ID: 1143652998

View in Genome Browser
Species Human (GRCh38)
Location 17:8275856-8275878
Sequence TCTTACATACAGCAGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143652998_1143653007 17 Left 1143652998 17:8275856-8275878 CCCAGCACCTGCTGTATGTAAGA No data
Right 1143653007 17:8275896-8275918 CCAAACAAACCTTCTGTCACTGG No data
1143652998_1143653010 26 Left 1143652998 17:8275856-8275878 CCCAGCACCTGCTGTATGTAAGA No data
Right 1143653010 17:8275905-8275927 CCTTCTGTCACTGGACACTTGGG No data
1143652998_1143653012 28 Left 1143652998 17:8275856-8275878 CCCAGCACCTGCTGTATGTAAGA No data
Right 1143653012 17:8275907-8275929 TTCTGTCACTGGACACTTGGGGG No data
1143652998_1143653008 25 Left 1143652998 17:8275856-8275878 CCCAGCACCTGCTGTATGTAAGA No data
Right 1143653008 17:8275904-8275926 ACCTTCTGTCACTGGACACTTGG No data
1143652998_1143653011 27 Left 1143652998 17:8275856-8275878 CCCAGCACCTGCTGTATGTAAGA No data
Right 1143653011 17:8275906-8275928 CTTCTGTCACTGGACACTTGGGG No data
1143652998_1143653003 -9 Left 1143652998 17:8275856-8275878 CCCAGCACCTGCTGTATGTAAGA No data
Right 1143653003 17:8275870-8275892 TATGTAAGACCCTGTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143652998 Original CRISPR TCTTACATACAGCAGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr