ID: 1143666538

View in Genome Browser
Species Human (GRCh38)
Location 17:8365314-8365336
Sequence CTCCTAGTTACTTGGCATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143666538_1143666548 1 Left 1143666538 17:8365314-8365336 CCGGTATGCCAAGTAACTAGGAG No data
Right 1143666548 17:8365338-8365360 GAGGAGGTCAGCACTGGGGAGGG No data
1143666538_1143666551 28 Left 1143666538 17:8365314-8365336 CCGGTATGCCAAGTAACTAGGAG No data
Right 1143666551 17:8365365-8365387 GTAACATCCTCAGTCAAAGTTGG No data
1143666538_1143666549 2 Left 1143666538 17:8365314-8365336 CCGGTATGCCAAGTAACTAGGAG No data
Right 1143666549 17:8365339-8365361 AGGAGGTCAGCACTGGGGAGGGG No data
1143666538_1143666544 -5 Left 1143666538 17:8365314-8365336 CCGGTATGCCAAGTAACTAGGAG No data
Right 1143666544 17:8365332-8365354 AGGAGGGAGGAGGTCAGCACTGG No data
1143666538_1143666546 -3 Left 1143666538 17:8365314-8365336 CCGGTATGCCAAGTAACTAGGAG No data
Right 1143666546 17:8365334-8365356 GAGGGAGGAGGTCAGCACTGGGG No data
1143666538_1143666547 0 Left 1143666538 17:8365314-8365336 CCGGTATGCCAAGTAACTAGGAG No data
Right 1143666547 17:8365337-8365359 GGAGGAGGTCAGCACTGGGGAGG No data
1143666538_1143666550 6 Left 1143666538 17:8365314-8365336 CCGGTATGCCAAGTAACTAGGAG No data
Right 1143666550 17:8365343-8365365 GGTCAGCACTGGGGAGGGGAAGG No data
1143666538_1143666545 -4 Left 1143666538 17:8365314-8365336 CCGGTATGCCAAGTAACTAGGAG No data
Right 1143666545 17:8365333-8365355 GGAGGGAGGAGGTCAGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143666538 Original CRISPR CTCCTAGTTACTTGGCATAC CGG (reversed) Intergenic
No off target data available for this crispr