ID: 1143662900

View in Genome Browser
Species Human (GRCh38)
Location 17:8338038-8338060
Sequence AAATGCTCACTGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143662900_1143662914 18 Left 1143662900 17:8338038-8338060 CCCTGCTCCATCAGTGAGCATTT No data
Right 1143662914 17:8338079-8338101 GAGGAACTAGGAAGAGAAAAGGG No data
1143662900_1143662909 -8 Left 1143662900 17:8338038-8338060 CCCTGCTCCATCAGTGAGCATTT No data
Right 1143662909 17:8338053-8338075 GAGCATTTGGGGTTGGGGTTAGG No data
1143662900_1143662911 -1 Left 1143662900 17:8338038-8338060 CCCTGCTCCATCAGTGAGCATTT No data
Right 1143662911 17:8338060-8338082 TGGGGTTGGGGTTAGGGCAGAGG No data
1143662900_1143662910 -7 Left 1143662900 17:8338038-8338060 CCCTGCTCCATCAGTGAGCATTT No data
Right 1143662910 17:8338054-8338076 AGCATTTGGGGTTGGGGTTAGGG No data
1143662900_1143662913 17 Left 1143662900 17:8338038-8338060 CCCTGCTCCATCAGTGAGCATTT No data
Right 1143662913 17:8338078-8338100 AGAGGAACTAGGAAGAGAAAAGG No data
1143662900_1143662915 19 Left 1143662900 17:8338038-8338060 CCCTGCTCCATCAGTGAGCATTT No data
Right 1143662915 17:8338080-8338102 AGGAACTAGGAAGAGAAAAGGGG No data
1143662900_1143662912 6 Left 1143662900 17:8338038-8338060 CCCTGCTCCATCAGTGAGCATTT No data
Right 1143662912 17:8338067-8338089 GGGGTTAGGGCAGAGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143662900 Original CRISPR AAATGCTCACTGATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr