ID: 1143642621

View in Genome Browser
Species Human (GRCh38)
Location 17:8207761-8207783
Sequence CTCATGAGGACAAGTGCAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 169}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143642614_1143642621 15 Left 1143642614 17:8207723-8207745 CCTTGCGCCAGTTACCTGTGGGC 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1143642621 17:8207761-8207783 CTCATGAGGACAAGTGCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 169
1143642610_1143642621 17 Left 1143642610 17:8207721-8207743 CCCCTTGCGCCAGTTACCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1143642621 17:8207761-8207783 CTCATGAGGACAAGTGCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 169
1143642609_1143642621 18 Left 1143642609 17:8207720-8207742 CCCCCTTGCGCCAGTTACCTGTG 0: 1
1: 0
2: 2
3: 5
4: 87
Right 1143642621 17:8207761-8207783 CTCATGAGGACAAGTGCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 169
1143642612_1143642621 16 Left 1143642612 17:8207722-8207744 CCCTTGCGCCAGTTACCTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1143642621 17:8207761-8207783 CTCATGAGGACAAGTGCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 169
1143642608_1143642621 23 Left 1143642608 17:8207715-8207737 CCTCTCCCCCTTGCGCCAGTTAC 0: 1
1: 0
2: 0
3: 18
4: 151
Right 1143642621 17:8207761-8207783 CTCATGAGGACAAGTGCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 169
1143642618_1143642621 1 Left 1143642618 17:8207737-8207759 CCTGTGGGCTGGACATTGGAGCG 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1143642621 17:8207761-8207783 CTCATGAGGACAAGTGCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 169
1143642616_1143642621 8 Left 1143642616 17:8207730-8207752 CCAGTTACCTGTGGGCTGGACAT 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1143642621 17:8207761-8207783 CTCATGAGGACAAGTGCAGATGG 0: 1
1: 0
2: 1
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143642621 Original CRISPR CTCATGAGGACAAGTGCAGA TGG Exonic
901917256 1:12509162-12509184 CTCATGAGGAAAAGTACAAATGG + Exonic
903833982 1:26190870-26190892 CCCATGAGCACAGCTGCAGAAGG - Intronic
903884479 1:26532832-26532854 CTCATGAGGACAGATGCCCAGGG - Intronic
904596640 1:31650589-31650611 CTCAGGAAGAAAAGTGAAGAAGG + Intergenic
906799009 1:48719966-48719988 CCCATGAGAACAAGAGAAGAAGG + Intronic
909226576 1:73032125-73032147 CTCATGAGAAAAATGGCAGAAGG - Intergenic
909268591 1:73593983-73594005 CTCATGATGACACATGCAGTGGG + Intergenic
912858834 1:113195147-113195169 CCCATTAGGACAAGTTCTGAAGG - Intergenic
913444218 1:118932683-118932705 CTCATGAAGACAAGTGGGGCTGG + Intronic
914094920 1:144537030-144537052 CTCATGAGAACAAGAACTGAGGG + Intergenic
914303603 1:146396868-146396890 CTCATGAGAACAAGAACTGAGGG - Intergenic
919153441 1:193729710-193729732 CTCATGTGGACAAATAAAGATGG + Intergenic
919896376 1:202012095-202012117 CTCAAGGGCACAATTGCAGAGGG - Exonic
920054689 1:203183535-203183557 CTCCTGAGGACAGGTAAAGAGGG - Intronic
921080716 1:211736776-211736798 CACATGTTGACATGTGCAGATGG - Intergenic
922404919 1:225302619-225302641 CTTATGAGGAAAAGGGCTGAAGG + Intronic
922696291 1:227732666-227732688 CTCATGATGACCTGGGCAGAGGG + Exonic
1062813893 10:485244-485266 CACATGAGGGCACCTGCAGAGGG + Intronic
1066412574 10:35187899-35187921 CTCAAGAGGAAGAGTGGAGAAGG - Intronic
1067689689 10:48493786-48493808 CACAGCAGGACAAGTGCACAGGG - Intronic
1070312559 10:75284246-75284268 CTGATGAGCACATTTGCAGAAGG - Intergenic
1072444040 10:95482397-95482419 CTCATGAGCACCGGTGAAGACGG + Intronic
1073133766 10:101207834-101207856 CTCCTGAGGACAGGGACAGAGGG - Intergenic
1073350915 10:102819188-102819210 CCCATGTGACCAAGTGCAGATGG + Intergenic
1074482535 10:113838265-113838287 TTTGTGAGGACAAGGGCAGAAGG - Intronic
1075713273 10:124542082-124542104 GTCATGGGGGCAAATGCAGATGG - Intronic
1075956053 10:126524245-126524267 TTCATGACCACATGTGCAGAGGG + Intronic
1076138358 10:128060451-128060473 CCCATGAGGACAAGTGGATGTGG - Intronic
1076248257 10:128964340-128964362 TTCTTGAGGACAAGTACAGAGGG + Intergenic
1077032775 11:477150-477172 CTCATGAGGAGGAGTGGAAATGG + Intronic
1077336376 11:2006723-2006745 CCCGTGAGGACATGTGGAGAAGG + Intergenic
1077442696 11:2576026-2576048 CTCATGAGGACACTTGCTGTTGG + Intronic
1080397576 11:31903967-31903989 TTCATGAAGACAAGTGCTGATGG - Intronic
1080883026 11:36340309-36340331 CTCAGGCTGCCAAGTGCAGATGG + Intronic
1081313907 11:41607411-41607433 CTCTAGAGGACAAGAGAAGATGG + Intergenic
1081497862 11:43633752-43633774 CTGATGTGGACAAGGGAAGATGG - Intronic
1083229928 11:61310359-61310381 CTCATGAGGAGCAGTGCTGCTGG + Exonic
1084931717 11:72561532-72561554 CTCCTGAGGCCAGGTGGAGAGGG - Intergenic
1085127930 11:74014489-74014511 CTCATGAGCAGAACTGCAGGGGG - Intronic
1085268270 11:75250866-75250888 CTGATGAGGAGTATTGCAGAGGG - Intergenic
1086725393 11:90176400-90176422 TTCATGAGGATAAATGCAGTTGG + Intronic
1088258273 11:107921458-107921480 CTCATGAGGTTGTGTGCAGACGG + Intronic
1089371148 11:117959094-117959116 CTCATGAAGATAAGAGTAGAAGG + Intergenic
1089542775 11:119200177-119200199 ATCCTGAGAACAAGTGCCGAAGG - Intergenic
1089879584 11:121760844-121760866 CTCATGAGCACAGGTGCATATGG + Intergenic
1202819360 11_KI270721v1_random:61905-61927 CCCGTGAGGACATGTGGAGAAGG + Intergenic
1095173105 12:39057948-39057970 CTCATGAGAACAAGGGCAATGGG + Intergenic
1100214842 12:92436834-92436856 CACATGAGGACAAGGCAAGAAGG - Intergenic
1102613253 12:114131058-114131080 CTCATAAGGAAGAGTGGAGACGG - Intergenic
1107934539 13:45334274-45334296 CTTCTGAGTACAAGTGCAGTGGG + Exonic
1108990936 13:56657925-56657947 CACATGAGGACAAGGTCTGATGG - Intergenic
1115108411 14:29789664-29789686 CACATGAGCACCAGTGCACATGG + Intronic
1115652060 14:35409784-35409806 CCCATGATGCCAAGAGCAGAAGG - Intergenic
1121847869 14:97189865-97189887 ACCATGATGACAAGTGTAGAAGG + Intergenic
1123450873 15:20358189-20358211 CTCATGATGAGATGAGCAGAGGG - Intergenic
1125489809 15:40137979-40138001 CACATGAGGACACGGTCAGAAGG + Intergenic
1126507835 15:49428466-49428488 CCCATGGGGACAAGATCAGAGGG + Intronic
1130892004 15:88141357-88141379 CTCATGACAAGAAGAGCAGAAGG + Intronic
1133989413 16:10692920-10692942 GTCATGAGGAAAATTCCAGAGGG - Intronic
1134034690 16:11020750-11020772 CTCATGTGGCCAAGTCAAGAGGG - Intronic
1134412961 16:14018621-14018643 CTCATGATGCCAGGTGCAAATGG - Intergenic
1135851175 16:25965263-25965285 CTCATGAAGCCATGAGCAGAGGG + Intronic
1139702598 16:68717859-68717881 CTCATGGGGAAAAGTGGAGGTGG - Intronic
1140486463 16:75297514-75297536 CACCTGAGGACAAGTGCAATGGG + Intronic
1140985244 16:80152527-80152549 GTCCTGGGGAAAAGTGCAGAGGG - Intergenic
1142550565 17:736109-736131 CTCAAGAGCACAAATTCAGATGG + Intronic
1143642621 17:8207761-8207783 CTCATGAGGACAAGTGCAGATGG + Exonic
1146108252 17:30062753-30062775 CACATGAGGCCAAGTGGAGGTGG + Intronic
1146409569 17:32570994-32571016 CCCATGAGGAAAAGTGCTGGAGG + Intronic
1149321502 17:55486437-55486459 GTCATGAGGAGAGATGCAGATGG - Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1149852957 17:60052106-60052128 CCCATGAGGACATCTCCAGAGGG - Intronic
1149978382 17:61289012-61289034 CCCAAGAGGAAATGTGCAGAGGG - Intronic
1150579056 17:66455741-66455763 CAGATGAGGAAAAGAGCAGAAGG - Intronic
1151215305 17:72573015-72573037 CTCATGAGCAGCAGTGCTGAAGG - Intergenic
1152337570 17:79707156-79707178 CTCATGATGAGATGAGCAGAGGG + Intergenic
1153488629 18:5627532-5627554 CTCATGAGGACCAGTGTGCATGG + Intronic
1153543772 18:6185418-6185440 CTCATGAAGACAGGAGGAGAGGG + Intronic
1153981948 18:10317711-10317733 CTCATGACAAAAAATGCAGATGG - Intergenic
1156271915 18:35543088-35543110 CTCATGAGGCTAAGGCCAGAGGG - Intergenic
1159709104 18:71732197-71732219 CTCATTATAACAAGTGCACATGG + Intergenic
1160020544 18:75177307-75177329 CACATGAGGACAAAGCCAGAAGG + Intergenic
1162043690 19:7985304-7985326 CTCCAGAGGAGAAGTGCAAACGG + Intronic
1165249733 19:34520215-34520237 GTCCTGAGGACACGTGCACAAGG + Intergenic
1166335700 19:42105631-42105653 CTCATGGTGAGAAGTTCAGATGG + Intronic
1166545398 19:43631758-43631780 ACCATGAGGACAAGAGCAGTGGG + Intronic
928822471 2:35378097-35378119 CTCATGACAATAAATGCAGAAGG - Intergenic
932033298 2:68212819-68212841 CTCTTGGGGACCAGTGCAGCTGG - Intronic
935113216 2:100110780-100110802 CTATCAAGGACAAGTGCAGATGG - Intronic
936944600 2:117919100-117919122 CTCCTGAGGACCAGGGCAGCAGG + Exonic
941388427 2:164881752-164881774 GTAAAGAGTACAAGTGCAGAAGG + Intergenic
942273505 2:174300793-174300815 CCCTTGAGGTCAAGTGCAGGAGG - Intergenic
947524571 2:230870381-230870403 ATTATGAGCAGAAGTGCAGAAGG - Intronic
948409496 2:237748155-237748177 CAAATGAGGACAAGAGAAGAAGG + Intronic
1168873613 20:1153382-1153404 CACATGAGAAGAAATGCAGAAGG - Intronic
1169760810 20:9091596-9091618 CCCATGAGGACAAGTTCAGAGGG - Intronic
1170156914 20:13277512-13277534 CTCAGAAAGACAAGTGGAGAAGG - Intronic
1171185123 20:23119582-23119604 CGCATGAGAAAAAGGGCAGAAGG + Intergenic
1171935313 20:31269572-31269594 CTCATGGGGATTAGTGCACATGG - Intergenic
1174081246 20:47972078-47972100 CTCATGATGAAAAATCCAGAGGG - Intergenic
1174135253 20:48374810-48374832 CTCATGATGAAAAATCCAGAGGG + Intergenic
1175478653 20:59295741-59295763 CTCATGATGACAAGTACTGCTGG + Intergenic
1175828443 20:61949708-61949730 CTCACATGGACAAGAGCAGAAGG - Intergenic
1182466311 22:30518907-30518929 CTCCTGAGGACATGTTCAAAAGG - Intergenic
1183999779 22:41664760-41664782 CTCATGAGGAAGAGTGTAGGAGG + Intergenic
1184372563 22:44091912-44091934 CTCATAAGGACAATGGCAGCGGG - Intronic
1184491344 22:44810996-44811018 CTCACGTGGGGAAGTGCAGAGGG - Intronic
1185152806 22:49175642-49175664 CTCATGAGGACACAGCCAGAAGG + Intergenic
953675354 3:44997200-44997222 CTCCCGAGGACTAATGCAGAGGG - Exonic
954419105 3:50409231-50409253 CTCATGAGCCCAAGTGCTGTCGG - Intronic
955729558 3:61970227-61970249 CTCATGAGGAGAAGGAAAGAAGG + Intronic
955926032 3:64006025-64006047 TTCATGAAGACAAATGGAGAAGG + Intergenic
956280821 3:67554884-67554906 TACGTGAGGACAAGTGCTGAGGG + Intronic
956883695 3:73537000-73537022 CTGTTGAGGACCAGGGCAGAAGG - Intronic
958505070 3:94966634-94966656 TACAGGAGGACAAGGGCAGAAGG - Intergenic
958633057 3:96705226-96705248 GCCATGAGTTCAAGTGCAGACGG - Intergenic
959720576 3:109482702-109482724 TTGAAGAGGACAAGTGCACAAGG + Intergenic
960240879 3:115340388-115340410 CTCATGAGGCCAAGTCCATGAGG - Intergenic
960692723 3:120363737-120363759 CTCCTGAGTACAACTGGAGAAGG + Intergenic
962338636 3:134562209-134562231 CTGCTGAGGACAAGTTTAGATGG + Exonic
962354047 3:134678378-134678400 CTCATAGAGACAAGTCCAGAGGG - Intronic
964401125 3:156299772-156299794 CTCATGAGGGCTAGACCAGATGG - Intronic
966355788 3:179077192-179077214 GACAGGAGGACAAGAGCAGAGGG + Intergenic
969132768 4:5003837-5003859 CTGAGGAGGATCAGTGCAGAGGG - Intergenic
969914147 4:10473593-10473615 CTCATGAGGTCCAGTGGAAAGGG + Intergenic
970377223 4:15471250-15471272 CTCATGGGTAGAAGTGCAGGAGG + Intronic
970836060 4:20408957-20408979 CATATGAGCACAAGTGCATATGG - Intronic
971465760 4:26958770-26958792 TTCATGAGGAAAAGTGAAAATGG + Intronic
971662040 4:29431254-29431276 CTCATAAAGACAAGTGGAGAAGG + Intergenic
972333965 4:38089237-38089259 ATCCTGATGACAAGTCCAGAAGG - Intronic
973645134 4:52942718-52942740 CTCAGGAGGAGAAGTACAGAAGG + Intronic
983507604 4:168572177-168572199 CTTAAGGTGACAAGTGCAGAGGG - Intronic
984829640 4:183960107-183960129 GTCATGACGACAAGTTCAGCAGG + Intronic
987472469 5:18350358-18350380 ATGATGAGGAGAAGTGCAAAGGG - Intergenic
990261069 5:54022860-54022882 CTCAAGAGGAGAAGGGCATAGGG - Intronic
993058195 5:83007232-83007254 CTCTTGAGTAGATGTGCAGATGG - Intergenic
994496381 5:100518106-100518128 CTCATGAGGAGAACTGGAGAAGG + Intergenic
995015472 5:107304359-107304381 GTCGTGAGGACAACCGCAGAGGG + Intergenic
997381413 5:133440887-133440909 CCCAGGAGGCCAAGTGCAGGAGG - Intronic
999743653 5:154575613-154575635 CTAATGAGGAAAACTGCAGAAGG + Intergenic
1001570138 5:172725470-172725492 GTTAGGCGGACAAGTGCAGAGGG + Intergenic
1001932049 5:175680179-175680201 CTCATGAGGATATGTGCACAAGG - Intronic
1007707355 6:43798994-43799016 CTCTTGAGACCAAGGGCAGAGGG + Intergenic
1008493778 6:52112437-52112459 CACAAAAGAACAAGTGCAGAGGG + Intergenic
1009604301 6:65847630-65847652 CTCATGATGGAAAGTGCAGGAGG + Intergenic
1010495875 6:76533191-76533213 CTAATGAGGAGAAGTGCAATAGG + Intergenic
1011750482 6:90450156-90450178 CTCCTGAGAACATGTGCTGAAGG + Intergenic
1011857193 6:91708685-91708707 CTCTTGAGGCCAGGTGCTGAAGG + Intergenic
1011990104 6:93504242-93504264 CTCAAGTGGACAATTCCAGAGGG + Intergenic
1016285142 6:142464039-142464061 CTCATGATGCCACGTGAAGAAGG - Intergenic
1017776347 6:157683967-157683989 CTTAGGAGGACAGCTGCAGAAGG - Intergenic
1017949653 6:159126097-159126119 GTCAGGAGGCCAAGTGCAGTGGG + Intergenic
1018333552 6:162760318-162760340 CACATGTGGACTACTGCAGATGG + Intronic
1019228067 6:170531861-170531883 CTCAGCAGCACAAGAGCAGATGG - Intergenic
1023210086 7:37793651-37793673 TTCATAAGGACAAATTCAGAAGG - Intronic
1023965159 7:44960320-44960342 CTGATGAGGTCACCTGCAGAGGG + Intergenic
1027566065 7:79796102-79796124 CTCATGAGGAAACATGCAAATGG - Intergenic
1028536386 7:91892472-91892494 CTCATGGGTAAAAGTGAAGAAGG - Intergenic
1035298475 7:157881075-157881097 GTCATGAGGATATGTGGAGATGG + Intronic
1035352530 7:158256602-158256624 CCCGTGAGGACAAGTGATGACGG + Intronic
1035372508 7:158388326-158388348 CCCATGAGGGCCAGTGCAGATGG + Intronic
1035741458 8:1930987-1931009 ATCATGAGGCCAAGTGAAGAGGG - Intronic
1037554584 8:20009799-20009821 ATCCTGAGGACAAGTGCCCAAGG + Intergenic
1037826085 8:22161532-22161554 CCCATGGTGAGAAGTGCAGATGG + Intronic
1038247552 8:25873076-25873098 CACATGAGGAATAGGGCAGAAGG - Intronic
1038341905 8:26693252-26693274 CTCGTGAGGACACGGGGAGATGG - Intergenic
1038949492 8:32398867-32398889 CTTATGAGAAAAACTGCAGAAGG - Intronic
1039345134 8:36695188-36695210 CTCATGGGGACAACTGGAGATGG - Intergenic
1040960914 8:53032031-53032053 CTGATGAGAACAAATGCTGAGGG - Intergenic
1041661376 8:60404829-60404851 CTAATGATTCCAAGTGCAGATGG + Intergenic
1044328460 8:90888485-90888507 CTGAAGTGGAAAAGTGCAGAGGG + Intronic
1045361588 8:101438104-101438126 CTCATGAGGTGAAATCCAGAAGG - Intergenic
1048305767 8:133283654-133283676 CTCATGGGGCCAAGTGAGGATGG - Intronic
1049231355 8:141485621-141485643 CTCATGAGGCTAAAGGCAGAAGG - Intergenic
1053175231 9:35917706-35917728 CTCAGGAGGACAAGGACAGAGGG - Intergenic
1055800697 9:80032624-80032646 CCCATGAGACCAGGTGCAGAGGG - Intergenic
1056634840 9:88322998-88323020 CTGATGATGACATCTGCAGAGGG + Intergenic
1056940322 9:90949932-90949954 CTTATGAGGGAAAGTGGAGAAGG - Intergenic
1058001883 9:99874190-99874212 CTCATGGGGCCAATTGCAGGGGG + Intergenic
1061169565 9:128944403-128944425 CTCCTGAGGGAAAGAGCAGAGGG - Intronic
1188266872 X:28087779-28087801 CAGAGGAGGAGAAGTGCAGATGG - Intergenic
1189984238 X:46539847-46539869 ATCATGAAGACAAGACCAGAAGG + Intronic
1195659494 X:107364012-107364034 CTCATTAGAACATGTGCAGTTGG + Intergenic
1196514979 X:116599498-116599520 CTCATGAGGAGCAGTGAAGCAGG - Intergenic