ID: 1143646631

View in Genome Browser
Species Human (GRCh38)
Location 17:8234608-8234630
Sequence CAGGGTGGCCAGAGTGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 963
Summary {0: 1, 1: 0, 2: 13, 3: 105, 4: 844}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143646622_1143646631 4 Left 1143646622 17:8234581-8234603 CCAGGCCTTACGCTGTCCTTCTT 0: 1
1: 0
2: 1
3: 34
4: 504
Right 1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG 0: 1
1: 0
2: 13
3: 105
4: 844
1143646619_1143646631 23 Left 1143646619 17:8234562-8234584 CCTTAGGGTCAAAGGAGGCCCAG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG 0: 1
1: 0
2: 13
3: 105
4: 844
1143646623_1143646631 -1 Left 1143646623 17:8234586-8234608 CCTTACGCTGTCCTTCTTCTTTC 0: 1
1: 0
2: 1
3: 49
4: 323
Right 1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG 0: 1
1: 0
2: 13
3: 105
4: 844
1143646621_1143646631 5 Left 1143646621 17:8234580-8234602 CCCAGGCCTTACGCTGTCCTTCT 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG 0: 1
1: 0
2: 13
3: 105
4: 844

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143646631 Original CRISPR CAGGGTGGCCAGAGTGGGGA AGG Exonic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900291637 1:1926198-1926220 CAGTGTGGCCAGGGTGGGCCTGG + Intronic
900322572 1:2092369-2092391 CAGGGTGCCCAGAGAGGGCGGGG + Intronic
900640433 1:3685717-3685739 CAGGGGTCCCAGAGTGGGGCTGG + Intronic
900656238 1:3759391-3759413 CAGCTTGGGCAGGGTGGGGACGG + Intronic
900824233 1:4913486-4913508 CTGGGGGCCCAGGGTGGGGAAGG - Intergenic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901322679 1:8349170-8349192 CCTGGTGGCCAGGATGGGGATGG + Intergenic
901528967 1:9842002-9842024 GAGGCTGGGCAGTGTGGGGAGGG - Intergenic
901557898 1:10046089-10046111 CATTCTGGCCAGAGAGGGGAGGG + Intronic
901647879 1:10726475-10726497 CAGGCTGGCCAGGCTGGGGCCGG + Intronic
901676457 1:10888718-10888740 CAGGGCGGGCCGGGTGGGGAGGG - Intergenic
901718575 1:11176656-11176678 CAGGGTGGCCTCAGTGTGGCTGG - Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
901989410 1:13100656-13100678 CAGTGTGGCCAGACCTGGGAAGG + Intergenic
901992403 1:13126108-13126130 CAGTGTGGCCAGACCTGGGAAGG - Intergenic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902233482 1:15043085-15043107 CAGGAGGGCCAGCCTGGGGAGGG + Intronic
902377416 1:16036371-16036393 CAGGGGGGCATGGGTGGGGACGG + Intergenic
902382593 1:16059629-16059651 CAGGGGGGCATGGGTGGGGACGG + Intronic
902383665 1:16064505-16064527 CAAAGTGGACAGAGTGGAGAGGG - Intronic
902393406 1:16119150-16119172 GAGGGTGCCAGGAGTGGGGAGGG + Intergenic
902513088 1:16976640-16976662 CAGGGTTGACAGGGTGGGGAGGG + Intronic
902885185 1:19399664-19399686 CAGGGTGTCAAGAGTGGGAGAGG + Intronic
903060403 1:20664850-20664872 CAGGGGGGCGGGAGTGGGGTGGG - Intronic
903215152 1:21839606-21839628 GAGGGTGGCCATGGTGAGGAAGG + Intronic
903233494 1:21935877-21935899 GAGGCTGCCCAGAGTGGGGATGG + Intronic
903275607 1:22219410-22219432 CAGCCTGGCTAGAGAGGGGATGG - Intergenic
903297084 1:22350742-22350764 AGGGGAGGCCAGAGTGGGGAGGG + Intergenic
903480929 1:23652728-23652750 CAGGGTGGGAAGGGTGGAGAGGG - Intergenic
903647187 1:24902596-24902618 GAGGGTTGGCAGCGTGGGGAAGG + Exonic
904005316 1:27360484-27360506 CAGGGTAGTAAGGGTGGGGAAGG - Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904182018 1:28672702-28672724 CACCCAGGCCAGAGTGGGGAGGG - Intronic
904466896 1:30713657-30713679 CAGGTTGGCCAGAGCAGGGCAGG + Intronic
904566542 1:31431805-31431827 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566566 1:31431877-31431899 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566614 1:31432021-31432043 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566617 1:31432030-31432052 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566620 1:31432039-31432061 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566623 1:31432048-31432070 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566626 1:31432057-31432079 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566629 1:31432066-31432088 CAGGGTGGACAGGGTGGTTAGGG + Intronic
904566638 1:31432093-31432115 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566653 1:31432138-31432160 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566656 1:31432147-31432169 CAGGGTGGACAGGGTGGATAGGG + Intronic
904601970 1:31678186-31678208 CAGGGTGGCGGGGGTGGGGAGGG + Intronic
904617516 1:31757958-31757980 CAGTCAGGCCAGAGTGGGTAAGG + Intronic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
904940429 1:34162240-34162262 CAGGGAGGCTGGGGTGGGGAGGG + Intronic
905203780 1:36331182-36331204 CTGGGTGGTTAGAGAGGGGAGGG - Intergenic
905288906 1:36908063-36908085 CAAGGTGGGGAGTGTGGGGAGGG - Intronic
905348371 1:37327361-37327383 CAGGGTGGCCAGGGCTGGGGTGG + Intergenic
905627343 1:39497831-39497853 CAGGTGGGACAGAGTGGGGCCGG + Intronic
905629538 1:39511038-39511060 CAGGGAGGCCTGGGTGGGGCCGG - Intronic
905653447 1:39671614-39671636 CCCGGCGGCCCGAGTGGGGAGGG + Intronic
905668222 1:39775152-39775174 CAGGGAGGCCTGGGTGGGGCCGG + Intronic
906607332 1:47181421-47181443 CAGCCTGGCCAGATCGGGGAGGG - Intergenic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907088475 1:51701788-51701810 TGGGGTGGGCAGAGCGGGGAGGG - Intronic
907236555 1:53054543-53054565 GTGGGGGGCAAGAGTGGGGAGGG - Intergenic
907278029 1:53327707-53327729 CCGGGAGGCCGGAGCGGGGAGGG - Intronic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
907568016 1:55455298-55455320 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
907568693 1:55462114-55462136 TGGGGTGGGCAGAGTGGGGAGGG + Intergenic
907641479 1:56194911-56194933 TAGGGTGGTGAGAGTAGGGATGG - Intergenic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
908783557 1:67713479-67713501 CAGGGAGAGCAGGGTGGGGATGG + Intronic
909094538 1:71271024-71271046 CAGGGTGGCCAGGGTGGTTTTGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
910338045 1:86155821-86155843 AAGGGTCGCCAGCGGGGGGAAGG - Intronic
910729766 1:90381943-90381965 CATAGTGGCCTGAGTGGGCAAGG - Intergenic
910835538 1:91505248-91505270 CATTGTGGCTAGAATGGGGAAGG + Intronic
911243463 1:95490831-95490853 TAGAGTGGCCGGAGTGGTGATGG + Intergenic
911381286 1:97118255-97118277 CAGGGTGCCCAGAGTCTGGGTGG - Intronic
911590023 1:99736619-99736641 TGGGGTGGGGAGAGTGGGGAGGG + Intronic
911852449 1:102836432-102836454 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
912091496 1:106081730-106081752 CAGGGTGGGTAGAGAGGGTAGGG - Intergenic
912125578 1:106533303-106533325 TGGGGTGGCAGGAGTGGGGAGGG - Intergenic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
912836342 1:112999837-112999859 GAGGGTGGCAAGCCTGGGGAGGG - Intergenic
912871534 1:113311295-113311317 CAGCTTGGTCACAGTGGGGAAGG + Intergenic
912961697 1:114201709-114201731 CCCGGTGTCCAGAGTGGGCAGGG - Intergenic
915359870 1:155279394-155279416 CAGGGAGGCCAGAGGAGGAAAGG + Intronic
915471270 1:156127015-156127037 CAGGGAGGACAGGGTGGGGCAGG - Intronic
915740719 1:158116477-158116499 GAAGGAGGACAGAGTGGGGAGGG + Intergenic
916085913 1:161269238-161269260 CAGGGTGCTGAGGGTGGGGAAGG + Intronic
916552210 1:165859893-165859915 CAGGGTGGACAAGGTGGGCAGGG - Intronic
917175975 1:172235845-172235867 TGGGGTGGGGAGAGTGGGGAGGG + Intronic
917513767 1:175689742-175689764 CAGGGTGGCCAGACAGGGAGGGG + Intronic
917795610 1:178530739-178530761 CAGGGTGGTGAGAGGGGGTAGGG - Intronic
918101732 1:181382256-181382278 CAGTGTGGCTAGAGTTGGTAAGG + Intergenic
918874815 1:190027062-190027084 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
919735592 1:200948254-200948276 GAGGGGGGCCGGGGTGGGGAAGG + Intergenic
919981908 1:202647073-202647095 CATGGTGGCCAGGGTAGGGTTGG + Intronic
920183581 1:204147247-204147269 CAGCCTGGCCAAGGTGGGGAGGG + Intronic
920347725 1:205317450-205317472 CAGGCTGGGCAGAGTGGGGGTGG + Intronic
920580133 1:207098594-207098616 GGGGGTGGGGAGAGTGGGGATGG + Intronic
920670990 1:208003467-208003489 GAGGGAAGCCAGGGTGGGGAGGG - Intergenic
920685374 1:208105157-208105179 GAGGGTGGCCAGGATGGGGTGGG + Intronic
921177793 1:212608894-212608916 CGGGGCGGCCAGGGTCGGGACGG - Exonic
922032194 1:221812338-221812360 AAGCGGGGCCAGAGTGGGCAGGG - Intergenic
922180172 1:223227268-223227290 CAGGGGGACCACAGTGGGAATGG + Intronic
922521393 1:226255393-226255415 CGGGGTGGCTAGAGTGGGCTGGG - Intronic
922621277 1:226990302-226990324 CACGGTGTCCTGTGTGGGGAGGG + Exonic
922621500 1:226992008-226992030 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
922621506 1:226992026-226992048 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
922905740 1:229172337-229172359 CAGGTAGGGCAGAGAGGGGAGGG + Intergenic
922908997 1:229199696-229199718 CAGGCAGGCCAGAGAAGGGAAGG - Intergenic
923042653 1:230330735-230330757 CAGGGTCCCTGGAGTGGGGAGGG + Intronic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923390492 1:233510329-233510351 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
923747421 1:236715298-236715320 CAGGGTGGGGGGAGGGGGGAGGG - Intronic
923978957 1:239298413-239298435 CAGGGGGACTGGAGTGGGGAGGG - Intergenic
924791016 1:247248172-247248194 TGGGGTGGGCAGAGTGGGGAGGG + Intergenic
1062766533 10:70424-70446 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1062824226 10:556624-556646 CAGGGTGGCAACATTGTGGAGGG - Intronic
1063177090 10:3561012-3561034 TGGGGTGGGGAGAGTGGGGAGGG + Intergenic
1063340448 10:5258136-5258158 TGGGGTGGGCAGAGTGGGGAGGG + Intergenic
1064553929 10:16529386-16529408 CAGGGTGGAGAGATAGGGGAAGG - Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1065916292 10:30357099-30357121 CGGGGTGGCCAGAGTGGCACAGG + Intronic
1066690216 10:38019126-38019148 CGGGGTGGGGGGAGTGGGGAGGG - Intronic
1066696916 10:38087402-38087424 GAGGGTGGGGAGGGTGGGGAGGG - Intergenic
1066696921 10:38087411-38087433 GAGGGTGGGGAGGGTGGGGAGGG - Intergenic
1067020721 10:42794904-42794926 TGGGGTGGGCAGAGCGGGGAGGG - Intronic
1067204054 10:44198666-44198688 GTGTGTGGGCAGAGTGGGGAGGG + Intergenic
1067219691 10:44335091-44335113 CAGAGAGGCCAGAGTGGCCATGG + Intergenic
1067816079 10:49477693-49477715 CAGGGAGGCCAGTGTGGTCAGGG - Intronic
1068062471 10:52086183-52086205 CAGGGTGGAAAGGATGGGGAGGG - Intronic
1068576774 10:58693002-58693024 TGGGGTGGGCAGAGTGGGGAGGG - Intronic
1069606634 10:69743049-69743071 CATGGTGGCAGGAGTGGGGAGGG - Intergenic
1069743488 10:70700264-70700286 CAGGAAGGACAGTGTGGGGAGGG - Intronic
1069942926 10:71967316-71967338 GAGGGTGGAGACAGTGGGGAGGG - Intronic
1070425866 10:76286505-76286527 CTGAGTGACCAGAGAGGGGATGG + Intronic
1070717345 10:78732357-78732379 CAGGGTGGCGAGTGAAGGGAGGG + Intergenic
1070789278 10:79180042-79180064 CAGGGTGCCGAGGGTGGAGACGG + Intronic
1070806992 10:79276504-79276526 GAGGGTGGCCAGGGTGGTGGGGG - Intronic
1071048570 10:81416756-81416778 CGGGGTGGAGGGAGTGGGGAGGG - Intergenic
1071075151 10:81740904-81740926 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071495358 10:86164097-86164119 CAGGCTGGGCAGAGTGGGAGGGG + Intronic
1071526089 10:86359384-86359406 CAGTGTGGCCAGTGAGGGGCAGG + Intronic
1071552696 10:86579233-86579255 GAGGGTGGCTAGAGTGGGCTTGG + Intergenic
1071647338 10:87367069-87367091 GAGGGTGGCCTGAATGGGGAGGG + Exonic
1072066954 10:91880503-91880525 CAGGCTGGCAGGGGTGGGGAGGG + Intergenic
1072091082 10:92127786-92127808 CAGTGTGGCCATAGTGGGTAAGG + Intronic
1073036104 10:100565173-100565195 AAGGGTGGCCAGGGTGAGGCTGG + Intergenic
1073186924 10:101620562-101620584 CAGGCTGGCCAGAGCGGGCAGGG + Intronic
1073580791 10:104663893-104663915 CAGAGAGGCCGGGGTGGGGAAGG - Intronic
1073616763 10:105004205-105004227 CAGGATGGACAGAGAAGGGATGG + Intronic
1073711259 10:106045338-106045360 GGGGGTGGGCAGAGTGGTGAGGG + Intergenic
1074203282 10:111258602-111258624 CAGCGGGGCCAGACTGTGGAGGG - Intergenic
1074283091 10:112071561-112071583 GAAGGTTGTCAGAGTGGGGAGGG - Intergenic
1074333341 10:112542818-112542840 TGGGGTGGGGAGAGTGGGGAGGG - Intronic
1074565028 10:114569745-114569767 CAGGGTAGCAAGAATGGTGAAGG + Intronic
1075210365 10:120485831-120485853 CAGGGCAGCCAGGGTGGGGCAGG - Intronic
1075589157 10:123678819-123678841 CAGGCTGGGCAGGGTGTGGAGGG + Intronic
1075631855 10:124005249-124005271 CAGGCAGGTCTGAGTGGGGAGGG - Intergenic
1075797995 10:125134839-125134861 CAGGGTAGGTGGAGTGGGGAGGG - Intronic
1076094444 10:127719987-127720009 CAGGCTGGTGAGGGTGGGGAAGG - Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1076810969 10:132886140-132886162 CCGGGTGGCCACTGTGGGGCTGG - Intronic
1077185380 11:1233377-1233399 CAGGCTGGGGAGAGTGGGGCAGG + Intronic
1077350938 11:2092924-2092946 CAGGGTGGCTGCAGAGGGGATGG - Intergenic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077516726 11:3006711-3006733 CAGGCTGGCCAGCGTGGGAATGG + Intronic
1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG + Intronic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1078758350 11:14232541-14232563 CAGAGTTGCCAGAGTGGGGAGGG - Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1079989064 11:27228014-27228036 CTGGGAGGCCACAGTGGGGTGGG + Intergenic
1080763224 11:35272644-35272666 CAGGGTTTCCTGAGTGGTGAGGG - Intronic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1081783137 11:45727358-45727380 GAGGGTAGCCACAGTGGGGAGGG + Intergenic
1082789513 11:57337671-57337693 CGGGGTGGGCGGAGTGGGGAGGG + Intergenic
1082904949 11:58297597-58297619 TCGGGTGGCGGGAGTGGGGAGGG - Intergenic
1083128721 11:60601115-60601137 CGGGGTGGGGGGAGTGGGGAGGG - Intergenic
1083167617 11:60900812-60900834 CCGGCAGGCCAAAGTGGGGAGGG - Intronic
1083179065 11:60972601-60972623 CAAGCTGGCCAGAGCGGGGCAGG + Intronic
1083267900 11:61555350-61555372 CCGGGCGGCAGGAGTGGGGACGG + Intronic
1083270605 11:61570319-61570341 GAGGGTGGCCAGAGGCTGGAAGG + Intronic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083479415 11:62934056-62934078 CAGAGTGGCCAGAGTGGGGTGGG - Intergenic
1083502639 11:63124953-63124975 CGGGGTGGGGGGAGTGGGGAGGG + Intronic
1083623986 11:64062673-64062695 CAGGGAAGCCAGAGTGCTGAAGG + Intronic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1083741655 11:64714458-64714480 CAGGGTAACCAGACTGGGAAGGG + Intronic
1084459159 11:69286643-69286665 CAGCGTGACGAGAGTGGGGATGG + Intergenic
1084557851 11:69885601-69885623 TGGGGAGGACAGAGTGGGGAGGG + Intergenic
1084557855 11:69885615-69885637 TGGGGAGGGCAGAGTGGGGAAGG + Intergenic
1084557865 11:69885643-69885665 TGGGGAGGGCAGAGTGGGGAGGG + Intergenic
1084557870 11:69885657-69885679 TGGGGAGGGCAGAGTGGGGAGGG + Intergenic
1084557874 11:69885671-69885693 TGGGGAGGGCAGAGTGGGGAAGG + Intergenic
1084557884 11:69885699-69885721 TGGGGAGGGCAGAGTGGGGAGGG + Intergenic
1084557902 11:69885741-69885763 GGGGGAGGGCAGAGTGGGGAGGG + Intergenic
1085295150 11:75427331-75427353 CAGGGTGGCCAGACATGGGAAGG - Intronic
1085306995 11:75492163-75492185 GAGAGAGGGCAGAGTGGGGATGG - Intronic
1085309637 11:75508682-75508704 CATGGGGGCCACAGTGGGGGAGG - Intronic
1085329227 11:75633829-75633851 AAGGGCGAGCAGAGTGGGGAGGG + Intronic
1085454938 11:76660357-76660379 CAGGCTGGCCAGATTGGCAAAGG + Exonic
1085528280 11:77176543-77176565 CTGTGTGGGCAAAGTGGGGAAGG + Intronic
1085699122 11:78730505-78730527 CCAGATGGACAGAGTGGGGAAGG + Intronic
1085810716 11:79678478-79678500 GAGGGTGGCTACAGAGGGGAAGG + Intergenic
1086897303 11:92328165-92328187 CAGGAGGGCAAGAGTGGGTAAGG - Intergenic
1087675932 11:101161561-101161583 CGGGGTGGGGGGAGTGGGGAGGG - Intergenic
1088134586 11:106539269-106539291 CAGGGTGGTCAGAGTTGGAGAGG - Intergenic
1088187811 11:107193140-107193162 CAGGGTGGGCAGACTGGTGAAGG - Intergenic
1088388113 11:109282012-109282034 GAGGGTGGCCAGAGGAGCGAGGG - Intergenic
1088516341 11:110638850-110638872 CGGGGTGGGAGGAGTGGGGAGGG + Intronic
1088585574 11:111357613-111357635 CAGGGTGGCCGGGGTGGGCTGGG + Exonic
1088681534 11:112247463-112247485 CAAGGTGTCCTAAGTGGGGAGGG + Intronic
1089162640 11:116451286-116451308 CAGGCTGGGGAAAGTGGGGAAGG + Intergenic
1089457963 11:118636308-118636330 GAGGGTGGTGAGATTGGGGAGGG + Intronic
1089632433 11:119792056-119792078 CAGGGAGGGCAGAGTGGGGCTGG + Intergenic
1090398761 11:126435340-126435362 CTGGCTGGCCAGGGTGGGGTGGG + Intronic
1090439372 11:126713342-126713364 CAGGTGGGCCAAGGTGGGGAGGG + Intronic
1090620179 11:128553677-128553699 GAGGGTGGCGGGAGTGTGGAGGG - Intronic
1090622993 11:128578140-128578162 CCGGGTTGCCAGTTTGGGGAGGG - Intronic
1090773022 11:129938511-129938533 CAGGGTGGCAAAAGCGGGGATGG - Intronic
1090848606 11:130550815-130550837 AGGGGAGGCCAGAGTGGGGTTGG - Intergenic
1091193138 11:133710959-133710981 CAGGGAGGTCACAGAGGGGAGGG - Intergenic
1091419024 12:318868-318890 GAGAATGACCAGAGTGGGGAAGG + Intronic
1092664876 12:10784941-10784963 TAGGGTGGGGGGAGTGGGGAGGG - Intergenic
1094476338 12:30843520-30843542 CAGGCTGGACATAGTGGAGAGGG + Intergenic
1094645220 12:32316846-32316868 TGGGGTGGGGAGAGTGGGGAGGG - Intronic
1096467137 12:51852882-51852904 CAGAGAGGGCAGAGTGGGGGTGG - Intergenic
1096913628 12:55009336-55009358 GCTGGGGGCCAGAGTGGGGATGG + Intergenic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1099012602 12:77309701-77309723 TTGGGAGGCCAAAGTGGGGATGG - Intergenic
1099358402 12:81666611-81666633 TGGGGTGGAGAGAGTGGGGAGGG + Intronic
1099775457 12:87122183-87122205 CAGGAAGGCCAGTTTGGGGAAGG + Intergenic
1101810533 12:108103896-108103918 CATGGTGGCCAGAGTTGTGATGG - Intergenic
1101937482 12:109069962-109069984 CAGGGAGGCCAGGGCGGGGAGGG + Intronic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102095808 12:110240332-110240354 CAGGATGGCCAGTGTGGCCATGG + Intergenic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102517526 12:113459876-113459898 CAGGTTGGGGAGAGAGGGGAGGG - Intergenic
1104566884 12:129893395-129893417 CAGGGTGGGTAGGGTGGGGAGGG - Intronic
1105273948 13:18904052-18904074 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1105515406 13:21085269-21085291 GAGGATGGCTTGAGTGGGGAAGG + Intergenic
1105893878 13:24701870-24701892 TCGGTTGGCCAAAGTGGGGATGG - Intronic
1106299915 13:28454029-28454051 CTGGGTGGGGGGAGTGGGGAAGG + Intronic
1107012228 13:35680552-35680574 CAGGGTGGCCAAAGTCAGGGTGG + Intergenic
1107775456 13:43835310-43835332 TGGGGTGGGGAGAGTGGGGAGGG + Intronic
1107963617 13:45579868-45579890 CAGAGTGCCCTGGGTGGGGAAGG - Intronic
1108169808 13:47729560-47729582 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
1108498152 13:51044972-51044994 CAGGTGGCCCAGAGTGGGCAGGG + Intergenic
1109385640 13:61626255-61626277 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1109418477 13:62076508-62076530 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109525361 13:63567293-63567315 AAGGGTGAGCAGAGTGGTGAGGG - Intergenic
1109577096 13:64273721-64273743 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1109698444 13:65993141-65993163 TGGGGTGGCGGGAGTGGGGAGGG - Intergenic
1111387431 13:87544978-87545000 CAGGGTTGGAGGAGTGGGGAGGG + Intergenic
1111639321 13:90947445-90947467 CAGCTTGGCCACAGTGGGGTAGG + Intergenic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112179400 13:97062616-97062638 AAGTATTGCCAGAGTGGGGATGG + Intergenic
1112251534 13:97785076-97785098 AAGGCAGGCCAGAGTGAGGAGGG - Intergenic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1113605863 13:111605236-111605258 TGGGGTGGCGGGAGTGGGGAGGG - Intronic
1113857843 13:113458515-113458537 CAGGGCTGCCGGGGTGGGGAAGG - Intronic
1114409957 14:22491412-22491434 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
1114636037 14:24187427-24187449 CATGGTGGTCAGAGTGCGCAGGG + Exonic
1114823637 14:26051787-26051809 CAGGGTTGCAACAGTGGAGATGG - Intergenic
1114852369 14:26396624-26396646 CAAGGTGGCGAGATTGGGCATGG - Intergenic
1115122198 14:29951053-29951075 GAGGGTGGTGGGAGTGGGGAGGG - Intronic
1115410515 14:33068860-33068882 CAGGGAGGCCAGTGTGGTGGGGG + Intronic
1115704109 14:35980842-35980864 CGGGGTGGCAGGAGTGGGGAGGG - Intergenic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1117038875 14:51752265-51752287 CAGAGATGCCAGAGTGTGGAGGG + Intergenic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118661190 14:68014927-68014949 CCGGGTGGCCCTAGTGGGTAGGG - Intronic
1118970960 14:70637336-70637358 CAGAATGGGGAGAGTGGGGAGGG - Intergenic
1119110467 14:71968965-71968987 TGGGGTGGCAGGAGTGGGGAGGG - Intronic
1119850705 14:77864556-77864578 CAGGTTGGCCAGAGCTGGGCTGG + Intronic
1120339548 14:83202030-83202052 TGGGGTGGGCGGAGTGGGGAGGG - Intergenic
1120576564 14:86188297-86188319 TGGGGTGGGGAGAGTGGGGAGGG + Intergenic
1120693980 14:87623294-87623316 CTGGGTGACCAGAGTAGGCAAGG - Intergenic
1120823062 14:88930790-88930812 CAGGCTGGCCACAGTAAGGATGG + Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121299445 14:92858814-92858836 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1121399681 14:93662653-93662675 CAGGTAGGCCAGAGTGAAGACGG - Exonic
1121465265 14:94111718-94111740 CAGTGTGGCCAAAGTGGTCAGGG + Exonic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122122584 14:99562294-99562316 CAGGGGTGCCAGAGGAGGGAGGG - Intronic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122740374 14:103868533-103868555 CTGGGGGCCCAGAGTGGGCAGGG - Intergenic
1122863593 14:104593602-104593624 CAGGAAGGCCAGCGTGGTGATGG + Exonic
1122983290 14:105201130-105201152 GAGGGTGGGCTGTGTGGGGATGG + Intergenic
1122988058 14:105221700-105221722 CAGGCTGGCTGCAGTGGGGAGGG + Exonic
1123049656 14:105534842-105534864 CAGGGTGGCGGGGGTGGGCATGG - Intergenic
1123112880 14:105881279-105881301 CAGGATGGCCTCAATGGGGAGGG + Intergenic
1123184806 14:106506486-106506508 CAGGATGGTGACAGTGGGGAAGG + Intergenic
1202904297 14_GL000194v1_random:59616-59638 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1123399705 15:19972278-19972300 CAGGATGGTGACAGTGGGGAAGG + Intergenic
1123888169 15:24748648-24748670 CATGCTGGCCACTGTGGGGAGGG + Intergenic
1123990178 15:25677654-25677676 CAGGCTGGGCAGGGTTGGGACGG + Exonic
1124404985 15:29384461-29384483 CAGGATGGCTTCAGTGGGGAGGG - Intronic
1124513579 15:30347972-30347994 CAGGGTGGGCAGGGTGGCGGTGG - Intergenic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1124631274 15:31338935-31338957 CAGGGGGGCCTGAGGAGGGAGGG + Intronic
1124729342 15:32182793-32182815 CAGGGTGGGCAGGGTGGCGGTGG + Intergenic
1124804329 15:32866078-32866100 TGGGGTGGCGGGAGTGGGGAGGG + Intronic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126482099 15:49136176-49136198 CATGGTGGCAAGCGTGGGGAGGG + Intronic
1127194879 15:56573509-56573531 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1127613792 15:60663061-60663083 CAGGGAGATCAGAGTGGGGGTGG - Intronic
1127718792 15:61679312-61679334 CAGGGTGGCCAGAGTATGAGGGG - Intergenic
1128791238 15:70435425-70435447 CAGGGTGACGAGGGTGGGAAAGG + Intergenic
1129152389 15:73697126-73697148 CAGGGTGGCCCTTGTGGGGCAGG + Intronic
1129166857 15:73783392-73783414 CAGGAAGGCCACAGTGGAGATGG - Intergenic
1129239771 15:74244467-74244489 CATGATGGTCAGATTGGGGAAGG + Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129361915 15:75029623-75029645 CAGCCAGGCCAGAGTGGGGGAGG + Intronic
1129403890 15:75301776-75301798 CAGGGTGGCCAGGGTGGCACAGG - Intergenic
1129670693 15:77606194-77606216 TGGGGTGGCCAGGGTGGGGCAGG + Intergenic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1129691775 15:77717871-77717893 CAAGGGGGCCCGAGTGGAGAAGG + Intronic
1129857862 15:78837793-78837815 AAAGGTGGCCAGAGTCAGGAGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1130743208 15:86623283-86623305 CTGGTTGGCCAGGGTTGGGATGG + Intronic
1130975356 15:88769452-88769474 GTGGGTGGGGAGAGTGGGGAGGG - Intergenic
1131158321 15:90088567-90088589 CAGGTAGGCCAGGGTGGAGAGGG - Exonic
1131166556 15:90145850-90145872 CAGAGAGGCAAGAGAGGGGATGG + Intergenic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1132253443 15:100352057-100352079 CAGGGTGGACACAGTGGGAAGGG - Intergenic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1132607530 16:799870-799892 GACGGGGGCCAGAGTTGGGACGG - Intronic
1132651083 16:1021730-1021752 GCCGCTGGCCAGAGTGGGGACGG - Intergenic
1132663315 16:1071041-1071063 CAGGGTGGCCGATGTGGGGAGGG + Intergenic
1132765839 16:1533807-1533829 CAGGGTGGCCGGTGTGGAGCGGG - Exonic
1132832987 16:1938576-1938598 CAGGCCAGCCAGAGTGGGGATGG - Exonic
1133232013 16:4371472-4371494 CAGGATGGCGGGAGTGGGGCTGG - Intronic
1133234006 16:4379306-4379328 TAGGGGTGCCAAAGTGGGGAGGG + Intronic
1133272847 16:4619109-4619131 CAGGCTGGCAAGAGTTGGGCAGG + Intronic
1134083404 16:11340069-11340091 AAGGGTTCCCAGGGTGGGGATGG + Intronic
1134365395 16:13572498-13572520 GAGGGTTGGGAGAGTGGGGAGGG + Intergenic
1135046917 16:19163495-19163517 CAGGGAGGCCAGTGAGGAGATGG - Intronic
1135163252 16:20116044-20116066 CAGGGTCCCCAGAGTTGGAAGGG + Intergenic
1135504683 16:23026191-23026213 GGAGGAGGCCAGAGTGGGGACGG + Intergenic
1136406936 16:30053513-30053535 GAGGGGGCCCAGAGAGGGGAAGG - Intronic
1136576823 16:31130176-31130198 CGGGGTGGGGAGGGTGGGGAGGG + Intronic
1136634435 16:31510647-31510669 CAGCATGTCCTGAGTGGGGAGGG + Intergenic
1137249091 16:46729917-46729939 CAGGATGGCCTCAGTGGTGAGGG - Intronic
1137406793 16:48195399-48195421 CATGGTGGACGGGGTGGGGACGG + Intronic
1137574660 16:49590849-49590871 CAGAGTGGCCAGAGTGGTGGTGG - Intronic
1137765579 16:50975239-50975261 CAGGTGAGCCAAAGTGGGGAAGG - Intergenic
1138184133 16:54963492-54963514 CAGGGCGGCCACCGGGGGGATGG - Intergenic
1138348110 16:56332251-56332273 GAGGGTGGCCAGAGTCCGGCTGG - Intronic
1138454206 16:57112199-57112221 CAGGGGCCCCAGAGTGGGTAGGG + Intronic
1138510471 16:57505812-57505834 CAGGGTGGGGATGGTGGGGACGG + Intergenic
1138590993 16:57999935-57999957 CAGGAGGGCCAGGGTGGGCAGGG - Intronic
1138595698 16:58027842-58027864 GAGGGTGGCCAGACTGGGTCGGG - Intronic
1139211651 16:65083569-65083591 CAGGATGGCTAGAATGGGAAAGG - Intronic
1139607890 16:68032940-68032962 CAGGGTGGCCAGGGCCGAGAGGG + Intronic
1139625694 16:68187045-68187067 AAGGGTGAGCAGAGTGGGAAGGG + Intronic
1140519088 16:75566575-75566597 CAGGGCCGCCCGAGTGGGGGAGG - Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141497515 16:84420165-84420187 CAGGGTGTACAGAGCAGGGAGGG - Intronic
1141700138 16:85638698-85638720 GGGGGTGGCAAGAATGGGGAAGG - Intronic
1141742499 16:85903206-85903228 CACTGTGCCCACAGTGGGGAAGG - Intronic
1142146848 16:88496344-88496366 GAGGGAGGGCAGAGTGGGGCTGG + Intronic
1142153807 16:88524203-88524225 CAGGAAGGCCAGGGTGGGGAGGG + Intronic
1142187471 16:88701359-88701381 CAGAGTGGGCACAGCGGGGATGG + Exonic
1142239201 16:88937488-88937510 CGGGAGGGCCAGCGTGGGGACGG - Intronic
1142265929 16:89063966-89063988 GTGGGTGACCAGGGTGGGGATGG - Intergenic
1142357064 16:89606215-89606237 GGGGCAGGCCAGAGTGGGGAGGG + Intergenic
1142401017 16:89858840-89858862 CAGGGCAGCCAGGGTGGGCAGGG - Intronic
1142431119 16:90027939-90027961 CAGGGTGGTAGGAGTGTGGAAGG + Intronic
1142847958 17:2691144-2691166 CAGGATGGGAAGCGTGGGGAGGG + Intronic
1143019168 17:3907794-3907816 CAAGGAGGCCAGTGGGGGGATGG - Intronic
1143026260 17:3943656-3943678 CAGGGCGGCCAGGCTGGGAAGGG - Intronic
1143057845 17:4175792-4175814 CTGGGAGGAGAGAGTGGGGAAGG + Intronic
1143105750 17:4529947-4529969 ATGGGTGGCCAGGGTGGGGCTGG + Intronic
1143184589 17:5002669-5002691 CAAGGGGGCCAGGGTTGGGAAGG + Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143465534 17:7133956-7133978 TGGGGTGGCCAGAAGGGGGATGG + Intergenic
1143503688 17:7352585-7352607 GAGGGCAGCCAGAGAGGGGAAGG - Exonic
1143571310 17:7760377-7760399 CAGGGGGGCCAGACTGGGGAAGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143723256 17:8828465-8828487 CAGGGTGGCAAGAGAGGGTCAGG - Intronic
1144076859 17:11727392-11727414 CAGGTTTTCCAGAGTGGTGAGGG - Intronic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1144754715 17:17672079-17672101 CTGGGTGGCGGGGGTGGGGAGGG + Intergenic
1145417145 17:22727329-22727351 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1145846412 17:28042259-28042281 CAGGTTGACCTGATTGGGGAGGG - Exonic
1145987208 17:29055028-29055050 CAGAGTGGCATGAGTGGTGAGGG - Intronic
1146057041 17:29586700-29586722 CAGGGTTGCCAAAGTGGAAAAGG + Intronic
1146499751 17:33354315-33354337 CAGGGGGCTCATAGTGGGGATGG - Intronic
1146653653 17:34622595-34622617 CTGGGTGGCCACTGAGGGGAGGG - Intronic
1147371580 17:39996477-39996499 CAGGGGGCCCAGAATGGGGAGGG + Intronic
1147880803 17:43652150-43652172 CAGAGTGGCCAGCGTGGGAGGGG - Intronic
1147892614 17:43727927-43727949 TTGGGAGGCCAAAGTGGGGATGG + Intergenic
1148092905 17:45033298-45033320 CAAGATGGCCAGGGTGGGTAGGG - Intronic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1148287839 17:46411576-46411598 CAGGTTGGCCAGAAGTGGGATGG + Intergenic
1148310008 17:46629156-46629178 CAGGTTGGCCAGAAGTGGGATGG + Intronic
1148603201 17:48909077-48909099 GAGGGTGGCCGGAATGGAGACGG - Intronic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148860266 17:50600940-50600962 CAGGGTGGCCTCAGCTGGGAGGG + Intronic
1149058744 17:52395751-52395773 AAGGCTGGTGAGAGTGGGGAAGG - Intergenic
1150125188 17:62630571-62630593 CTGGGAGGCCAGAATGGGGATGG + Intronic
1150136212 17:62696746-62696768 CCAGGTGGCCAGAGCGGGGCGGG - Intergenic
1150251341 17:63706421-63706443 AAGGGAGGCCAGCTTGGGGAGGG - Intronic
1150292217 17:63988469-63988491 CAGAGTGGCCTGAGTGGAGTTGG - Intergenic
1150699738 17:67436500-67436522 TAGGGAGGCCAGGGAGGGGAAGG + Intronic
1150850184 17:68696757-68696779 GGGGGTGGTGAGAGTGGGGATGG + Intergenic
1151194926 17:72424636-72424658 CAGGGCGGCCAGTGGGAGGAGGG - Intergenic
1151482747 17:74379960-74379982 CAAGCTCCCCAGAGTGGGGAAGG - Intergenic
1151517792 17:74607597-74607619 CATGGAGGGCAGAGTGTGGAAGG + Intergenic
1151625759 17:75274545-75274567 CAGTTTGGCCAGAGGTGGGAAGG - Intronic
1151701057 17:75742768-75742790 CTGGGTGGGGAGAGTGGGGAAGG + Intronic
1151876464 17:76870151-76870173 CAGGGGGACCACAGTGGGGCTGG - Intronic
1152214511 17:79024551-79024573 CCTGGTGGCCAGGGCGGGGATGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152380926 17:79941924-79941946 CTGGGGGGCCATGGTGGGGATGG + Intronic
1152725143 17:81941451-81941473 CAGGGTGGCCAGCATGGCGAAGG + Exonic
1153798985 18:8651866-8651888 CAGGGTGGCGAGCTAGGGGAGGG + Intergenic
1153971817 18:10234060-10234082 CAGTGTGGCCTGAGTCAGGATGG - Intergenic
1153989072 18:10379134-10379156 CCGGGCTGCCAGAGTGGGGTTGG + Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1154465614 18:14641105-14641127 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1155294346 18:24371632-24371654 CAGGGAGCACAGAGTAGGGAGGG - Intronic
1155427556 18:25722455-25722477 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
1155519580 18:26656020-26656042 AAGGGTGGCGGGAGTGGGTAGGG + Intronic
1155979487 18:32165708-32165730 CACGGGAGCCACAGTGGGGATGG - Intronic
1156309959 18:35912570-35912592 AAGGGTGGACAGTGTGGTGAAGG - Intergenic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1156816453 18:41317119-41317141 CTGGGTGGGCTGAGTGGGCAGGG + Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157592319 18:48843192-48843214 GAGGGTGGCCTCAGTGGGGAGGG + Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157784698 18:50471057-50471079 CAGGGTAGCTGGAGTGAGGATGG - Intergenic
1159766004 18:72489223-72489245 CAGAGAGGCCAGAGTGTGGGGGG + Intergenic
1159800583 18:72894629-72894651 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1160750960 19:734234-734256 TCTGGTGGCCAGAGAGGGGATGG + Intronic
1160841289 19:1148016-1148038 CAAGGGGGCCGGAGTGGGGAAGG - Intronic
1161016335 19:1985577-1985599 GGGCGTGGCCGGAGTGGGGAGGG + Exonic
1161041849 19:2114634-2114656 CAGGGTGGGCAGGCTGGGGTGGG - Intronic
1161055364 19:2188297-2188319 CAGGGTGGCCAGGGCAGGGCAGG + Intronic
1161284106 19:3459961-3459983 CAGGGTGGACTGTGAGGGGAGGG - Intronic
1161285803 19:3467699-3467721 TGGGGAGGCCAGAGTGGGTAGGG - Intronic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161332885 19:3696715-3696737 CAGGGAGGGCAGAGTGCGGAGGG + Intronic
1161445817 19:4318573-4318595 CAGTGTGGTCAGAGTTGGGGTGG + Intronic
1161581063 19:5081398-5081420 GAGTGTCCCCAGAGTGGGGAGGG + Intronic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1161768038 19:6217497-6217519 CAGGGTGGCCTGCCTGGAGAGGG + Intronic
1162109444 19:8392097-8392119 CACGGTGGGCTGAGTGGAGATGG - Intronic
1162109526 19:8392489-8392511 AAAGGAGGCCAGTGTGGGGAGGG - Intronic
1162186957 19:8913148-8913170 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1162471070 19:10872128-10872150 CAAGGTGCCCAGAGTGAGCAAGG + Intronic
1162531169 19:11237232-11237254 CAGGGTGGCTAAAGTGGGAATGG + Intronic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1162765322 19:12915843-12915865 AAGTGTGGGCAGGGTGGGGAAGG - Intronic
1162850826 19:13429980-13430002 TAGGGTGGGGGGAGTGGGGAGGG + Intronic
1163370225 19:16897350-16897372 GAGGGTGGTCAGTGTGGTGAGGG - Intronic
1163502594 19:17685940-17685962 GATGGTGCCCAGAGAGGGGAGGG - Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163737014 19:18987835-18987857 CAGGCTGGCCAGGGAGGGGTGGG + Intergenic
1164416293 19:28048897-28048919 CAGGCTGGCCCCAGTGAGGATGG + Intergenic
1164416564 19:28050672-28050694 CAGGCTGGCCCCAGTGAGGATGG - Intergenic
1164716257 19:30392415-30392437 CAGGGTAGCCAGAGAAGGGTTGG + Intronic
1164826668 19:31289353-31289375 AAGGCTGCCCAGAGTGAGGAGGG - Intronic
1165029693 19:32988805-32988827 CAGGGTGGAATGACTGGGGAGGG - Intronic
1165086377 19:33350980-33351002 CACACTGGCCAGACTGGGGAGGG + Intergenic
1165139434 19:33689961-33689983 CAGGGAGGCCAGAGCAGGAAGGG + Intronic
1165152058 19:33766726-33766748 CAGGCTGGCCCGACTGGGGGTGG - Intronic
1165261250 19:34620516-34620538 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1165396520 19:35567178-35567200 CAGGGTGGACATGGTGGGGAGGG + Intergenic
1165723185 19:38093940-38093962 CACTGGGGACAGAGTGGGGATGG + Intronic
1165792622 19:38500999-38501021 GAGGGTGGCCAGGCTGGGCAGGG - Intronic
1165797329 19:38526664-38526686 CTGGGGGGTCAGAGTGGGGCAGG - Intronic
1165828561 19:38719345-38719367 CATGCGGGCCAGGGTGGGGAGGG - Intronic
1166200139 19:41232098-41232120 CAGAGTGGCCAGGGCTGGGATGG - Intronic
1166345033 19:42160200-42160222 CTGGGTGGGCAGAGTGGAGAAGG + Intronic
1166457159 19:42951434-42951456 CACGGTGGTGAGTGTGGGGAGGG + Intronic
1166467103 19:43042294-43042316 CATGGTGGTGAGTGTGGGGAGGG + Intronic
1166473237 19:43098377-43098399 CATGGTGGTGAGTGTGGGGAGGG + Intronic
1166704988 19:44903549-44903571 CAGGGTGGACTGACCGGGGATGG - Exonic
1166796421 19:45428845-45428867 CAGGGGGGCCCGAGTGGAGGGGG + Intronic
1166859246 19:45800346-45800368 CAGGGTGGGCAGAGATGGGGAGG - Intronic
1167146057 19:47681236-47681258 CAGGGAGTCCTGAGTGAGGATGG - Exonic
1167419282 19:49393884-49393906 CAGGGTGGGCAGTGAGGGAATGG - Intronic
1167575018 19:50313861-50313883 TGGGGTGGCAGGAGTGGGGAGGG + Intronic
1167694793 19:51009150-51009172 CAGGCTGGCCATGCTGGGGAGGG - Intronic
1167758129 19:51426239-51426261 CAGGGGAGCCATAATGGGGATGG - Intergenic
1168660642 19:58163162-58163184 CAGGGTCGGGAGAGGGGGGAGGG + Intergenic
925003497 2:424691-424713 CAAGGAGGTCAGAGTGGAGAGGG + Intergenic
925275459 2:2645139-2645161 CAGGGTGGCCAGAGGTGGAGGGG - Intergenic
925641600 2:5990586-5990608 CCGGGTGGTCAGAGTGAGGCTGG - Intergenic
925880181 2:8345746-8345768 CAGGGTGCCCAGAGGAGGCATGG - Intergenic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
926113321 2:10196236-10196258 AAAGGTGGCCAGAGAGGGGTGGG + Intronic
926188157 2:10707814-10707836 TTGGGAGGCCAAAGTGGGGAAGG - Intergenic
927103848 2:19807782-19807804 CATGGGAGCCAGTGTGGGGAGGG + Intergenic
927515786 2:23670874-23670896 CAGAGTGGGCAGAGAAGGGAGGG + Intronic
927714389 2:25342403-25342425 CGGGGCGCCCAGCGTGGGGAGGG - Intronic
927978230 2:27356546-27356568 CACGGTGGCCACAGTAGGGAAGG + Intronic
929234437 2:39591391-39591413 CAGGGATGGGAGAGTGGGGAGGG - Intergenic
929279463 2:40062103-40062125 CAGGGTGGCAGCAGTAGGGAAGG - Intergenic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
929779135 2:44946535-44946557 GACAGTGGCCTGAGTGGGGAAGG + Intergenic
929916874 2:46143689-46143711 CACAGTGGCCAGGGTGGGGGTGG + Intronic
930769823 2:55120104-55120126 CTGGGTGTCCAGAGTGGGCATGG - Intergenic
931046817 2:58363134-58363156 CAGGGAGGGAACAGTGGGGAAGG - Intergenic
931199324 2:60081940-60081962 CAGGGTGGCCAGAATGACTAGGG - Intergenic
931464403 2:62474007-62474029 CAGGGAGGCCACACTGAGGATGG + Intergenic
932400260 2:71475602-71475624 CAGAGTGGGCACAGAGGGGAGGG + Intronic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932569407 2:72930524-72930546 CAGAGAGGTCAGAGTGGGCAAGG + Intronic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
933690846 2:85178492-85178514 CAGGGTGGCAGGGGTGGGAAGGG + Intronic
933779083 2:85788917-85788939 CAGACTGGACAGAGTGGGCATGG + Intergenic
934502344 2:94870781-94870803 CAGGCTGGGCACAGCGGGGAGGG - Intergenic
934772047 2:96913405-96913427 CAGGGAGTCCACAGTGGAGAAGG + Intronic
935097753 2:99961963-99961985 CATGGTGGTCTGAGTTGGGAAGG - Intronic
937149058 2:119673469-119673491 CAGTGGGGACAGAGTAGGGAGGG - Intergenic
937216425 2:120316361-120316383 CAGGGTGGCCAGAGCCAGGGAGG + Intergenic
937295570 2:120807902-120807924 CTGGGTGGGCAGGGTGGGGAGGG + Intronic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938070617 2:128306404-128306426 CATCGTGGCCAGGGTGGGGTGGG - Intronic
938082816 2:128379299-128379321 GAGGGAGGCGAGAGGGGGGAAGG - Intergenic
939157119 2:138538889-138538911 TGGGGTGGGGAGAGTGGGGAGGG - Intronic
940005574 2:149006812-149006834 CAGGGAGGCTAGAGAGGGGAGGG + Intronic
940455017 2:153886353-153886375 CGGGGTGGGGGGAGTGGGGAGGG - Intronic
940462342 2:153981357-153981379 TGGGGTGGGCAGAGTGGGGAGGG - Intronic
940701880 2:157055039-157055061 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
941274105 2:163469219-163469241 TGGGGTGGGCAGAGTGGGGAGGG - Intergenic
941696118 2:168552667-168552689 CAGGCTGGCAAGAGTGGAGGAGG + Intronic
941970888 2:171350103-171350125 TGGGGTGGCGGGAGTGGGGAGGG - Intronic
942511503 2:176707847-176707869 CGGGGTGGGGGGAGTGGGGAGGG - Intergenic
942881032 2:180860566-180860588 GACGGTGGCCAGTGTGGGCAGGG - Intergenic
944094826 2:195954168-195954190 TGGGGTGGGGAGAGTGGGGAGGG - Intronic
944164055 2:196698831-196698853 CCGGGTGGGGAGAGGGGGGAGGG - Intronic
945067862 2:205962191-205962213 CAGGGTGGCCAGTCAGTGGATGG - Intergenic
946158992 2:217824733-217824755 TAGGGTGGCAAGAGACGGGAGGG - Intronic
946225595 2:218262649-218262671 TGGGGTGGCCAGAGTTAGGATGG - Exonic
946284407 2:218692290-218692312 CAAGGTAACCAGAGTGGAGAAGG + Exonic
946310182 2:218878957-218878979 CATGGTAGGGAGAGTGGGGAGGG + Intergenic
946661339 2:222003250-222003272 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
947988123 2:234466012-234466034 CAGGGTGGGAATGGTGGGGAGGG + Intergenic
948260361 2:236599989-236600011 CAGGGTGGGGAGTGAGGGGAGGG - Intergenic
948338531 2:237230657-237230679 CAGGGTGGCATGAGTTTGGAAGG - Intergenic
948367136 2:237464015-237464037 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
948465437 2:238149682-238149704 CAGGGTGGCCAAGTTGGGGAGGG + Intronic
948632851 2:239313037-239313059 CAAGGTGGCCAGCCTGGGGCAGG + Intronic
948785469 2:240350169-240350191 AAGGGTGGCCAGGATGGGGCAGG + Intergenic
1169084985 20:2820970-2820992 CAGGGTCGTCAGGGAGGGGAAGG + Intergenic
1169235381 20:3926038-3926060 GTGGGTGGCCAGAATGGAGAGGG + Intronic
1169265005 20:4162155-4162177 CAGGGCGGCCCGGGTGGGGCTGG + Intronic
1169289925 20:4340863-4340885 CAGGCTGCCCACAGTGGTGATGG + Intergenic
1170061695 20:12265817-12265839 CAGGGTGCCCAGTGAGGGCAGGG + Intergenic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171118884 20:22550952-22550974 AAGGGTAGGCACAGTGGGGAGGG - Intergenic
1171170190 20:23008951-23008973 CAGGGTGGGTAGAGATGGGAAGG + Intergenic
1171756131 20:29111544-29111566 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
1172045882 20:32079888-32079910 CAGGGAGGACAAGGTGGGGAGGG - Intronic
1172274839 20:33673896-33673918 CAGGCTGGGCTGACTGGGGAAGG - Intronic
1172311078 20:33918887-33918909 CAGGGAGGCCAGGGAGGGGCTGG - Intergenic
1172487135 20:35305084-35305106 CAGGGAGGGCAGAGTGCTGAAGG - Intronic
1172526414 20:35602569-35602591 CCGGGTGGCCATAAAGGGGAGGG + Intergenic
1173086361 20:39922600-39922622 TGGGGTGGCAGGAGTGGGGAGGG + Intergenic
1173125612 20:40333360-40333382 CAGGGAGGCCAGAGAGGGACTGG - Intergenic
1175158975 20:56994085-56994107 CAGGGAGGTCAGAGAGGGGCAGG - Intergenic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1175367645 20:58466954-58466976 CACGCGGACCAGAGTGGGGAGGG + Intronic
1175516874 20:59575688-59575710 CTGGGTCCACAGAGTGGGGAAGG + Intergenic
1175639991 20:60620892-60620914 CAGGCTGGCAGGGGTGGGGATGG + Intergenic
1175701488 20:61140832-61140854 CAGGGGGGCCAGCTTGGGGGTGG + Intergenic
1175716074 20:61254440-61254462 CAGGGAGGCCAAAGTGTGGGCGG - Intronic
1175727940 20:61332241-61332263 CAGGGTGGGCGGAGCGGTGACGG + Intronic
1175743339 20:61435969-61435991 AAGTGTGGCCAGACTGGAGAAGG - Intronic
1176023433 20:62974049-62974071 CAGGCTGCCTAGAGTGGGGGGGG - Intergenic
1176046722 20:63096775-63096797 CTGAGTGGCCACAGTGGGGATGG + Intergenic
1176294792 21:5065704-5065726 CAGTGACGCCAGAGTCGGGACGG - Intergenic
1176623670 21:9074383-9074405 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1176808943 21:13517377-13517399 GAGGGTGGCGAGAGGGAGGAGGG + Intergenic
1177348122 21:19900101-19900123 CAGGGAGGCCGGCGGGGGGAAGG - Intergenic
1178898032 21:36576736-36576758 CAGAGTGGACAGAGTAGGAATGG - Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179750818 21:43466534-43466556 CAGGGTGGTCGGAGGGGGGGGGG - Intergenic
1179791792 21:43760016-43760038 CTGGGAGTCCGGAGTGGGGACGG - Exonic
1180012193 21:45058566-45058588 CAGTGGGGGCAGAGTGGGGAGGG + Intergenic
1180696501 22:17754410-17754432 CAGGGTGCCCAGGGAGGGCAGGG + Intronic
1180698955 22:17771426-17771448 CAGCTTGGCCAGGGTGGGGGTGG - Intronic
1180834228 22:18921872-18921894 CAGGGAGGACACAGTGGGCAAGG + Intronic
1180841018 22:18958894-18958916 CATGGCGGGCAGAGTGTGGAGGG - Intergenic
1180844516 22:18973875-18973897 CAGGCTTGCCAGAATGGGGGCGG - Intergenic
1181060476 22:20279899-20279921 CATGGCGGGCAGAGTGCGGAGGG + Intronic
1181065585 22:20304231-20304253 CAGGGAGGACACAGTGGGCAAGG - Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181800001 22:25340242-25340264 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1181948337 22:26536317-26536339 CAGGGTTGCCATAGTTGGGGGGG + Exonic
1181990587 22:26833820-26833842 CAGGGTGGCAAGAGGTGGGAAGG + Intergenic
1182142040 22:27967788-27967810 GAGGCTGGCCAGGGTGAGGAGGG - Intergenic
1182522196 22:30891005-30891027 CAGCTTGGCCAGAGTGTGGGTGG - Intronic
1182548043 22:31086879-31086901 CCAGGTGGCAAGGGTGGGGATGG - Intronic
1183292736 22:37012628-37012650 CAGGGTGGCAGGAGTGGGAGGGG + Intronic
1183458643 22:37936381-37936403 CAGGAGGGACAGAGTGGGGCAGG - Intronic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184567610 22:45301558-45301580 CAGGGTGGGCAGGGGTGGGATGG - Intergenic
1184639689 22:45863819-45863841 GAGGGGGCACAGAGTGGGGAAGG - Intergenic
1203284317 22_KI270734v1_random:147171-147193 CAGGGAGGACACAGTGGGCAAGG + Intergenic
949564505 3:5232364-5232386 CCTGGTGGGCAGTGTGGGGATGG + Intergenic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
951585358 3:24209675-24209697 TAGGGTGGGCGGAGCGGGGAGGG + Intronic
953001557 3:38938230-38938252 TGGGGTGGGCGGAGTGGGGAGGG + Intronic
953098150 3:39799112-39799134 GAGGGTGGGGAGGGTGGGGAGGG - Intergenic
953650594 3:44799631-44799653 CAGGATGTCAAGAGTGGGGCAGG - Intronic
953744966 3:45567178-45567200 CAGGGAGGCCTGTGTGGGGATGG - Intronic
954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG + Intronic
954698466 3:52439829-52439851 CAGGGTGGCCAGGCTGGAGAGGG - Intronic
954833187 3:53440881-53440903 TAGGGTGGGGAGAGTGGGGAGGG - Intergenic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
956004292 3:64762200-64762222 CAGGTGGCCCTGAGTGGGGAAGG - Intergenic
956204076 3:66738127-66738149 TAGGATGGCCAGAAAGGGGATGG + Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
959056695 3:101574340-101574362 CAGGGTGGGGGGAGTGGGGTGGG + Intronic
959891964 3:111567039-111567061 CAGGATGTCCACAGTGGGGGAGG + Intronic
959993854 3:112659288-112659310 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
960517771 3:118621149-118621171 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
961084741 3:124057227-124057249 CAGAGTGGCAAAAGTGGGGGCGG - Intergenic
961473278 3:127131854-127131876 AAGGGTGCCCAGAGCAGGGAGGG + Intergenic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961986152 3:131137324-131137346 CAGGGTGGACAGGGAAGGGATGG + Intronic
962279164 3:134037368-134037390 CAGGTTGGCCAGGGTGGTGAAGG - Intronic
962691468 3:137902864-137902886 AAGGGTGGGGAGAGGGGGGAGGG + Intergenic
962753479 3:138451319-138451341 CAAGGTGGGCAGAGGTGGGAGGG + Intronic
963042501 3:141079918-141079940 CATGGAGGGCAGAGTGGGGGTGG + Intronic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
964182355 3:153903968-153903990 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964582288 3:158253906-158253928 TGGGGTGGAGAGAGTGGGGAGGG - Intronic
964690154 3:159441479-159441501 CGGGGTGACAGGAGTGGGGAAGG + Intronic
964943045 3:162185123-162185145 CTGTGAGGCCATAGTGGGGATGG - Intergenic
965599039 3:170437286-170437308 CAGGGAGGCCAGTGTGGGGCTGG + Intronic
965952134 3:174322365-174322387 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
966098633 3:176239062-176239084 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
966183099 3:177204376-177204398 GAGCGTGGCCAGAGTGGGCGCGG + Intergenic
966554661 3:181245361-181245383 CACCGGGGCCAGTGTGGGGATGG + Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
968065606 3:195757407-195757429 GAGGGTGGCCTGAGAGGGGTGGG - Intronic
968073374 3:195801997-195802019 CAGGGTGGCCAGAGAGGGAGGGG - Intronic
968148666 3:196320367-196320389 CAGGCCTGCCAGGGTGGGGAAGG - Intronic
968317652 3:197737544-197737566 CTGGGTAGCCAGAGCTGGGAAGG + Intronic
968555743 4:1245670-1245692 CAGGGTGGCACGGGTGGGCAGGG + Intronic
968555758 4:1245725-1245747 CAGGGTGGCACGTGTGGGTAGGG + Intronic
968710558 4:2113236-2113258 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
969200396 4:5599571-5599593 TGGGGTGGGCAGAGGGGGGAGGG + Intronic
969475525 4:7420568-7420590 CAGGGTGTCCAGTGTGGCCATGG + Intronic
969592542 4:8130225-8130247 CAGGGTGGCCAGGGTGGTGCTGG + Intronic
970121186 4:12754132-12754154 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
970983548 4:22129145-22129167 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
970999929 4:22310471-22310493 TGGGGTGGGCGGAGTGGGGAGGG + Intergenic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
974106056 4:57471385-57471407 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
974182936 4:58406374-58406396 TGGGGTGGGGAGAGTGGGGAGGG + Intergenic
976126384 4:81837750-81837772 CAGGGTGGAGGGAATGGGGAAGG - Intronic
976271696 4:83237182-83237204 CAGGGTAGCCAGAGTGGCACTGG - Intergenic
976910931 4:90304648-90304670 TGGGGTGGGGAGAGTGGGGAGGG + Intronic
977081949 4:92541143-92541165 TAGGGTGGGGAGAGGGGGGAGGG + Intronic
977802715 4:101256987-101257009 CAGGGTTGCCCAAGTAGGGAAGG + Intronic
979098452 4:116582726-116582748 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
979804162 4:124950224-124950246 TGGGGTGGGGAGAGTGGGGAAGG - Intergenic
979818033 4:125134390-125134412 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980610013 4:135148191-135148213 CGGGGTGGGGAGAGGGGGGAGGG - Intergenic
981419985 4:144538295-144538317 CACTGAGGCCAGAATGGGGATGG + Intergenic
981658290 4:147137192-147137214 CAGGATGGCCACAGTGGGGATGG - Intergenic
981704880 4:147648417-147648439 GAGGGTGCCCAGAGAGGGCATGG + Intronic
984299520 4:177896826-177896848 TGGGGTGGGGAGAGTGGGGAGGG + Intronic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
985236631 4:187882335-187882357 TGGGGTGGCGGGAGTGGGGAGGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985578759 5:685737-685759 CAGCGTGGCCACTCTGGGGACGG + Intronic
985719595 5:1482283-1482305 CAAGGTCGCCTAAGTGGGGAGGG + Intronic
985782433 5:1878256-1878278 CCAGGGCGCCAGAGTGGGGAAGG + Exonic
985789080 5:1915767-1915789 CAGTGGGGGCAGAGTGGGGTGGG + Intergenic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
986232626 5:5880684-5880706 GAGGGCGGGCAGTGTGGGGAGGG - Intergenic
986410544 5:7474937-7474959 CAGCCTAGCCTGAGTGGGGAAGG + Intronic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
987446167 5:18022085-18022107 GAGGGGGGCCGGAGTGGGTAAGG - Intergenic
988616419 5:32779469-32779491 CGGGGTGGCCAGAGAACGGAGGG - Intronic
988850995 5:35180726-35180748 TGGGGTGGGGAGAGTGGGGAGGG - Intronic
988939655 5:36130037-36130059 TAGGGTGGCGGGAGCGGGGAGGG + Intronic
989816410 5:45743211-45743233 TGGGGTGGCGGGAGTGGGGAGGG - Intergenic
989947352 5:50254607-50254629 TGGGGTGGGCAGAGTGGGGAGGG + Intergenic
989947483 5:50257124-50257146 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
990643164 5:57811036-57811058 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
993478010 5:88388785-88388807 TGGGGTGGCAAGGGTGGGGAAGG + Intergenic
993520178 5:88890017-88890039 CCGGCTGGCCAGAGTGGGACAGG - Intronic
993706473 5:91177455-91177477 CAGGGTGGCTGGAGTGGTAAGGG - Intergenic
995652999 5:114392443-114392465 CTGGGTGGCCAGAGTGAACAGGG + Intronic
995699154 5:114914825-114914847 TGGGGTGGCGGGAGTGGGGAGGG - Intergenic
996003274 5:118388959-118388981 TGGGGTGGGGAGAGTGGGGAGGG + Intergenic
996735957 5:126758634-126758656 CATGGAGGCGAGAGTGGGGGTGG + Intergenic
996831653 5:127747247-127747269 CGGGGTGGGGAGAGGGGGGAGGG - Intergenic
997352958 5:133244086-133244108 AATGGGGGCCAGAGTAGGGAGGG + Intronic
997459895 5:134044899-134044921 CAGGATGGCCAGAGTTGAGGGGG - Intergenic
997472109 5:134122864-134122886 CAGGGAGGCCAGATCAGGGAAGG + Intronic
997873786 5:137529665-137529687 TAGGGTGGTGGGAGTGGGGAGGG + Intronic
997875519 5:137543265-137543287 TAGGGTGGGGGGAGTGGGGAGGG + Intronic
997878679 5:137571015-137571037 CAGGGTGGCCCAGGTGGGGAGGG + Intronic
998380049 5:141717852-141717874 CAGTATGGCCAGGGTGGTGATGG + Intergenic
998671051 5:144354458-144354480 TAGGCTGGCCAGAGGGTGGAAGG - Intronic
998956781 5:147446845-147446867 CAGGGTGGAAGGATTGGGGATGG - Intronic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999203472 5:149832624-149832646 GAGAGAGGCCAGAGTGAGGAAGG - Intronic
1000338717 5:160260800-160260822 CAGGGTTGGCTGAGTGAGGAGGG - Intronic
1000664589 5:163979549-163979571 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
1001426896 5:171628796-171628818 CAGGGCTGTCAGTGTGGGGAGGG - Intergenic
1002193676 5:177491321-177491343 GAGGGCAGCCAGGGTGGGGAGGG + Intronic
1002278211 5:178116400-178116422 CAGGAGGGGCACAGTGGGGACGG + Intronic
1002400503 5:178989203-178989225 GAGGGTGGTGAGGGTGGGGAGGG - Intronic
1002400511 5:178989221-178989243 GAGGGTGGGGAGGGTGGGGAGGG - Intronic
1002400516 5:178989230-178989252 CAGGGTGGTGAGGGTGGGGAGGG - Intronic
1002519881 5:179786491-179786513 CTGGGAAGCCACAGTGGGGAAGG + Intronic
1002600382 5:180351407-180351429 CAGGGTGGGGGAAGTGGGGAGGG - Intronic
1002638741 5:180620546-180620568 AGGGGCGGCCAGGGTGGGGAAGG + Intronic
1003115458 6:3280973-3280995 CAGGGCTGCCGGAGTGGGCAGGG + Intronic
1003948179 6:11094076-11094098 CGGGGTGGCCAGAGCGCGGGAGG - Exonic
1004137665 6:12983687-12983709 TGGGGTGGCGGGAGTGGGGAGGG - Intronic
1004331951 6:14729569-14729591 GAAGGTGGCCTGAATGGGGACGG + Intergenic
1004866300 6:19856581-19856603 GAGGGGGGCAGGAGTGGGGAAGG + Intergenic
1005666430 6:28062291-28062313 TAGGGTGTCCAGAGGAGGGAGGG + Intergenic
1005695762 6:28351322-28351344 GAGGGTGTCCACGGTGGGGAAGG - Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006303972 6:33208148-33208170 CAGGGTACGCAGAGTGGGGGAGG + Intergenic
1006554234 6:34852109-34852131 CAGCTTGGCCATAGTGGGGTAGG - Intronic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007696414 6:43736872-43736894 CTGGAAGGCCACAGTGGGGAAGG - Intergenic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1007957882 6:45933746-45933768 CTGGGTGGACAGAGAGGGGCAGG + Intronic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1008598744 6:53068087-53068109 CAGGGCGGCCAGGGGGGGGAGGG - Intronic
1008856571 6:56095406-56095428 GAGAGTGGTCAGAGTTGGGAGGG - Intronic
1009291262 6:61885855-61885877 AAGGAAGGCCATAGTGGGGAGGG - Intronic
1009708796 6:67290532-67290554 TGGGGTGGGGAGAGTGGGGAGGG + Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1010552653 6:77242104-77242126 TAGGGTGGCTAGAGAGGGGGAGG + Intergenic
1010898921 6:81401519-81401541 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
1011432932 6:87307024-87307046 TAGGGTGGGGAGAGTGGGGAGGG + Intronic
1011992840 6:93545705-93545727 TTGGGTGGGGAGAGTGGGGAGGG - Intergenic
1012503746 6:99920577-99920599 CAGTGAGGCCACAGTGTGGAGGG + Exonic
1012543988 6:100395711-100395733 CAGGGTGGGCCTAGTGGTGAGGG - Intronic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1012840824 6:104326931-104326953 CAGGGAGGCCAGTATGGTGAGGG - Intergenic
1012925338 6:105261832-105261854 CAGGGGATCCAGAGTGGGGCAGG - Intergenic
1014069282 6:117162279-117162301 CAGAGTGGGCAGCGTGGAGACGG - Intergenic
1014402835 6:121012326-121012348 TGGGGTGGGCAGAGCGGGGAGGG + Intergenic
1015359989 6:132329105-132329127 TGGGGTGGGGAGAGTGGGGAGGG - Intronic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1015609351 6:134999248-134999270 TATGGTGGACAGAGTGGGCAGGG + Intronic
1015920793 6:138264654-138264676 CAGGGAGTCTAGAGAGGGGAGGG - Intronic
1015938610 6:138426763-138426785 AAGGGTGGCCAGAGTGGACAGGG + Intronic
1016559453 6:145378720-145378742 GAGAGTGGCCAGTGTGGGGGAGG + Intergenic
1016621725 6:146118582-146118604 CAGGGTGGGAGTAGTGGGGAGGG - Intronic
1017426729 6:154329929-154329951 CACGGAGGCCAGAGTGGGGCTGG - Intronic
1017711314 6:157170677-157170699 GGGGGTGGCCACAGTGGGGAGGG + Intronic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018931859 6:168245245-168245267 TACAGTGGCAAGAGTGGGGATGG - Intergenic
1019416761 7:931192-931214 CTGCCTGGCCAGGGTGGGGACGG + Intronic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019427616 7:984810-984832 CAGGGGGACGGGAGTGGGGATGG + Intronic
1019577705 7:1745510-1745532 CTGCGTGGCCAGCGTGGGCAGGG - Exonic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1019912157 7:4107111-4107133 CAGGGTGGGGAGGGTGGGGAGGG + Intronic
1019912162 7:4107120-4107142 GAGGGTGGGGAGGGTGGGGAGGG + Intronic
1019912167 7:4107129-4107151 GAGGGTGGGGAGGGTGGGGAGGG + Intronic
1019912172 7:4107138-4107160 GAGGGTGGGGAGGGTGGGGAGGG + Intronic
1019984857 7:4648226-4648248 CATGGTGTCCAGAGAGGGAAAGG - Intergenic
1020016495 7:4834826-4834848 CAGGGCGGCCTGAGTAGGGGAGG + Exonic
1020420286 7:7995751-7995773 TGGGGTGGGGAGAGTGGGGAGGG + Intronic
1020476114 7:8597048-8597070 CCAGGTGGGCAAAGTGGGGATGG + Intronic
1020988493 7:15166398-15166420 TCGGGAGACCAGAGTGGGGAGGG + Intergenic
1021923430 7:25510627-25510649 GTGGGTGGGCTGAGTGGGGATGG + Intergenic
1022739520 7:33108378-33108400 CAGGGTGGCATGTTTGGGGATGG - Intronic
1023113499 7:36838013-36838035 CAGGGTGGGCAGAGATGGGGTGG - Intergenic
1023435316 7:40135282-40135304 CTGGGCGGCCAGAGCGGGGCAGG - Intronic
1023986501 7:45100208-45100230 GACCTTGGCCAGAGTGGGGAGGG - Exonic
1024392514 7:48831710-48831732 CATGGTGGCCAGTGGGGAGATGG - Intergenic
1024544587 7:50506354-50506376 TGGGGTGGCAGGAGTGGGGAGGG + Intronic
1024552083 7:50570976-50570998 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1024572203 7:50732596-50732618 AAGGGTGCCCAGAGTGGTGAGGG + Intronic
1024784821 7:52895189-52895211 TGGGGTGGCGTGAGTGGGGAGGG + Intergenic
1024924995 7:54602809-54602831 CAGGGAGGCGTGTGTGGGGAGGG - Intergenic
1024970176 7:55061956-55061978 GCTGGAGGCCAGAGTGGGGAGGG + Intronic
1025240372 7:57266835-57266857 AAGGGTGGCCAGGCTGGGCACGG - Intergenic
1025697880 7:63789610-63789632 CAGGCGGGCCAGCGCGGGGAGGG - Intergenic
1026731416 7:72914912-72914934 CAGGTGGGTCAGGGTGGGGAGGG - Intronic
1026906026 7:74063239-74063261 CAGGAGGGGCAGGGTGGGGAGGG + Intronic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1027112624 7:75452911-75452933 CAGGTGGGTCAGGGTGGGGAGGG + Intronic
1028257724 7:88621024-88621046 TGGGGTGGGGAGAGTGGGGAGGG + Intergenic
1028774381 7:94660801-94660823 CAGGGGGGCAGGGGTGGGGAGGG + Intronic
1029110154 7:98210008-98210030 CAGAGGGGCCATAGTGGGGCGGG - Intergenic
1029306022 7:99620608-99620630 CAGGGTGACGAGAGTGTGCACGG - Intronic
1029575385 7:101400149-101400171 CAGGGAGGCAGGGGTGGGGAGGG + Intronic
1030175812 7:106651883-106651905 CAGGATGGCAACTGTGGGGAAGG + Intergenic
1030363156 7:108616446-108616468 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
1030542104 7:110843879-110843901 GAGGGTGGCCAGGGTGGCTAAGG + Intronic
1031928148 7:127657738-127657760 TTGGGAGGCCAGAGTGGAGAAGG - Intronic
1032529435 7:132608183-132608205 CATGGTGGCCATGGTGGTGATGG - Intronic
1033270771 7:139930859-139930881 CAGGGTGGCAGCTGTGGGGATGG + Intronic
1034276718 7:149827069-149827091 CAGTGTGGACAGACAGGGGAGGG - Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1035048276 7:155983356-155983378 CAGGGTGGGCAGAGCTGGGGAGG + Intergenic
1035172224 7:157023193-157023215 CACAGAGACCAGAGTGGGGAAGG + Intergenic
1035235802 7:157497070-157497092 CAGGGTGGGCAGGGAGGGGCAGG - Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036936245 8:13004825-13004847 CAGCTCGGCCACAGTGGGGAAGG + Intronic
1037802882 8:22044622-22044644 AAGGGAGGCCAGCGTGGGGCAGG + Intronic
1038496050 8:28003729-28003751 AAGGGTGGCCAGCCTGGTGAAGG - Intergenic
1038660097 8:29489898-29489920 CAAGGGGGCCAGAGTGGGGAAGG - Intergenic
1038740390 8:30211864-30211886 CAAGGTGGCGGGAGTGGGGCGGG + Intergenic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1039474670 8:37833386-37833408 CACTGAGGCCACAGTGGGGAAGG + Intronic
1039477067 8:37844668-37844690 CAGGGTGGCAAGAGAAGGGCAGG + Exonic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039744610 8:40413071-40413093 GAGGGTGGCCAGACGGGGGTTGG - Intergenic
1040312965 8:46246224-46246246 CAGGGTGGCCTGGGCGGGCAGGG + Intergenic
1040967680 8:53100759-53100781 AAGGGTGGGCAGGGTGGGGGTGG + Intergenic
1040986129 8:53296208-53296230 GAGGGTGGCCAGAGAGGGCATGG - Intergenic
1041389845 8:57338589-57338611 AAGGGTGGACAGAGTTAGGAGGG - Intergenic
1041624534 8:60010468-60010490 CAGAGTGCACAGTGTGGGGATGG + Intergenic
1041889664 8:62855258-62855280 CAGCCTGGCCACAGTGTGGAAGG + Intronic
1042119339 8:65467367-65467389 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1042845873 8:73169190-73169212 GACGGTGGCCAGGGAGGGGATGG - Intergenic
1043372701 8:79612234-79612256 CAATGAGGCCAGCGTGGGGAGGG - Intronic
1043705402 8:83342441-83342463 TGGGGTGGGCAGAGGGGGGAAGG + Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045035854 8:98176102-98176124 CAGGGGGTCCTGAGTGTGGAGGG + Intergenic
1045322197 8:101090790-101090812 CATGGTGGGGACAGTGGGGATGG + Intergenic
1045801727 8:106109966-106109988 CAGGGTGGGCAGAGTGGCACTGG - Intergenic
1046887837 8:119387611-119387633 CATGGTGGCAGGAGTGGGGCAGG - Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047210397 8:122835698-122835720 CAGGGTGGCAAGAATGGAGAAGG + Intronic
1047731987 8:127735928-127735950 GAGGGTGGGGAGGGTGGGGAAGG - Intronic
1048976332 8:139674916-139674938 GAGGGGATCCAGAGTGGGGAAGG - Intronic
1049072683 8:140368955-140368977 CATGGTGGCCAGATTTGGCATGG - Intronic
1049214020 8:141399457-141399479 CAGGGAGGCCACCGAGGGGAGGG - Intronic
1049220296 8:141425897-141425919 CAGGGTCGCAAGGCTGGGGAGGG - Intronic
1049230872 8:141480524-141480546 CAGGGTGGCCAGGGTGGGCTGGG - Intergenic
1049424644 8:142532709-142532731 CAAGATGGCCATGGTGGGGAGGG - Intronic
1049476617 8:142799867-142799889 AGGTGTGGCCAGAGTGGGGAGGG + Intergenic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1049600448 8:143505100-143505122 CACGGTGGTCAGAGTTGGCAGGG - Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050029207 9:1367464-1367486 CAGGGCGGCGGGAGTGGGGGTGG + Intergenic
1050048939 9:1577514-1577536 CAGGGAGGCAAGAAAGGGGAGGG + Intergenic
1051278454 9:15418950-15418972 CACTGTGGCCAGATTGGGAATGG + Intergenic
1051362608 9:16294500-16294522 GAGGGTGGCCAGAGGAGGGGTGG + Intergenic
1052020681 9:23522178-23522200 AAGGCTGGCCTTAGTGGGGAGGG + Intergenic
1052451395 9:28635965-28635987 TGGGGTGGGGAGAGTGGGGAGGG - Intronic
1052740000 9:32384205-32384227 GAGGGTGGGTAGGGTGGGGACGG + Intergenic
1052824289 9:33163935-33163957 CAGGGTGCCCGGTGTGGGGGCGG + Intronic
1053274112 9:36770557-36770579 CAGGCTGGGCAGAGGGGGAAGGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053525511 9:38826230-38826252 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054197740 9:62050657-62050679 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054640614 9:67537715-67537737 GAGGGGAGCCAGAGGGGGGATGG + Intergenic
1055350185 9:75378562-75378584 GAGGGTGGCAGGAGGGGGGAGGG + Intergenic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1055439984 9:76327946-76327968 CAGGGTGGCCCTCGTGGGAATGG - Intronic
1055705415 9:78995369-78995391 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1056971168 9:91204963-91204985 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1057337277 9:94166065-94166087 CGGGGTGGCCACCGTGGGGGAGG - Intergenic
1057367555 9:94437339-94437361 CAGGGTGGGGAGAGCAGGGATGG - Intronic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1057594990 9:96408062-96408084 CGGGGTGGCGGGAGCGGGGAGGG + Intronic
1057655773 9:96950714-96950736 CAGGGTGGGGAGAGCAGGGATGG + Intronic
1057704643 9:97388209-97388231 CAGGGTGGCCACCCTGGAGATGG - Intergenic
1057853718 9:98585491-98585513 TAGGGTGGGGGGAGTGGGGAGGG + Intronic
1057925350 9:99142088-99142110 CAGTGTGGCCACAGTGGGAATGG - Intronic
1058506777 9:105674302-105674324 CAGGGAGGCCAGAGTGATGGAGG + Intergenic
1059406376 9:114100165-114100187 CAGGATGGCCAGGGTGGGGTGGG + Intergenic
1059409835 9:114124897-114124919 CAGAGCCTCCAGAGTGGGGAGGG - Intergenic
1059476559 9:114552173-114552195 CAGAGTGGCCAGACTAGGGAAGG - Intergenic
1059636025 9:116171496-116171518 AAGGGTGGACAGAGTGGTGGGGG - Intronic
1059684865 9:116625448-116625470 CAATGGGGCCAGAGTGGGGAGGG - Intronic
1059912672 9:119063542-119063564 TGGGGTGGGCGGAGTGGGGAGGG - Intergenic
1060010850 9:120041675-120041697 CAAGGAGGCCAGAGTGTGGCAGG - Intergenic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060781385 9:126415890-126415912 AAGGGTGGCCTGACTGGGGAGGG + Intronic
1060789259 9:126474849-126474871 CAAGGAGGCCAGAGTGGTGAGGG - Intronic
1060909052 9:127334175-127334197 GATGGGGGCCTGAGTGGGGAAGG + Intronic
1060941503 9:127545486-127545508 CAGGGAGGCCATGGTGGGCAGGG + Intronic
1060984611 9:127812917-127812939 CAATGAGGCCAGAGTGGGGAAGG + Intronic
1061626656 9:131844382-131844404 CTCGGTGGCCAGAGGGCGGAGGG + Intergenic
1061670800 9:132187140-132187162 CAGGGGGGCCACAGTGGGCATGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061952172 9:133942763-133942785 TAGGGTGGCCAGAGTGGCCACGG - Intronic
1062043917 9:134416518-134416540 CTGTGTGGCCAGGGTGGGGCCGG + Intronic
1062135113 9:134922681-134922703 GAGGCTGGTCAGAGTGGGGCTGG + Intergenic
1062407331 9:136403183-136403205 GAGGGTTTCCAGAGCGGGGAGGG + Intronic
1062426960 9:136510535-136510557 CAGGGAGGCCGGAGTGTGGCCGG - Intronic
1062448296 9:136604885-136604907 AAGGGTGGCCTGGGTGGGGCTGG - Intergenic
1062453723 9:136626252-136626274 CAGGCAGGCCAGTGTGGGGCTGG + Intergenic
1062462818 9:136668982-136669004 CAGGGATGCCAGGGTAGGGAGGG - Intronic
1062612943 9:137383136-137383158 CAGGGTGGCCTGTGTGGGGCAGG - Intronic
1062738720 9:138153900-138153922 TGGGGTGGGGAGAGTGGGGAGGG + Intergenic
1203746854 Un_GL000218v1:44811-44833 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1203563254 Un_KI270744v1:74669-74691 CAGGCTGGGCACAGTGGGGAGGG - Intergenic
1185570856 X:1133827-1133849 CAGCCTCACCAGAGTGGGGAGGG - Intergenic
1185641773 X:1592428-1592450 GCTGGAGGCCAGAGTGGGGAGGG + Intronic
1186478509 X:9877848-9877870 CAGGGTTGGGAGGGTGGGGAAGG + Intronic
1186599140 X:11018118-11018140 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1186610747 X:11135949-11135971 CAAAGGGGCCAGAATGGGGATGG - Intergenic
1187314817 X:18183544-18183566 CAGCTTGGCCACAGTGGGGTAGG + Intronic
1187522963 X:20029445-20029467 CAGGGTGGCCTAGGTGGGGGAGG + Intronic
1187982592 X:24774193-24774215 CAGAGAGGGCAGAGTGGGCAAGG - Intronic
1188878973 X:35468659-35468681 CAGGGAAGGCAGTGTGGGGAGGG + Intergenic
1188926848 X:36054209-36054231 CTGGGTAGCCACAGTGGGGGTGG - Intronic
1191053978 X:56223030-56223052 AAGTGCGGCCAGAGTGGGCACGG + Intergenic
1191798674 X:65053248-65053270 CGGGGTGGGGGGAGTGGGGACGG - Intergenic
1191992647 X:67055808-67055830 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1192124178 X:68486186-68486208 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192478340 X:71463436-71463458 CAAGGTAGGCAGAGTAGGGATGG + Intronic
1192568652 X:72184215-72184237 CATGGGGTCCAGAGTGGGAAGGG + Intronic
1192586130 X:72319459-72319481 AAGGATGGCCACAGTGTGGAGGG + Intergenic
1193753263 X:85373821-85373843 CAGGGTGTCTAGATTGGTGAGGG + Intronic
1194916986 X:99719309-99719331 CAGCCTGGCCACAGTGTGGAAGG + Intergenic
1195659110 X:107360999-107361021 CTGGATGGCAAGGGTGGGGAGGG - Intergenic
1196380126 X:115080578-115080600 TGGGGTGGGGAGAGTGGGGAGGG - Intergenic
1196661092 X:118269493-118269515 CGGGGTGGCGGGAGGGGGGAGGG + Intergenic
1196865229 X:120065332-120065354 CATGGCTGCCAGGGTGGGGAAGG - Intergenic
1196877864 X:120170948-120170970 CATGGCTGCCAGGGTGGGGAAGG + Intergenic
1197607840 X:128606487-128606509 AAGCGCGGCCAGAGTGGGCACGG - Intergenic
1197765477 X:130057073-130057095 CAGGGAGGCCAGAACGGGGTGGG - Exonic
1198124319 X:133627164-133627186 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198634282 X:138678217-138678239 TGGGGTGGGGAGAGTGGGGAGGG + Intronic
1199227693 X:145396643-145396665 CAGGGAAGCCATAGAGGGGATGG - Intergenic
1199905392 X:152223549-152223571 GTGGCTGGCCAGAGTGAGGAAGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200069542 X:153521195-153521217 CAGCTTAGCCAGGGTGGGGAAGG - Intronic
1200099984 X:153685508-153685530 CAGGGTGGCCGACGTGGGGAGGG + Intronic
1200213263 X:154356296-154356318 CAGGGAGCCCGGGGTGGGGAAGG - Intronic
1200760670 Y:7036065-7036087 CCGGGAGTCCAGAGTAGGGATGG + Intronic
1201160178 Y:11159825-11159847 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1201392600 Y:13514567-13514589 TGGGGTGGGCAGAGAGGGGAAGG - Intergenic
1201591216 Y:15616883-15616905 CAGGGTGCAGGGAGTGGGGAGGG + Intergenic
1201895282 Y:18986025-18986047 CAGGGAAGCCAGAATGGGCATGG - Intergenic
1201952476 Y:19580647-19580669 TAGGGTGGGGAGAGGGGGGAGGG - Intergenic