ID: 1143644833

View in Genome Browser
Species Human (GRCh38)
Location 17:8223467-8223489
Sequence TCTGGGGCCCAGAAGACCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143644822_1143644833 22 Left 1143644822 17:8223422-8223444 CCAGACCGCATGGCAGTACCCAA No data
Right 1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG No data
1143644820_1143644833 24 Left 1143644820 17:8223420-8223442 CCCCAGACCGCATGGCAGTACCC No data
Right 1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG No data
1143644821_1143644833 23 Left 1143644821 17:8223421-8223443 CCCAGACCGCATGGCAGTACCCA No data
Right 1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG No data
1143644823_1143644833 17 Left 1143644823 17:8223427-8223449 CCGCATGGCAGTACCCAAGCGAG No data
Right 1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG No data
1143644828_1143644833 4 Left 1143644828 17:8223440-8223462 CCCAAGCGAGGGAAAGAGGGAAC No data
Right 1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG No data
1143644829_1143644833 3 Left 1143644829 17:8223441-8223463 CCAAGCGAGGGAAAGAGGGAACG No data
Right 1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143644833 Original CRISPR TCTGGGGCCCAGAAGACCCA CGG Intergenic
No off target data available for this crispr