ID: 1143666594

View in Genome Browser
Species Human (GRCh38)
Location 17:8365677-8365699
Sequence CTTCACATGCAGAATCTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143666590_1143666594 25 Left 1143666590 17:8365629-8365651 CCGCAAAGATGAGTCACATTGTA No data
Right 1143666594 17:8365677-8365699 CTTCACATGCAGAATCTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143666594 Original CRISPR CTTCACATGCAGAATCTCGC TGG Intergenic
No off target data available for this crispr