ID: 1143660514

View in Genome Browser
Species Human (GRCh38)
Location 17:8321896-8321918
Sequence GACTGAAGATGGCCAGTAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143660507_1143660514 4 Left 1143660507 17:8321869-8321891 CCAACGGCCTGGCAGAGGAGCCC 0: 1
1: 1
2: 4
3: 14
4: 225
Right 1143660514 17:8321896-8321918 GACTGAAGATGGCCAGTAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 158
1143660510_1143660514 -3 Left 1143660510 17:8321876-8321898 CCTGGCAGAGGAGCCCAAGGGAC 0: 1
1: 0
2: 2
3: 33
4: 287
Right 1143660514 17:8321896-8321918 GACTGAAGATGGCCAGTAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143660514 Original CRISPR GACTGAAGATGGCCAGTAGC TGG Exonic
902110766 1:14076397-14076419 GCCAGAAGATTGCCAGAAGCTGG + Intergenic
902502299 1:16919021-16919043 CACTGCACCTGGCCAGTAGCTGG + Intronic
902539640 1:17145076-17145098 GGCAGAAGATGGGCAGGAGCTGG - Intergenic
902582427 1:17416557-17416579 CAATGAAGATGGCCACTCGCCGG + Exonic
904581788 1:31549055-31549077 CACTGAGAATGGCCAGTAGGTGG - Intergenic
906204845 1:43981268-43981290 GGCTGAAGAAGGCCAGGTGCTGG - Exonic
910029436 1:82699768-82699790 AACTGATCATGGACAGTAGCAGG - Intergenic
910126460 1:83848089-83848111 GACAGAGGATTGCAAGTAGCTGG - Intergenic
912801199 1:112720648-112720670 CATTGAAGATGGGGAGTAGCGGG + Intronic
913138894 1:115920398-115920420 GAATGAAAATGCCCACTAGCTGG + Intergenic
913365763 1:118036698-118036720 GACTGAGAATGGGCAGTGGCAGG + Intronic
913615479 1:120556016-120556038 GAATGACGTTGACCAGTAGCAGG + Intergenic
913996499 1:143655011-143655033 GACTGCGGATGCCTAGTAGCTGG - Intergenic
914444700 1:147740094-147740116 CACTGAAGAGGGCCAGGACCTGG - Intergenic
914574795 1:148954891-148954913 GAATGACGTTGACCAGTAGCAGG - Intronic
916020769 1:160790336-160790358 GACTGGAGATGGGCAATAGGAGG - Intergenic
920364971 1:205443506-205443528 TAATGAAGCTGGCCAGGAGCTGG + Intronic
921355218 1:214279645-214279667 GACTGACTATGGCCAGCAACTGG - Intergenic
922082501 1:222310560-222310582 GACTCAAGATGGACTATAGCAGG + Intergenic
922339981 1:224647479-224647501 GACTGGGGATGGGCAGAAGCTGG + Intronic
924270695 1:242329487-242329509 GAGTGGAGATGACCAGAAGCTGG - Intronic
924592693 1:245418716-245418738 GACTGAAGATTTCAAGTAACAGG + Intronic
1063090388 10:2860827-2860849 AGCTGAAGATGTCCAGTGGCAGG + Intergenic
1063283422 10:4656773-4656795 TACTGAAGATAGACAGTAGGGGG - Intergenic
1063470143 10:6277853-6277875 GAATGAAGAAGTCCACTAGCAGG - Intergenic
1066714251 10:38269373-38269395 GAGTGGAGATGACCAGAAGCAGG + Intergenic
1071973597 10:90932686-90932708 GAGTGATGATTGCCAGGAGCCGG + Intergenic
1072994911 10:100234767-100234789 GATTGAAGATGGGAAGTTGCTGG - Intronic
1073338202 10:102726495-102726517 GTCAGACGATGCCCAGTAGCTGG + Intronic
1073368497 10:102965551-102965573 CATTGAAGATTGCCAGTAGATGG + Intronic
1075067429 10:119298856-119298878 GGCTGAAGTTGGCCAGGAGTGGG - Intronic
1076350447 10:129811559-129811581 GACTGCAGATGGCCAGCACCGGG - Intergenic
1077279666 11:1736962-1736984 GATTGAAGATGGGAAGAAGCAGG + Intronic
1078959349 11:16247073-16247095 GAATGATGATTACCAGTAGCTGG - Intronic
1082009778 11:47442192-47442214 GACGGAAGAGGGCCAGTTTCTGG - Intronic
1083393495 11:62372537-62372559 CAATGAAGATGGCCACTCGCTGG - Intronic
1086162109 11:83733480-83733502 CACAGAAGCTGGCAAGTAGCTGG + Intronic
1088175266 11:107046341-107046363 GACTGAAGGTTGCCAGGGGCTGG + Intergenic
1089566939 11:119376575-119376597 CAGTGAAGATGGCCAGGAGGAGG - Intronic
1092726277 12:11488577-11488599 CACTGGAGATGCCCAGTAGGTGG + Intronic
1092753640 12:11742584-11742606 GACTGAAGATTGACAGTAACTGG - Intronic
1095271770 12:40226872-40226894 GAATGAAGGTGGCCAGAATCAGG - Intronic
1101898519 12:108773823-108773845 GACTGAGCAAGGCCAGGAGCTGG - Intergenic
1104352319 12:128055693-128055715 TGCTGAAGCTGGCCAGTGGCCGG + Intergenic
1105782480 13:23716385-23716407 CACTGAAACTGGCCAGTGGCGGG + Intergenic
1110799582 13:79679441-79679463 GTCAGAAGATGGCCACTAGGGGG + Intergenic
1115470102 14:33759731-33759753 GACTAAAGACAACCAGTAGCAGG - Intronic
1116855783 14:49951127-49951149 AACTGAACATGCCCATTAGCAGG - Intergenic
1120039255 14:79733897-79733919 CTCTGATAATGGCCAGTAGCTGG + Intronic
1120252353 14:82073940-82073962 GACTGCAGATGACCAGTTACAGG + Intergenic
1121113470 14:91328176-91328198 GAATGGAGATGGCCAGGAGTGGG + Intronic
1123021500 14:105399801-105399823 GGCTGAAGGTGGCAAGAAGCGGG + Intronic
1127055890 15:55130943-55130965 GACTGATGATTGCCAGGGGCTGG - Intergenic
1129679575 15:77650640-77650662 GACTGGAGTTGCCCAGTAGAGGG + Intronic
1133306816 16:4814818-4814840 AACTGAAGATGGCCAGTAAAAGG - Intronic
1133695554 16:8259279-8259301 GAATGAAGGTTGCCAGGAGCTGG - Intergenic
1136238612 16:28930773-28930795 GAATGAAGGGGGCGAGTAGCAGG - Intronic
1141236784 16:82225848-82225870 TGCTGCGGATGGCCAGTAGCTGG + Intergenic
1142170482 16:88619523-88619545 AAATGAAGATGGCCAGAGGCAGG - Intronic
1142262930 16:89051031-89051053 GGCTGAGGATGGCCAGTCCCTGG + Intergenic
1143404193 17:6666169-6666191 GACAGACGATGGACAGTAGAGGG + Intergenic
1143532490 17:7513375-7513397 GGGTGAAGTTGGCGAGTAGCTGG - Exonic
1143660514 17:8321896-8321918 GACTGAAGATGGCCAGTAGCTGG + Exonic
1144051411 17:11500181-11500203 GACTGAGGATGGAGAGCAGCAGG - Intronic
1144630489 17:16869687-16869709 GAGCAAAGATGGCCAGTAGTGGG - Intergenic
1146255448 17:31389573-31389595 GAAAGGAGATGGCCAGGAGCTGG - Intergenic
1146558494 17:33847991-33848013 GACAGAAGATAGCCAAGAGCTGG + Intronic
1147913896 17:43875466-43875488 GACTGAATATGGACAGTGGATGG + Intronic
1147996804 17:44363951-44363973 GGCTGAAGGTGGGCAGTACCGGG - Intergenic
1153679185 18:7484325-7484347 GATGGGAGGTGGCCAGTAGCTGG - Intergenic
1155202390 18:23528586-23528608 CACTGAAGAGGGCCAGTTGCTGG + Intronic
1155720189 18:29001715-29001737 GACTGAAGATGGCAGGTGACAGG - Intergenic
1156177689 18:34566038-34566060 CAATGAAAATGGCCACTAGCAGG + Intronic
1159673585 18:71253345-71253367 GACTAAAAATGGCCAGTGACAGG - Intergenic
1159922656 18:74239926-74239948 GACTGCAGGTGGCCAAGAGCAGG - Intergenic
1160319446 18:77876565-77876587 GAGTTAAGATGCCCAGTCGCTGG - Intergenic
1160844004 19:1158756-1158778 ACCTGAAGATGGCAAGGAGCAGG + Intronic
1163175712 19:15563090-15563112 GACACATGATGGCCAGGAGCAGG - Intergenic
1164434567 19:28218465-28218487 GAATGAAGAAGGCCTGGAGCAGG + Intergenic
1164750275 19:30648512-30648534 TCCTGCAGAAGGCCAGTAGCTGG - Intronic
1165078569 19:33294554-33294576 GACTCAAGAGGTCAAGTAGCTGG - Intergenic
1165939660 19:39408657-39408679 GATTGAAGATGGGGAGTCGCCGG - Exonic
1167687115 19:50963290-50963312 GACAGCAGATGGTCAGTAGTGGG - Exonic
1168288124 19:55344534-55344556 GAAGAAAGATGGCCAGCAGCTGG - Intronic
931472425 2:62552381-62552403 GAGTGAAGATGTTCAGAAGCTGG - Intergenic
932771539 2:74503275-74503297 GGCTGAAGCTGGCCAGCTGCGGG - Intronic
935274468 2:101464052-101464074 GTCTGAAGGTGTCCAGTGGCTGG - Intronic
936624592 2:114135136-114135158 CACTGAATATGGCCACCAGCAGG - Intergenic
940535561 2:154937053-154937075 GAACGATGATGGCCAGAAGCTGG - Intergenic
942178902 2:173360968-173360990 GACTGATGGTTGCCAGGAGCTGG - Intronic
943414089 2:187577174-187577196 GAATGAAGATGACTACTAGCTGG - Intergenic
943869197 2:192972226-192972248 GACTGAAGATGTCCATTTCCAGG + Intergenic
943883585 2:193181797-193181819 GACTGAAGATTACCAGAAACAGG + Intergenic
946209369 2:218135203-218135225 CACTGATGCAGGCCAGTAGCAGG - Exonic
946478691 2:220033328-220033350 GACAGCTGATGGCCAATAGCTGG + Intergenic
949001414 2:241616267-241616289 GGCTGGAGATGGCCAGCAGCTGG + Intronic
1168951450 20:1804760-1804782 GACTGGAGATGGTCAGCAGCTGG + Intergenic
1171159761 20:22910577-22910599 GACTGGAGATGGACAGTTGAGGG + Intergenic
1172706725 20:36887507-36887529 CACTGATGATGGGCAGTGGCAGG + Exonic
1173178755 20:40785748-40785770 GCCTGAACATGGGGAGTAGCTGG + Intergenic
1173762461 20:45575680-45575702 GTCTACAGATGGCCAGGAGCTGG + Intronic
1174340721 20:49893378-49893400 GAATGAAGCTGGCCTGGAGCGGG + Intergenic
1175952026 20:62588670-62588692 GTGGGAAAATGGCCAGTAGCCGG + Intergenic
1176155248 20:63616737-63616759 GGCTGAGGATGGCAGGTAGCTGG - Intronic
1182149129 22:28016468-28016490 GACAGCAGATGGGCAGCAGCAGG + Intronic
1185288894 22:50014411-50014433 GGCTGCAGGTGGCCAGTAGTCGG + Intergenic
949453269 3:4211040-4211062 GCCTGCAGATGGCCTGTTGCAGG + Intronic
950265873 3:11572511-11572533 GACTGAGGAGGGCCTGGAGCAGG - Intronic
950924212 3:16723949-16723971 GACTGAAAATAGCAAGAAGCCGG - Intergenic
953374342 3:42416227-42416249 GACTTAAGCTGGCCAGTAGATGG - Intergenic
954984274 3:54775948-54775970 GACTGGGGATGGCAAGTAGGAGG - Intronic
961020805 3:123505230-123505252 GACAGAAGGTTGCCAGCAGCTGG + Intronic
961381129 3:126497182-126497204 CACCGAACATGGCCAGCAGCAGG + Intronic
962697130 3:137961268-137961290 GTCCGAAGTTGGCCAGTATCAGG + Intergenic
965833402 3:172824358-172824380 CACTTCAGATGGCCAGAAGCAGG + Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
968863537 4:3192429-3192451 GACCGAAGATGACCTCTAGCAGG + Intronic
970865824 4:20757563-20757585 AACTGAAGATGGGCATTTGCAGG - Intronic
970997730 4:22286978-22287000 GACTGCAGATGGGGAGGAGCTGG - Intergenic
971793053 4:31194047-31194069 TACTGAAGATGTCAGGTAGCTGG + Intergenic
976066665 4:81195559-81195581 GAATGGAGATTGCCAGGAGCAGG - Intronic
976280944 4:83326463-83326485 GACTGAAGATGGGGAGGAACAGG + Intronic
978971561 4:114813638-114813660 GACTGAAGATGGTCAGTTGAGGG + Intergenic
981136717 4:141219514-141219536 TCCTGAAGATGGCCAAGAGCTGG - Intergenic
985808848 5:2068572-2068594 GACTGAAGATGGGGTGCAGCTGG + Intergenic
986433124 5:7701663-7701685 GAATAGAGATGGCCAGGAGCTGG - Intronic
986456245 5:7923186-7923208 GAATGAAGATTGCCAGAGGCTGG + Intergenic
987605368 5:20127668-20127690 GAATGATGATTGCCAGTGGCTGG + Intronic
990302519 5:54462906-54462928 GAAGGAAAATGGCCAGTATCAGG + Intergenic
990310070 5:54529302-54529324 GCCTGGAGATGGCCTGGAGCGGG + Intronic
992684053 5:79181981-79182003 GGCTGAGGAGGGCCAGTAGCTGG - Intronic
993560606 5:89402736-89402758 GACTGATGATGACCATTAGAGGG + Intergenic
997841388 5:137243742-137243764 GACTGAACATGGCTAGCTGCAGG + Intronic
997930075 5:138065439-138065461 GACTCAAGCTGGAGAGTAGCAGG - Intergenic
998174651 5:139894348-139894370 GCCTGCAGCTGGCCAGCAGCAGG - Intronic
998392738 5:141797779-141797801 GACTCAAGATGCCCAGAAGATGG + Intergenic
999249234 5:150172220-150172242 GACTACAGATGGTCAGTGGCAGG - Intronic
1001050401 5:168409415-168409437 GCCTGCAGATGGCTAGTAGCTGG - Intronic
1002590417 5:180287597-180287619 GCCTGAAGGTGTGCAGTAGCTGG - Intronic
1003337878 6:5192247-5192269 GACTGAAGATGGCCTGGGGTAGG + Intronic
1003663758 6:8089396-8089418 GCCTGAAGATGGCCTGTTGTGGG - Intronic
1005159804 6:22845599-22845621 TAATGAAGTTTGCCAGTAGCAGG + Intergenic
1007156468 6:39749840-39749862 TATTGATGATGGCCATTAGCTGG + Intergenic
1008019149 6:46556242-46556264 GCCTGAAGACTGCCAGAAGCAGG - Intronic
1008154165 6:47993619-47993641 GTCTGCTGATGGCCAGCAGCTGG + Intronic
1008886069 6:56432542-56432564 CAATGAATATGGCCAGTCGCGGG + Intergenic
1009883539 6:69598918-69598940 GACAGAAAAGGGCCAGGAGCAGG + Intergenic
1009963375 6:70551751-70551773 GACTGGAAATGGCCAGTTGGTGG + Intronic
1017090188 6:150752458-150752480 GACTGGAGGTTGCCAGGAGCTGG - Intronic
1019772407 7:2891818-2891840 GGCTGAATATAGCCAGTAGGAGG + Intergenic
1024880135 7:54075334-54075356 GTCTGAAGATGGGCAGTAGAAGG - Intergenic
1027943434 7:84714891-84714913 CACTGAAGATGCACAGTAGGAGG - Intergenic
1028616479 7:92773564-92773586 GACAGAAGATGGCCAAGAACAGG + Intronic
1035959439 8:4120626-4120648 GACTAGAGAAGGCCAGTGGCAGG - Intronic
1036114862 8:5948129-5948151 GAGAGAAGATGGAAAGTAGCTGG - Intergenic
1037822825 8:22143350-22143372 GCCTAAAGATGGACAGTGGCTGG - Intergenic
1046538222 8:115544231-115544253 GCCTGAAGAAGGCAAGTGGCTGG - Intronic
1047097799 8:121642434-121642456 GACTGAAAATGGACAGTAGGTGG + Intergenic
1047928851 8:129706543-129706565 GACTGGAAATGGCAAGTATCTGG - Intergenic
1050463453 9:5896486-5896508 GACAGAAGTTGTCCAGTAGATGG + Intronic
1057257270 9:93559723-93559745 AACTGAAGCTGGCCTGTAGTTGG + Intronic
1059078405 9:111220426-111220448 GTCTCAGGATGCCCAGTAGCTGG - Intergenic
1059161005 9:112035072-112035094 GACTCAAGATGGCCACTCCCAGG + Intergenic
1060046245 9:120343588-120343610 GAATGCAGATGGCCTCTAGCAGG - Intergenic
1060991906 9:127854301-127854323 GGCTGCAGCTGGCCAGCAGCAGG + Exonic
1061416534 9:130450330-130450352 GACTTAAGGTGGGCAGTACCTGG - Intronic
1062321867 9:135994150-135994172 TGCTGGAGATGGCCAGGAGCAGG - Intergenic
1189217074 X:39335384-39335406 GCCTGGAGGTGGCCAGTTGCAGG + Intergenic
1195325008 X:103751389-103751411 GCCTGAAGATGGCCAGTTCTAGG + Intergenic
1198581601 X:138071537-138071559 GACTAAAAATAGACAGTAGCTGG + Intergenic
1199495288 X:148446190-148446212 CACAGAAGATAGGCAGTAGCAGG - Intergenic