580 2:240459640-240459662 CAGAGTGCAGGGCCTGCCTGGGG + Intronic
949028086 2:241775590-241775612 GAGGATGCAGGGCACGCCGGTGG + Intergenic
1168799594 20:635591-635613 CAGGCAGGAGGGCAGGCCTGGGG - Intergenic
1168830222 20:841599-841621 GAGGCCGCGGGGCAGGGCTGGGG - Intronic
1169153206 20:3306748-3306770 CAGGCTACGGGGCAGCACTGTGG - Intronic
1169343689 20:4814177-4814199 CACCCTGCAGGGAGGGCCTGAGG + Intronic
1169758809 20:9068963-9068985 CAGGCGGGAGGGCGGGACTGGGG + Intronic
1170573516 20:17646222-17646244 CAGGCTCTTGGGCAGGCCTGTGG - Intronic
1171349336 20:24490803-24490825 CAGGCTCCAGGGCAGCACAGAGG + Intronic
1171383613 20:24752358-24752380 CAGGCTCCAGGGTGGCCCTGGGG - Intergenic
1172056278 20:32156649-32156671 CAGGCTGGAGTGCAGTGCTGTGG + Intronic
1172279036 20:33697875-33697897 CAGGCTGGAGTGCAGGGGTGTGG + Intergenic
1172620096 20:36313091-36313113 CAGGCGGCAGGTCAGGGGTGAGG - Intronic
1172623559 20:36334845-36334867 CAGGCTGAGAGGCAGGACTGGGG - Intronic
1172810503 20:37644264-37644286 CAGACTGCAGGGCAGGAGGGAGG - Intergenic
1172841760 20:37906172-37906194 CAAGCTCCAGGGCAGGCAGGTGG - Intronic
1172934875 20:38612957-38612979 CAGCCAGCAGCGCAGCCCTGTGG - Intronic
1172950062 20:38717459-38717481 GAGTCTGCAGGGCAGGGCTTGGG - Intergenic
1173422539 20:42915328-42915350 CAGGCTATAGGTAAGGCCTGTGG + Intronic
1173546756 20:43903719-43903741 CAGGCTGCAGCCAAGGCCTGGGG + Intergenic
1173665790 20:44762230-44762252 CAGGCTGCAGAGCAGGTGAGCGG - Intronic
1174022296 20:47540525-47540547 CAGGCTGCAGTACAATCCTGCGG - Intronic
1174287813 20:49484376-49484398 CAGCCTGCCGGGGAGGCCGGGGG + Intergenic
1175067610 20:56303026-56303048 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1175215281 20:57389293-57389315 CAGGCGGCAGGGCAGCCCCGGGG - Intergenic
1175399555 20:58692787-58692809 CGGGCTGCCGGGCAGGGCCGGGG + Exonic
1175550515 20:59814308-59814330 GAGGATGAACGGCAGGCCTGTGG + Intronic
1175757484 20:61538821-61538843 CCTGCTGCAGGCCAGGCATGGGG + Intronic
1175766429 20:61595829-61595851 CAGGCTCCAGTGCTGACCTGAGG + Intronic
1175963175 20:62647315-62647337 CTGGGTGCAGGGCAGGCATGTGG + Intronic
1175978094 20:62723645-62723667 AAGGGTGCAGGGCAGGGCAGTGG - Intronic
1175986457 20:62766280-62766302 CAGGCTCAGGGGCAGGGCTGGGG + Intergenic
1175994510 20:62806027-62806049 CAGGCAGCTGGGGAGGCCTGAGG - Intronic
1176131422 20:63498336-63498358 CAGCCTGCCGGGCAGGGATGAGG - Intronic
1176248646 20:64109587-64109609 CAGGCTGCCAGCCAGCCCTGGGG - Intergenic
1176668658 21:9711676-9711698 CAGGGTGGAGGGCAGTCTTGGGG - Intergenic
1177214989 21:18116647-18116669 GAGACTGAAGAGCAGGCCTGAGG + Intronic
1178294946 21:31401864-31401886 CAGGCTGGAGGGCAGTAGTGCGG - Intronic
1178399241 21:32270027-32270049 CAGGCTGGAGTGCAGTGCTGTGG - Intronic
1178440834 21:32596942-32596964 GAGGCAGCAGGTGAGGCCTGAGG + Intronic
1179497560 21:41783143-41783165 CAGGCTGGAGTGCAGTGCTGTGG + Intergenic
1179531177 21:42020622-42020644 CAGCATCCAGGGCAGGCCTGTGG + Intergenic
1179729889 21:43361831-43361853 CAAGCCGCCGGGCCGGCCTGTGG - Intergenic
1179787195 21:43736675-43736697 CAGGCTGGAGTGCAGTCCTGCGG + Intronic
1179797557 21:43794232-43794254 GAGGCTCCAGGGCAGGCCAGGGG + Intronic
1180068354 21:45424027-45424049 CAGGGTGCTGGGCAGTGCTGCGG + Intronic
1180091543 21:45536082-45536104 CTGGCTGCAGGAGAGGCCCGGGG - Intronic
1180137025 21:45868584-45868606 CAGGGAGCTGGGCAGGCATGGGG - Intronic
1180331075 22:11480889-11480911 CAGGCTGGAGTGCAGTCGTGTGG + Intergenic
1180670331 22:17548227-17548249 CAGTCTGCAGGGGAGGTGTGGGG - Exonic
1180675349 22:17582488-17582510 AGGGCTGAAGGGCAGACCTGGGG + Intronic
1180702304 22:17788234-17788256 AAGGCTGGGGCGCAGGCCTGCGG + Exonic
1180788262 22:18558848-18558870 TAGGCCACAGGGCTGGCCTGAGG - Intergenic
1180854995 22:19040101-19040123 CAGGCTGCAGAGCAGGGTGGGGG - Intronic
1181000387 22:19985341-19985363 CAGGCTGCTGCCCAGGCCTGGGG + Intronic
1181037630 22:20177575-20177597 CAGGGTGCACAGCAGGGCTGGGG - Intergenic
1181040093 22:20187996-20188018 CTGGCTGCAGGGCCTCCCTGTGG + Intergenic
1181050891 22:20237733-20237755 TGGGCTGCAGGGCAGGGCTCCGG + Intergenic
1181233476 22:21436470-21436492 TAGGCCACAGGGCTGGCCTGAGG + Intronic
1181245174 22:21498373-21498395 TAGGCCACAGGGCTGGCCTGAGG - Intergenic
1181439430 22:22928095-22928117 CAGGCAGGAGGGCAGCCATGGGG + Intergenic
1181479381 22:23188544-23188566 CAGGCTGCAGCTCACCCCTGTGG + Intronic
1181510773 22:23387905-23387927 CGGGCTGCAGCGCAGGGCAGGGG - Intergenic
1181747512 22:24966157-24966179 CAGGCCCCAGGTCAGGGCTGAGG + Intronic
1182300617 22:29334868-29334890 CAGGAGGCAGGGCTGGCCTTTGG + Intronic
1182548434 22:31088796-31088818 CAGACAGCAGGGCAGGGGTGGGG - Intronic
1182698865 22:32216075-32216097 CAGGCTGGAGTGCAGTGCTGCGG + Intergenic
1182830743 22:33302766-33302788 CAGGGTGACGGGCAGACCTGGGG + Intronic
1182913105 22:34004128-34004150 CAGCCTGCAGGGCACGCCCGAGG + Intergenic
1183063203 22:35347796-35347818 CAGGCTGCAGGTGAGGCTTCAGG + Exonic
1183308303 22:37095811-37095833 GAGGCTGCCTGCCAGGCCTGGGG - Intronic
1183329739 22:37212786-37212808 CCGACTGCAGGGCTGGACTGTGG - Intergenic
1183349251 22:37325429-37325451 CAGTGTGCCGGGCAGGCCAGGGG - Intergenic
1183376098 22:37466338-37466360 CAGGGTGGAGCCCAGGCCTGAGG + Intergenic
1183394153 22:37561781-37561803 CAGGCCGCAGTGCTGGCCAGGGG - Intronic
1183406010 22:37631020-37631042 CGGGCTGCTGCGGAGGCCTGGGG - Exonic
1183451006 22:37895074-37895096 CAGTCTGCAGGGCAGGCTGGGGG - Intergenic
1183485334 22:38085150-38085172 CAGGCTGCCGGGGTGGTCTGGGG + Exonic
1183500452 22:38175677-38175699 CAGGCTGCAGGGCGGAGGTGCGG - Intronic
1183659445 22:39210085-39210107 CAGGCACCAAGGCAGGCCTTAGG + Intergenic
1183720575 22:39559405-39559427 CAGGATCCAGGGCTGGGCTGGGG + Intergenic
1184096588 22:42319460-42319482 CAGGAGGCAGGGGAGGTCTGGGG - Intronic
1184246273 22:43237272-43237294 CCTGGTGCAGGGCAGGCATGTGG - Intronic
1184257307 22:43294610-43294632 CAGGCTACAGGGCAAGACAGGGG - Intronic
1184468323 22:44681871-44681893 CAGCCTGGAGGGCAGGCAGGAGG + Intronic
1184755894 22:46515553-46515575 CAAGCTGCAGGGCACCCCGGGGG + Intronic
1184785192 22:46668256-46668278 CAGGCAGCAGCGGAGGCCGGCGG - Intronic
1184985924 22:48134083-48134105 CAGGCACCAAGGCAGGGCTGGGG - Intergenic
1185024063 22:48397481-48397503 CTGGCTCCAGCGCAGGGCTGGGG - Intergenic
1185065672 22:48630708-48630730 CAGGCTGCAGGGCTGGCTACCGG + Intronic
1185107523 22:48882797-48882819 CCGGGTGCAGGGCAGAGCTGAGG - Intergenic
1185156461 22:49196132-49196154 CAGGCTGCAGGCCTGGCGTCTGG + Intergenic
1185214462 22:49590516-49590538 GAGGCTGCAGGGCGAGGCTGGGG + Intronic
1185266714 22:49907885-49907907 CAGGCTGCAGCCCAGGCCGCGGG + Exonic
949581584 3:5393815-5393837 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
950052373 3:10002426-10002448 CCAGCTGCAGTGCATGCCTGTGG - Intronic
950463693 3:13140739-13140761 AGGGGTGCAGGGCTGGCCTGGGG + Intergenic
950518663 3:13483371-13483393 CAGGCTGCAGACTTGGCCTGTGG - Intronic
950530974 3:13552207-13552229 CAGGCTGGAGGGCAGCTGTGGGG + Intronic
951576444 3:24119629-24119651 CAGTGTGCAGTGCAGGCCTGGGG - Exonic
952106887 3:30080702-30080724 CAGGCTGGAGTGCAGTGCTGTGG - Intergenic
952741454 3:36738438-36738460 CAGGATGCAAGGCAGCCATGAGG - Exonic
953123858 3:40072112-40072134 TAGGCTGTAGGGCTTGCCTGGGG + Intronic
953414957 3:42710397-42710419 CAGCCTGCAGGCCAGACCTCAGG - Intronic
953505591 3:43482858-43482880 CAGGGTACAGGGCAGGGATGGGG + Intronic
953596416 3:44318595-44318617 CAGGCCCCAGGGCAGGTCTGAGG + Intronic
954075904 3:48180043-48180065 CAGGCTGCTGGGCAGTTTTGGGG - Intronic
954257696 3:49417887-49417909 CAGGGTGCAGCGGAGGCGTGTGG - Exonic
954332899 3:49900308-49900330 CACGCTCCAGGGGAGGACTGTGG + Intronic
954594844 3:51815591-51815613 GAGGCTGCAGTGGAGCCCTGGGG - Intergenic
954816606 3:53286946-53286968 CCTGCTGCAGGGCAGGACTGGGG + Exonic
955074463 3:55600747-55600769 CAAGCTTCAGTGCAGGCCTTTGG + Intronic
955469670 3:59273493-59273515 CAGACTGCAGTGCAGTCCTAAGG - Intergenic
955928931 3:64036441-64036463 CAGGATGCAAGTCAAGCCTGGGG + Intergenic
956489124 3:69752903-69752925 GAGGCTTCAGGGGAGGCCTCAGG - Intronic
957776299 3:84760207-84760229 CAGGCTCCAGGGCAATGCTGAGG - Intergenic
958179767 3:90045396-90045418 AAATCTGCAGGGCAGGCCAGTGG + Intergenic
958643482 3:96839160-96839182 CAGTCTGCAGCCCAGGGCTGGGG - Intronic
960019419 3:112932542-112932564 GGGGCTGCTGGGGAGGCCTGGGG - Intronic
960509110 3:118526753-118526775 TGGGCTGCAGGGCTGGCCTTAGG - Intergenic
960939900 3:122926698-122926720 CAAGGGGCAGGGCAGGCCAGCGG + Intronic
961008656 3:123421908-123421930 CTGGCTCCAGGCCAGGGCTGTGG - Intronic
961074721 3:123971579-123971601 CAGGTGGGAGGGCAGGCATGGGG + Intronic
961186899 3:124923136-124923158 CAGGGTGCAGTGAAGGTCTGAGG - Intronic
961308959 3:125980899-125980921 CAGGTGGGAGGGCAGGCATGGGG - Intronic
961443047 3:126964057-126964079 GGGGCTGGAGGCCAGGCCTGGGG + Intergenic
961446067 3:126982446-126982468 CAGCCTGCATGGCAAGGCTGAGG - Intergenic
961450349 3:126999705-126999727 CAGCCAGCAGGGCCAGCCTGGGG + Intronic
961476134 3:127147488-127147510 TTGGCTGCAGGGCATGGCTGAGG - Intergenic
961681129 3:128600816-128600838 GTGGCTCTAGGGCAGGCCTGGGG - Intergenic
961825511 3:129597194-129597216 AAGCCTCCAGCGCAGGCCTGCGG + Intronic
961954254 3:130784950-130784972 CAGGCTGGAGTGCAGTCGTGTGG + Intergenic
962133086 3:132703622-132703644 CAGGCTGGAGGGCAGGGGTGTGG + Intronic
963289430 3:143472908-143472930 CAGCCTGTGGGGCAGGCCTGAGG - Intronic
964523566 3:157592946-157592968 GAGGCTGCAGTGCAGGCTTTAGG - Intronic
964627916 3:158776766-158776788 AAGGCTGCAGGGCAGGCCTGGGG + Intronic
965319788 3:167239092-167239114 CAGCCTGCAGGCCAGCCCTGTGG - Intergenic
965671958 3:171156766-171156788 CAGGCTGGAGGACAGGCCCTGGG + Intronic
965709512 3:171543215-171543237 CAGGCTGCAGGGCAGGAAAAAGG - Intergenic
966506629 3:180710332-180710354 CAAGATTCAGGGCAGGCCTTTGG - Intronic
966852261 3:184171433-184171455 CAGCACGCAGGGCAGGCATGGGG - Exonic
966902417 3:184496327-184496349 AAATCTGCAGGGCAGGCCAGCGG - Intronic
966949250 3:184801308-184801330 CTGGCTGCAGGGCAGGCAAGGGG - Intergenic
967219136 3:187234653-187234675 CAGGCTGCCTGGCATCCCTGGGG - Exonic
967345727 3:188453346-188453368 CAGGCTGGAGTGTAGACCTGGGG + Intronic
967844902 3:194035596-194035618 CAGCCTGCAAGGCAGGCCTGTGG - Intergenic
968227896 3:196987159-196987181 GAGGCTGCTGGTCAGCCCTGGGG + Intergenic
968232465 3:197011869-197011891 CAGGCCCCAGGGCAGCCCCGTGG + Intronic
968255533 3:197266566-197266588 CAGGCTGCAGTGCAGTGATGTGG - Intronic
968383657 4:116979-117001 GAGGCTGCAGGCCCGGCCAGAGG + Intergenic
968451492 4:678035-678057 CAGGCCGCCGTGCATGCCTGGGG + Intronic
968504236 4:964578-964600 CTGGCAACAGGGCAGGGCTGGGG - Intronic
968549816 4:1216465-1216487 CAGGCTGCAGGGGAGTGGTGTGG - Intronic
968576041 4:1366656-1366678 CAGGCTGCAGGGAGGGCCCCAGG - Intronic
968645823 4:1740059-1740081 CAGGGTGCAGGGCAGGGCCAGGG - Intronic
968689992 4:1985435-1985457 ATGGGTGCAGGACAGGCCTGTGG - Intronic
968872837 4:3250304-3250326 CAACCTGCAGGGAAGGCCGGAGG + Intronic
968893429 4:3384909-3384931 CAGGCTGGGAGGCAGGGCTGGGG + Intronic
969049752 4:4364259-4364281 GAGGCGGCAGGCCATGCCTGGGG - Intronic
969516062 4:7648832-7648854 CAGGTGCCAGGGCAGGCCTAGGG + Intronic
969602306 4:8183447-8183469 GAGGCTCCCGGGCTGGCCTGAGG + Intronic
969666958 4:8564062-8564084 CAGGCTGGAGGGCAGTGGTGTGG - Intronic
970691969 4:18630701-18630723 CTCCCTGCAGGGCAGGGCTGGGG - Intergenic
971386074 4:26141413-26141435 CAGGCTGCAGCACAGGCCCCAGG + Intergenic
971425646 4:26512533-26512555 CAGGCTACAGTGCAGCTCTGAGG + Intergenic
971928801 4:33050601-33050623 CAGGCTGGAGTGCAGGCTTCTGG - Intergenic
972247004 4:37255755-37255777 CAGGCTGCAGTTCTGGCCTTGGG - Intronic
972802330 4:42490118-42490140 CAGGCTGCAGGTCAGGGAAGGGG - Intronic
974045694 4:56896621-56896643 CAGGCTGCAGTGCAGTGGTGCGG + Intergenic
974064566 4:57065734-57065756 CAAGCTCCTGGGCTGGCCTGGGG + Intronic
974992847 4:69115374-69115396 CTTCCTGCAGGGCAGGGCTGGGG - Intronic
975588268 4:75972974-75972996 CAGGCTGGAGGGCAGTGGTGTGG - Intronic
975850502 4:78567019-78567041 TGGGCTGCAGAGCATGCCTGCGG + Intronic
976496895 4:85740262-85740284 CAGGCTGCAGTGCTGGAGTGCGG + Intronic
976711287 4:88074183-88074205 CAGGCTGGAGTGCAGGAGTGCGG + Intronic
977620238 4:99127785-99127807 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
978379858 4:108115885-108115907 ACGGCTGTAAGGCAGGCCTGCGG + Intronic
978764732 4:112392564-112392586 CAGGCTGCAGTGCAGTACAGTGG + Intronic
979435647 4:120686127-120686149 CAGGCTTCTGGGGAGGCCTCAGG - Intronic
980582646 4:134773794-134773816 CAGGCTCCAGGGCAGTGATGTGG + Intergenic
981405255 4:144360337-144360359 CAGGCTGTAGGGCTGGGATGAGG - Intergenic
981500494 4:145446127-145446149 CAGTCTGCAGTGCAGGAATGAGG + Intergenic
982288851 4:153760130-153760152 CTGGCTGAATGGGAGGCCTGAGG - Exonic
983881198 4:172935158-172935180 CAGTCTGCAGGGCAGCGCTCTGG - Intronic
983976048 4:173935779-173935801 GATGCTGCAGGGCAGCTCTGGGG + Intergenic
984557217 4:181228798-181228820 CAAGCTGCATGGCAGGCTAGCGG + Intergenic
984996356 4:185434177-185434199 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
985475179 5:74823-74845 GTGGGGGCAGGGCAGGCCTGGGG + Intergenic
985812219 5:2098485-2098507 AATGATGCAGGCCAGGCCTGCGG - Intergenic
986212441 5:5686616-5686638 CAGACTCCAGTGCAGCCCTGTGG - Intergenic
987276600 5:16369844-16369866 ATGGCTGCAGTGCAGGCCAGTGG - Intergenic
988730871 5:33971481-33971503 CAGGCTGGAGTGCAGTACTGTGG + Intronic
990375250 5:55163549-55163571 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
990450234 5:55926572-55926594 TAGGCTGGAGTGCAGGCCTCAGG - Intergenic
990678292 5:58213258-58213280 CAGTATGCATGGCAGGCCAGAGG + Intergenic
990954575 5:61330527-61330549 CAGGCTGCAAGGCAGGCGGGTGG + Intergenic
991486152 5:67139194-67139216 GAAGCAGCACGGCAGGCCTGCGG - Intronic
991612575 5:68464565-68464587 CAGGCTGCTGGGCACTGCTGCGG - Intergenic
991628634 5:68631570-68631592 CAGCCAGCATGGCAGGTCTGGGG - Intergenic
992004315 5:72462588-72462610 CAGGCTGAAGTGCAGTCCAGTGG + Intronic
992311500 5:75505240-75505262 CAGGCTGGAGTGCAGTTCTGTGG - Intronic
992610672 5:78505565-78505587 CAGGGTGCACAGCAGTCCTGTGG - Intronic
992615630 5:78543587-78543609 CAGCCAGAAGGCCAGGCCTGGGG - Intronic
992865297 5:80951784-80951806 CAGTCTGAAGGGCAGGACTGTGG + Intergenic
993365560 5:87030366-87030388 CAGGCTGCTGTGCTGGCCAGTGG + Intergenic
993901983 5:93590376-93590398 CAGGCTGCAGGGAAACACTGTGG + Intronic
994546880 5:101177721-101177743 CAGGCTTCTGGGGAGGCCTTAGG - Intergenic
994704285 5:103181525-103181547 CAGGCTGCAGTGCAGTCAGGGGG - Intronic
995542740 5:113200586-113200608 CAGTCTGCTGTGCAGACCTGAGG - Intronic
996846689 5:127906739-127906761 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
997234417 5:132264568-132264590 GGGGCTGCAGGGCAGGACTCAGG - Intronic
997264347 5:132486439-132486461 CAGGCTGCAGGGTTGGTCGGAGG - Intronic
997376928 5:133403958-133403980 CAGCCTGCAGGGAAGGCCATGGG - Intronic
997382545 5:133448203-133448225 CATTCGGCAGGGCAGCCCTGGGG - Intronic
997717378 5:136052187-136052209 TAGGGGGCAGGGCAGGGCTGAGG - Intronic
997820898 5:137064714-137064736 CAGGCAACAGGGCTGACCTGAGG - Intronic
997929835 5:138063082-138063104 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
999209577 5:149876393-149876415 CAGGCTGGAGGGCAGTGCAGTGG + Intronic
1000301805 5:159963489-159963511 CAACCTGCATGGCTGGCCTGGGG - Intronic
1000365770 5:160489640-160489662 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1001178419 5:169495027-169495049 GACGATGCAGGGCAGGCTTGAGG + Intergenic
1001250271 5:170141736-170141758 CTGGCTGCGGGGCTGGCCGGGGG - Intergenic
1001288023 5:170437839-170437861 CAGCCTTCAGAGCAGCCCTGAGG + Intronic
1001568439 5:172715095-172715117 AGGGCTGCAGGGCAGGAATGTGG + Intergenic
1001574199 5:172751349-172751371 CAAGCTGCAAGGCTGGGCTGAGG - Intergenic
1001581928 5:172804834-172804856 GATGCTGCAGGGCAGGCCTGTGG + Intergenic
1001677053 5:173527862-173527884 CCTGCAGCAGGGCAGCCCTGTGG - Intergenic
1001940217 5:175734942-175734964 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
1002119069 5:176987604-176987626 CAGGCTGGAGGGCAGTGGTGTGG - Intronic
1002427263 5:179183691-179183713 CAGGCTTCAGGGCAAGCCCAGGG + Intronic
1002587605 5:180261121-180261143 AAGGGTTCAGAGCAGGCCTGTGG - Intronic
1002793230 6:450199-450221 CGGGTTGCAGGGCAGGGCTCGGG + Intergenic
1002876442 6:1215164-1215186 CATCCTGCAGGCCTGGCCTGAGG + Intergenic
1003030005 6:2593481-2593503 CTGTCTACAGGGCAGGCCTCTGG - Intergenic
1003065788 6:2902922-2902944 GAGGCTGCAGGGGAGGGCTTCGG + Intronic
1003086383 6:3064317-3064339 GAGGCTGCAGGGGAGGGCTTCGG - Intronic
1003111079 6:3252693-3252715 CAGGCTGCTGGGTGTGCCTGTGG + Intronic
1003341764 6:5228319-5228341 CAGGCTGCAGTGCAGTAATGCGG + Intronic
1003348333 6:5292321-5292343 CAGCCTGGAGAGCAGGCCAGAGG + Intronic
1003854518 6:10259382-10259404 GAGGCTGCAGGGAAGGGCAGAGG + Intergenic
1004308433 6:14522091-14522113 CAGGCTGCAGTGCAGTCACGCGG - Intergenic
1005379094 6:25215817-25215839 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1005492162 6:26357034-26357056 CAGGCTGCAGTGCAGTAGTGTGG + Intergenic
1005650575 6:27881404-27881426 CAGGCTGGAGGGCAGTGGTGTGG + Intergenic
1006110278 6:31740330-31740352 AGGGCTGCGGGGCAGGGCTGAGG - Intronic
1006341293 6:33448579-33448601 CAGGCAGCTGGGAAGGTCTGAGG - Intronic
1006386143 6:33732141-33732163 CAGGCTGCCGGCCAGCACTGGGG - Intronic
1006415570 6:33901820-33901842 TTGGCTGCAGGGCCAGCCTGGGG + Intergenic
1006906563 6:37537082-37537104 CAGGCTCCAGAGCAGGCCTGCGG - Intergenic
1007018679 6:38496607-38496629 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1007293911 6:40806694-40806716 CAGGCTGCACAGAGGGCCTGGGG + Intergenic
1007756028 6:44100250-44100272 GAGGCTGCAGGACAGGCCCTGGG + Intergenic
1007816787 6:44530608-44530630 CAAGCTGCAGGGCAGGCCAGTGG + Intergenic
1009505040 6:64467709-64467731 CAGTGTGCAGAGCAGGCCTATGG - Intronic
1010086302 6:71922493-71922515 CAGGCTGCAGTGCAGTGATGGGG - Intronic
1011342751 6:86335756-86335778 GAGTCTGCAGGGCAGGCATTTGG + Intergenic
1012949517 6:105503253-105503275 CAGGCTGCAGAGGAGGCTGGAGG - Intergenic
1013388981 6:109664467-109664489 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1013477385 6:110521525-110521547 CAGGTTGTAGGGCTGGCCTTAGG - Intergenic
1013512856 6:110859710-110859732 CGGGCCCCAGGGCAGGTCTGAGG - Intronic
1013752771 6:113426310-113426332 CAGGGTACAAAGCAGGCCTGGGG - Intergenic
1014009300 6:116458397-116458419 CTGGCTGCAGGGATGGCCAGGGG - Intergenic
1014508079 6:122283777-122283799 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
1015040109 6:128706206-128706228 CAGGCTGGAGGGCAGTGGTGCGG - Intergenic
1015509562 6:134024311-134024333 TTGGCAGCAGGGCAGGCCGGAGG - Intronic
1016187980 6:141221400-141221422 CACACAGCAGGGGAGGCCTGGGG + Intergenic
1016676680 6:146778289-146778311 CTGGAGGCAGGGGAGGCCTGAGG + Intronic
1017136903 6:151155395-151155417 CAGGCTGGAGTGCAGGCTGGAGG + Intergenic
1017950785 6:159133038-159133060 AAGGCTGCGAGGCAGGGCTGAGG + Intergenic
1018007148 6:159632725-159632747 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
1018346429 6:162903975-162903997 CAGGCTGCTGGCCTGCCCTGTGG - Intronic
1018745430 6:166758019-166758041 CACTCTGAGGGGCAGGCCTGAGG + Intronic
1018834208 6:167471054-167471076 CCAGCTGAAGGGCAGGCCTCAGG - Intergenic
1018877375 6:167834940-167834962 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1018909409 6:168093417-168093439 CAGGCTGCTTGTCAGGTCTGGGG - Intergenic
1019043097 6:169122259-169122281 CAGGCTGCTGGGCTGGACTGTGG - Intergenic
1019126144 6:169841215-169841237 CTGGGTTCCGGGCAGGCCTGGGG - Intergenic
1019189554 6:170243818-170243840 CAGGCAGCGGGGCAGGCGTCGGG + Intergenic
1019383998 7:743328-743350 CAGGCTGGAGTGCAGGGGTGTGG - Intronic
1019445186 7:1067352-1067374 CAGGCTGCAGTGCACCCCAGAGG + Intronic
1019445229 7:1067547-1067569 CAGGCTGCAGTGCACCCCAGAGG + Intronic
1019499038 7:1355296-1355318 CAGGCGGGAGGGAAGGCCTGCGG + Intergenic
1019617930 7:1974944-1974966 CAAGCTGCAGGCCGGACCTGGGG + Intronic
1019648715 7:2144694-2144716 GAGGCTACAGGGCAGCCCCGGGG + Intronic
1019666133 7:2253047-2253069 AAGGCTGGAGGGCAGGGGTGAGG - Exonic
1019706350 7:2498954-2498976 CGGAATGCGGGGCAGGCCTGAGG - Intergenic
1020276040 7:6625196-6625218 CAGGCTGGAAGGCTGGTCTGGGG - Intergenic
1021674632 7:23067881-23067903 CAGGCCCCATGGCAGGCTTGTGG - Intergenic
1021678499 7:23105765-23105787 CAGGCTCCTGGGCAGGGCTCGGG + Exonic
1022518257 7:30989106-30989128 CGGGCTGCAGGCCGGGTCTGGGG - Intronic
1022697027 7:32717110-32717132 CATACTGCAGGGCTGGCCTATGG - Intergenic
1023625514 7:42111590-42111612 AAGGCAGGAGAGCAGGCCTGAGG + Intronic
1023773600 7:43583019-43583041 CAGGGTGCAGGGCAGGCGCGGGG + Intronic
1023862585 7:44225193-44225215 CAGGCTGCAGTCCTGGGCTGGGG + Intronic
1023902175 7:44490350-44490372 CAGGAGTCAGGGCAGGCCGGGGG + Intronic
1024005808 7:45224396-45224418 CAGGCTATGGGCCAGGCCTGGGG - Intergenic
1024231140 7:47364593-47364615 CAGCCTGCATGGCAGGCTTTTGG - Intronic
1024252490 7:47517016-47517038 CAGGCTGGAGTGCAGTGCTGTGG - Intronic
1024456409 7:49613451-49613473 CAGGCTGGAGTGCAGGGCAGTGG + Intergenic
1024480005 7:49853110-49853132 CAGGCTATGGGGCAGGGCTGCGG + Intronic
1024523963 7:50332453-50332475 CAGGCAGCAGGGGAGGCGTTTGG + Intronic
1024539814 7:50467059-50467081 CATGGGGCAGGGCAGGCCGGTGG + Intronic
1024863088 7:53868757-53868779 CAGGCTGCAGTGCAGTGCCGCGG - Intergenic
1025086325 7:56026442-56026464 CAGGCTGCAGTGCAGTGCAGTGG - Intronic
1025241745 7:57282379-57282401 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1025730132 7:64101126-64101148 CAGGCTGGAGTGCAGTCCAGTGG - Intronic
1025832201 7:65062169-65062191 CAGGCTGCAGAGCAGGGATGGGG + Intergenic
1025919879 7:65901598-65901620 CAGGCTGCAGAGCAGGGATGGGG + Intronic
1025927463 7:65971210-65971232 CAGGCTGGGAGGCAGGCATGGGG + Intronic
1026166518 7:67914933-67914955 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1026602164 7:71785837-71785859 CAGGCAGCAGGGCAGGTAAGGGG + Exonic
1027054814 7:75042824-75042846 CCAGCTGCAGGTGAGGCCTGCGG - Exonic
1027224488 7:76235305-76235327 CAGGCCGCGGGGCGGGACTGGGG + Intronic
1027267086 7:76500379-76500401 CAGGCTGGAGAGGAGGCCAGAGG - Intronic
1027318899 7:77000247-77000269 CAGGCTGGAGAGGAGGCCAGAGG - Intergenic
1027505798 7:79016217-79016239 AAGGGTGCAAGGCAGCCCTGGGG - Intronic
1027787191 7:82594998-82595020 CAGACTGAAGGGTAGGACTGTGG + Intergenic
1028008869 7:85614817-85614839 CTGCTTGCAGGGCAGCCCTGGGG + Intergenic
1028867062 7:95725646-95725668 CAGTGTGAGGGGCAGGCCTGAGG - Intergenic
1028935879 7:96463460-96463482 GAGGCTTGAGGGAAGGCCTGTGG - Intergenic
1029000357 7:97147957-97147979 CAGGCTGCAGTGCAGGCTCACGG + Intronic
1029375469 7:100174580-100174602 CAGCCAGCAGGACAGGCCTTGGG - Intronic
1029420542 7:100469662-100469684 GGGGCTGGAGGGCAGGACTGGGG - Intronic
1029474969 7:100777700-100777722 CAGACTGTAGGGCACACCTGGGG + Intronic
1029539362 7:101173631-101173653 CGGGCACCAGGCCAGGCCTGGGG + Intronic
1029601086 7:101563839-101563861 GACGCTGCAGGGCTGGACTGTGG + Intergenic
1029669104 7:102016565-102016587 CAGGCTGGAGTGCAGGGGTGTGG - Intronic
1029731270 7:102439717-102439739 CAGGCTGGAGTGCAGTCGTGTGG - Intronic
1029829479 7:103240956-103240978 CATACTGCAGGGCTGGGCTGTGG - Intergenic
1030055629 7:105581599-105581621 CACGGTTCAGGGCAAGCCTGGGG + Intronic
1030154037 7:106434685-106434707 CAGGCTGGAGTGCAGTCCAGTGG + Intergenic
1031528543 7:122850266-122850288 GAGGCTGCTGGGGAGTCCTGGGG - Intronic
1031604046 7:123748364-123748386 CAGGCTGGAGGACAGGCCTGCGG + Intronic
1032084147 7:128874757-128874779 GGGGCTGCAGGGGAGCCCTGAGG + Intronic
1032192156 7:129771505-129771527 CAGGCTGCAGGGGAGGCATGGGG - Intergenic
1032222330 7:130004014-130004036 CAGGCTGCAGTGCAGTGCAGTGG + Intergenic
1032472349 7:132187655-132187677 GAGGCTTCTGGGCAGGCGTGAGG + Intronic
1032522088 7:132553192-132553214 CAGGTTGCAGGCCATGCCTGGGG - Intronic
1033038363 7:137895981-137896003 CAGTGTGCAGGGCTGGGCTGGGG - Intronic
1033278506 7:139989995-139990017 AAGGCCGGCGGGCAGGCCTGTGG - Intronic
1033580768 7:142733224-142733246 CAGGCTGCAGGGGACTCCTGAGG - Intergenic
1034500618 7:151448401-151448423 CAGGCTGCAGCGCCGGCCGAGGG + Intergenic
1035000577 7:155609471-155609493 GAGGGTGCAGGGCAGGGCTCTGG - Intergenic
1035362388 7:158322180-158322202 CAGGATGCAGGGCAGAGCTGTGG - Intronic
1035569284 8:661307-661329 CAGGCTCCAGGGCAGAACTGTGG - Intronic
1036157817 8:6358761-6358783 CACGCTGCAGCTAAGGCCTGGGG - Intergenic
1036415775 8:8546511-8546533 CAGGCTGGAGTGCAGGGGTGTGG - Intergenic
1036436979 8:8743615-8743637 CAGGCAGCAGTGCAGCTCTGCGG - Intergenic
1036453923 8:8892395-8892417 CCGGCTGCGGGGCCTGCCTGAGG - Exonic
1036645756 8:10610879-10610901 CAGGCTGCAGGGTGAGCCTGCGG - Exonic
1036653279 8:10659408-10659430 AAGGCTACCGGGCAGTCCTGTGG - Intronic
1037074804 8:14701550-14701572 CAGGCAGCACGGACGGCCTGTGG - Intronic
1037144375 8:15555337-15555359 CAGGCTGGAGTGCAGTGCTGGGG + Intronic
1038018919 8:23536689-23536711 GAGGCAGAAGGGCAGGCCCGAGG - Intronic
1038342824 8:26702019-26702041 CAGTCTGCTGGGTAGGTCTGTGG + Intergenic
1038417029 8:27404544-27404566 CAGGTTGCAGGGGTGGCCTTGGG + Intronic
1038563254 8:28598459-28598481 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1039246980 8:35619949-35619971 CAGGCTGCAGAGCAAGGCTAGGG - Intronic
1039447113 8:37641901-37641923 GAAGCTCCCGGGCAGGCCTGTGG + Intergenic
1041013460 8:53567636-53567658 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic
1041453062 8:58028146-58028168 CAGGCTGGAGTGCAGTGCTGCGG + Intronic
1041616815 8:59916785-59916807 AAGCCTGCAGGGCTGGGCTGTGG + Intergenic
1043455481 8:80408021-80408043 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1044999800 8:97869401-97869423 GGGGCTGCAGTGCGGGCCTGGGG - Intronic
1046496376 8:115019485-115019507 CAGGCTATATGTCAGGCCTGAGG + Intergenic
1047003791 8:120598736-120598758 CAGGAGGGAGGGCAGCCCTGAGG - Intronic
1047407257 8:124595925-124595947 GAGGCTGCTGGGGAGGCCTCTGG + Intronic
1047499604 8:125431087-125431109 CGGGCTGCAGGGCGAGCCGGGGG - Exonic
1047533120 8:125695234-125695256 GAGGTAGCAGGGCAGGACTGAGG + Intergenic
1047961570 8:130015711-130015733 CAGCCTGCAGGGCTTTCCTGGGG - Intronic
1048004808 8:130410712-130410734 CATGCTGCAGCCCAGGGCTGGGG + Intronic
1048273448 8:133047666-133047688 CACGCTGCTGGGGAGGCCAGTGG - Intronic
1048977457 8:139680884-139680906 CAGGCTGCTGGGCAGGACCATGG - Intronic
1049020920 8:139957253-139957275 AAGGCTGCAGGGCAGGTACGCGG - Intronic
1049242679 8:141546366-141546388 CAGGATGCAGGGCACCCCTCAGG + Intergenic
1049384948 8:142338461-142338483 CAGGCAGCCAGGCAGGCTTGTGG - Intronic
1049428789 8:142549736-142549758 CAGGCTGCAGAGCAGGGCTGTGG - Intergenic
1049435917 8:142586183-142586205 CAGGTTGCGGGGCAGGCATGAGG + Intergenic
1049462052 8:142734817-142734839 CAGGCTCCAGGCCACTCCTGAGG - Intronic
1049530690 8:143153354-143153376 CAGGCTGCAGGCGTGGCCTCCGG - Intergenic
1049595676 8:143482244-143482266 CAGATCCCAGGGCAGGCCTGAGG + Intronic
1049689751 8:143953335-143953357 CAAGGGGCAGGGCAGGGCTGGGG - Intronic
1049757131 8:144315705-144315727 CAGAGGGCAAGGCAGGCCTGGGG + Exonic
1049778589 8:144417409-144417431 CAAGCTGTGGGGCAGGGCTGGGG + Intergenic
1050609539 9:7337295-7337317 CAGGCTGCAGGATATTCCTGTGG + Intergenic
1050633291 9:7582963-7582985 CAGGCTGGAGTGCAGGGGTGCGG + Intergenic
1050704855 9:8385467-8385489 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
1051295061 9:15586850-15586872 CAGGCTGGAGGGCAGTGGTGTGG + Intronic
1051345064 9:16144012-16144034 AAATCTGCAGGGCAGGCCAGGGG + Intergenic
1052899402 9:33778723-33778745 CAGGCTGCAGGGGACTCCTGAGG - Intronic
1052959262 9:34280606-34280628 CATGCTGAAGGGCTGCCCTGGGG - Intronic
1055366558 9:75550463-75550485 CAGGTGGCAGGGCAGATCTGTGG - Intergenic
1056591706 9:87970017-87970039 GAGGCTCCAGGGCTGGCTTGTGG - Intronic
1056729287 9:89151061-89151083 CAGGCTGGAGTGCAGTGCTGTGG + Intronic
1056798438 9:89674984-89675006 AAGGCTGCTGGACAGGGCTGAGG + Intergenic
1056817600 9:89812818-89812840 CAAGCTCCAGGGCAGTCTTGAGG + Intergenic
1057290226 9:93801664-93801686 GAGTCTGGAGGGCAGGCCTGGGG - Intergenic
1057299718 9:93870808-93870830 CAGGGGCCAGGGAAGGCCTGAGG - Intergenic
1057314091 9:93958095-93958117 CATGCTGCAGGGCTGGCCTGGGG - Intergenic
1057484443 9:95471664-95471686 CAGGCTGCAGAGCAGCTCAGTGG + Intronic
1058004898 9:99904461-99904483 CAGGCTGGAGTGCAGGCTGGTGG + Intergenic
1058013551 9:100004401-100004423 GAGTCTGCTGGGCAGGCCTCGGG + Intronic
1058523088 9:105831450-105831472 CAGGCTTCTGGGGAGGCCTCAGG + Intergenic
1058904475 9:109470649-109470671 CAGGCTGCAGAGCAGTGGTGCGG - Intronic
1059015692 9:110513079-110513101 GAGGCTTCAGGGCAGGGCAGTGG + Exonic
1059197326 9:112382218-112382240 CAGGGTGGAGGGCAGGGCAGTGG - Intronic
1059709020 9:116850214-116850236 CAGGCTACTGGGGAGGCCTTGGG - Intronic
1060031600 9:120219047-120219069 AAGGAAGCAGGGTAGGCCTGTGG + Intergenic
1060206661 9:121686413-121686435 CAGGCTTAAGTGCAGGGCTGGGG - Intronic
1060503959 9:124183988-124184010 CAGGAGGCAGGGCAAGACTGGGG + Intergenic
1060524430 9:124312452-124312474 CAGGCTGCAGCAGAGGCCTGGGG - Intronic
1060526002 9:124321714-124321736 CAGACTGCAGCTGAGGCCTGTGG - Intronic
1060878281 9:127099111-127099133 CAGGCTGCTGGCCAGCCATGGGG - Intronic
1061001332 9:127904627-127904649 CAGGCTGCAAGCCAGGCCTGGGG + Intronic
1061121809 9:128647880-128647902 CAGGCTGCAGAGCGTCCCTGGGG - Intronic
1061238136 9:129353831-129353853 CAGAGGGCAGGGCAGGCCTTGGG - Intergenic
1061491333 9:130946268-130946290 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1061609157 9:131734896-131734918 CAGCGTGCTGGGCAAGCCTGTGG + Intronic
1061675798 9:132214914-132214936 CAGGCTGAAGGGCAGTGCAGTGG + Intronic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1061890611 9:133617213-133617235 CAGGCAGCATGGCAGGCACGGGG + Intergenic
1061976568 9:134070982-134071004 GAGGCTGGAGGGCAGGACAGAGG - Intergenic
1062037983 9:134391149-134391171 CAGGCCCCAGGACATGCCTGGGG + Intronic
1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG + Intergenic
1062181292 9:135192555-135192577 CAGACTACAGGGGAGGCCTGGGG + Intergenic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1062344069 9:136106851-136106873 CTGGCTGCAGGCCCTGCCTGAGG - Intergenic
1062351949 9:136143684-136143706 GAGGCTGCAGGCCTGGCCTGGGG - Intergenic
1062428117 9:136515428-136515450 CAGTGGGCAGGGCGGGCCTGAGG - Intronic
1062465035 9:136677208-136677230 CAGGGTGCCAGGCAGGCCTGTGG - Intronic
1062466774 9:136685099-136685121 CAGTCTGGAGGAGAGGCCTGGGG - Intronic
1062522390 9:136963761-136963783 ATGGCTCCAGGGCAGGCCTGGGG - Intergenic
1062718222 9:138021902-138021924 GAGGCTCCAGGGCGGGCCTCTGG + Intronic
1062726333 9:138076119-138076141 CAGGCTGAAGGGAAGCCCTGAGG + Intronic
1203489229 Un_GL000224v1:87610-87632 CAGTCAGCAGGACAGGCCAGGGG - Intergenic
1203501850 Un_KI270741v1:29505-29527 CAGTCAGCAGGACAGGCCAGGGG - Intergenic
1203657209 Un_KI270753v1:9265-9287 CAGGGTGGAGGGCAGTCTTGGGG + Intergenic
1185480230 X:440796-440818 CAGGCTGCAGGCCGACCCTGAGG + Intergenic
1185488884 X:504190-504212 CAGGCTGGAGTGCAGTGCTGTGG + Intergenic
1185646975 X:1622865-1622887 CAGGCTGGAGGGCAGTGGTGCGG - Intronic
1185789472 X:2918005-2918027 CTGGCTGCCGGCCAGACCTGCGG - Exonic
1185986569 X:4841558-4841580 CAGGCAGCAGGGCAGATCTCTGG - Intergenic
1186168834 X:6856040-6856062 CAGGCTTCTGGGAAGCCCTGTGG + Intergenic
1187614545 X:20978894-20978916 CAGGCCTCAGGACTGGCCTGAGG - Intergenic
1188298542 X:28480260-28480282 CAGGCTGGAGGGCAGTAGTGAGG - Intergenic
1189262342 X:39687768-39687790 CGGGCCTCAGGGCACGCCTGTGG - Intergenic
1190233339 X:48598685-48598707 CAGGATGCAGGGCAGGCAGCAGG - Intronic
1190514537 X:51209134-51209156 AAGGCTGCAGGGTAGAACTGAGG + Intergenic
1190776166 X:53553763-53553785 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
1191113026 X:56822362-56822384 CAGGCTTCAGGCCAGCCCAGTGG + Intergenic
1191846377 X:65550681-65550703 CAGGCTGCAGAGGGGCCCTGTGG + Intergenic
1192021954 X:67403242-67403264 CAGGCTCCAGGCCAGTTCTGGGG + Intergenic
1192222522 X:69207109-69207131 CAGGCTTCAGGGCATGCATGTGG + Intergenic
1192237375 X:69304548-69304570 CAGGCTGGAGTGCAGGGGTGGGG - Intergenic
1195135797 X:101906505-101906527 CAGCCTGGAGGGCAGGGCTGTGG - Intronic
1195269090 X:103213376-103213398 AAGGCAGCAGGACAGGGCTGGGG - Intergenic
1195895690 X:109744071-109744093 CAGGCTGGAGGGCAGTGGTGTGG - Intergenic
1196260988 X:113581374-113581396 CAGGCTGGAGGGAAAGCCTAAGG + Intergenic
1196290726 X:113937747-113937769 CAGGCTGGAGTGCAGTCATGTGG + Intergenic
1196330086 X:114461834-114461856 CAGACTGAAGGTCATGCCTGTGG + Intergenic
1197727404 X:129785686-129785708 CAAGCAGGAGGGCAGGCATGGGG - Intronic
1198033123 X:132774723-132774745 CAGGCTGGAGTGCAGTCCCGTGG + Intronic
1199679677 X:150216027-150216049 CAGGCTGCTCTGCAGGGCTGGGG - Intergenic
1199695554 X:150341022-150341044 CAGGCTGCTCTGCAGGGCTGGGG + Intergenic
1199847453 X:151701373-151701395 CAGCCCCCAGGCCAGGCCTGTGG - Exonic
1199974548 X:152885383-152885405 CAAGCTGTAGGCGAGGCCTGAGG + Intergenic
1200124306 X:153806037-153806059 CAGGCTGCAGGCCTGGCCCAAGG - Intronic
1200223288 X:154402708-154402730 CAGGCAGCAGGGCACAGCTGAGG + Exonic
1200773181 Y:7146121-7146143 CAGCCTGCAGGGAAGCCCTGGGG - Intergenic
1201783255 Y:17745650-17745672 CAGGCTGGAGTGCAGTCGTGTGG - Intergenic
1201818298 Y:18160337-18160359 CAGGCTGGAGTGCAGTCGTGTGG + Intergenic
1202174619 Y:22085900-22085922 CAGGCTGCAGTGCAGTGGTGTGG - Intronic
1202216743 Y:22500482-22500504 CAGGCTGCAGTGCAGTGGTGTGG + Intronic
1202326444 Y:23695588-23695610 CAGGCTGCAGTGCAGTGGTGTGG - Intergenic
1202544326 Y:25974466-25974488 CAGGCTGCAGTGCAGTGGTGTGG + Intergenic