ID: 1143667974

View in Genome Browser
Species Human (GRCh38)
Location 17:8375359-8375381
Sequence CATTGCTGCCTGGCAATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143667968_1143667974 27 Left 1143667968 17:8375309-8375331 CCTCGATTTCTGGCTTTCTTGAA 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1143667974 17:8375359-8375381 CATTGCTGCCTGGCAATAACTGG 0: 1
1: 0
2: 0
3: 18
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143667974 Original CRISPR CATTGCTGCCTGGCAATAAC TGG Intronic
901184845 1:7366305-7366327 CAGTGCGGCCAGGCAAGAACAGG - Intronic
904207912 1:28866648-28866670 CACTGATGCCTGGAATTAACTGG - Intergenic
905462915 1:38133268-38133290 CTTTACTGCCTGGCAATTCCAGG + Intergenic
905852478 1:41284174-41284196 CATGGCTGGCTGACAATAAGTGG - Intergenic
905925618 1:41747334-41747356 CATGGGTGCATGGCAAGAACTGG - Intronic
907467586 1:54649478-54649500 CAGAGCTGCCTGGCAGTGACTGG - Intronic
907535526 1:55151967-55151989 CCTTGCTGCCTGGCAGGAAAGGG + Intronic
909465247 1:75966666-75966688 CAGTGCTGACTGGCAATTTCAGG - Intergenic
912716311 1:111986479-111986501 CATTGCTGCCTGGGGAAGACAGG - Intronic
912958431 1:114173277-114173299 CAGTGCTGCCAGGCAGTTACTGG + Intergenic
914324797 1:146602051-146602073 CTTTACTGCCTGGGAATGACTGG - Intergenic
916737154 1:167618012-167618034 CATTGCCGCCTGGCTGTAAGGGG + Intergenic
918535623 1:185571293-185571315 CATTACTGCCTTGGAATGACTGG + Intergenic
918725859 1:187922711-187922733 TACTGCTGCCTGGCAAAAACTGG - Intergenic
922224244 1:223631507-223631529 CATTGCTGCTTTGCAAGAAGAGG - Intronic
923729802 1:236539279-236539301 TATTTCTGCATGGCAACAACTGG - Intronic
1063112888 10:3052234-3052256 CATTCCTCCGTGGCACTAACTGG - Intergenic
1068096702 10:52499889-52499911 CATTCCTGCCTGGCAATACAGGG - Intergenic
1069184456 10:65405628-65405650 TATTACTGCCTGGCAATATGGGG - Intergenic
1069916245 10:71789069-71789091 CAGTGGTGCCTGGCAACAGCAGG - Intronic
1074653844 10:115559012-115559034 CATAGCAGCCTGATAATAACAGG + Intronic
1078935498 11:15945841-15945863 CATTGCTGCCTGGCACACAGTGG - Intergenic
1079062286 11:17259837-17259859 CATTCCTACCTGGCAACAGCTGG - Intronic
1084803442 11:71562696-71562718 CCTTGCTGCCTGTCTGTAACTGG - Intronic
1085566117 11:77515189-77515211 CATGTGTGCCTGGCAAAAACTGG + Intronic
1088639587 11:111858506-111858528 CATTGCTGCCATACAATATCTGG - Intronic
1091204710 11:133812157-133812179 CATTGCTGCAAGGCAATAAGAGG + Intergenic
1096879353 12:54654945-54654967 CATTCCTGCCTCTGAATAACTGG + Intergenic
1097909726 12:64957152-64957174 CACTCCTGCCTGGCAACAAAGGG - Intergenic
1102389518 12:112538133-112538155 CAGGACTGCCTGGCAATAACAGG + Intergenic
1102390865 12:112547512-112547534 CACTCCTGCATGGCAATAATTGG - Intergenic
1103549365 12:121725614-121725636 TATTGCTGACTAGCAATAAAAGG + Intronic
1105504705 13:20999542-20999564 CATTGCAGCCTGGCACTGCCCGG + Intronic
1109508484 13:63337290-63337312 CATTACTGCCTGGCAACAAAGGG - Intergenic
1109970421 13:69760973-69760995 CATTGCTCTCTGGCAACAATGGG - Intronic
1112202921 13:97294982-97295004 CATTTCAAACTGGCAATAACTGG - Intronic
1114979354 14:28143535-28143557 CACTACTGCCTGGCAATTTCCGG + Intergenic
1115884982 14:37961217-37961239 TTTTGCTGCCTGGGAATAAGGGG + Intronic
1118497569 14:66323710-66323732 GATTGCTGACAGGCATTAACTGG - Intergenic
1122109259 14:99484697-99484719 CATTGCTGGGTATCAATAACTGG - Intronic
1124887671 15:33702073-33702095 CATTGTTGCCTGCCAGTTACGGG + Intronic
1126733012 15:51703550-51703572 CATTGCTTTCTAGCAACAACGGG + Intronic
1127646453 15:60963982-60964004 CACTGCTGCCTGCAAATAAGAGG - Intronic
1134668906 16:16040169-16040191 CATTGCAGCCTGGAAATTCCGGG + Intronic
1137554684 16:49463162-49463184 CCTTGCTTCCTGGCAAGCACAGG - Intergenic
1138963354 16:62053629-62053651 CATGTCTGCCTGGCAATACCTGG - Intergenic
1140008766 16:71108895-71108917 CTTTACTGCCTGGGAATGACTGG + Intronic
1142671599 17:1490131-1490153 CATCACAGCCTGGCATTAACAGG + Intronic
1143667974 17:8375359-8375381 CATTGCTGCCTGGCAATAACTGG + Intronic
1146228881 17:31091456-31091478 CATTCCTGCATGGCAGTAACTGG + Intergenic
1150323173 17:64233656-64233678 TATTGGTGCCAGGGAATAACTGG - Intronic
1153103790 18:1504591-1504613 CTTTGATACCTGGCAGTAACAGG + Intergenic
1153542830 18:6174479-6174501 TATTGCTGGATGGCAATAATAGG + Intronic
1154260685 18:12829549-12829571 CATTGCTGCTAGCCAATGACAGG + Intronic
1157642077 18:49226417-49226439 CATTGCTGCATGGCCATATTGGG - Intronic
1158642931 18:59219317-59219339 CAGAGCTGCCTGGGAATACCAGG + Intergenic
1158943324 18:62426277-62426299 CATTGCAGCCTGGCACTGGCTGG + Intergenic
1160153111 18:76410195-76410217 CAGTGCTGGCTGGCAAGGACAGG + Intronic
1164802775 19:31091477-31091499 CATTTCTTCCTGGCAAAAGCTGG + Intergenic
1164965926 19:32483497-32483519 CATTTCCACCTGGCAAGAACAGG - Exonic
1166372857 19:42312025-42312047 CAATCCTTCCTGGCAACAACTGG + Intergenic
1168535075 19:57162215-57162237 CATTGCTCAATAGCAATAACAGG + Intronic
1168713822 19:58515986-58516008 CCTTGCTGCCAGCCTATAACGGG + Intronic
927866927 2:26595074-26595096 CATTGATGGATGGCATTAACTGG - Intronic
929099562 2:38297740-38297762 CATTGCTGCTTGCCAATATTAGG + Intronic
929643081 2:43601293-43601315 CTTTGTTGCCTGGAAATAATTGG - Intergenic
933152468 2:78931863-78931885 CTTTGCTGGCTGTCAATGACGGG - Intergenic
933862462 2:86483599-86483621 TATTCCTGCTTGGCAATAACAGG + Intronic
936627364 2:114162817-114162839 CTTTGCTGCCTGGTAATGACAGG + Intergenic
936654345 2:114467359-114467381 TGTTTCTGCCTGGCAATAATTGG - Intronic
937172268 2:119886425-119886447 CATTGCTGCCTTTGAAAAACTGG + Intronic
938085306 2:128396047-128396069 TATTACTGCCTGTGAATAACTGG + Intergenic
942068306 2:172292722-172292744 CTTTCCTGCATGGCAACAACTGG + Intergenic
942330267 2:174816273-174816295 CATTCCTGCCTTGCAGAAACTGG - Intronic
942927015 2:181446167-181446189 CATTGCTGCCTGGGCATACCTGG + Intergenic
945825551 2:214716710-214716732 CATTCCTGCCTGGCTAAAACAGG + Intergenic
946117666 2:217477767-217477789 CATTGCTGCCTCCCATTGACAGG - Intronic
946428430 2:219612230-219612252 CATTGCAGACAGGCAACAACTGG - Intronic
948059560 2:235032969-235032991 CATTCCTTCCTGTGAATAACTGG + Intronic
1171472710 20:25384825-25384847 CATTCCTGCCAGGCAGCAACAGG + Intronic
1172435674 20:34927375-34927397 CCTTTCTGCCTGGCAGTCACAGG - Exonic
1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG + Intergenic
1177847339 21:26306004-26306026 CATTCTTGCCTGGCATTACCGGG + Intergenic
1179039571 21:37790408-37790430 TATTGCTGCCTGGCAAAAAGAGG - Intronic
1180592865 22:16955808-16955830 CACTGCAGCCTGGAAATAAAAGG - Intergenic
1181926466 22:26363112-26363134 CATTGTTACATGGCAATGACTGG - Intronic
1183048539 22:35241540-35241562 CATTCCTGCCTGGCACCACCGGG - Intergenic
954550656 3:51478827-51478849 TATTGCTGACTGGCAGAAACTGG - Intronic
955158853 3:56445126-56445148 CCTTTCTACATGGCAATAACTGG + Intronic
955666513 3:61355101-61355123 CATTACAGCCTGGCAAAGACAGG + Intergenic
955697929 3:61655212-61655234 CAGTGCTGCCTCTCAATGACAGG + Intronic
956370578 3:68555199-68555221 CATTGCTTACTGGCAAAAACAGG + Intergenic
958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG + Intergenic
962139315 3:132771935-132771957 CATTGCTGGGTGACACTAACAGG + Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962916687 3:139910856-139910878 CTTTGGTGCTTGGCAATAAATGG + Intergenic
967694690 3:192516393-192516415 CAAGGCTGCCTAGCACTAACTGG + Intronic
969054644 4:4393952-4393974 CATTGCAGCCTGGCTACAAAAGG - Intronic
970611018 4:17725345-17725367 CAGTGCTGCCTGGGAAAAAGAGG + Intronic
971136000 4:23869173-23869195 CATGGCTGCCTGGCTGTATCAGG + Intronic
971610813 4:28723873-28723895 CATTGGTCCCTGCCAATGACTGG - Intergenic
972966940 4:44521996-44522018 AATTCCTGCATGGCATTAACTGG - Intergenic
974117945 4:57603742-57603764 CACTGCAGCCTGGAAATACCAGG - Intergenic
977155895 4:93573129-93573151 CATTCCTGCCTTGGAATAGCAGG - Intronic
982048612 4:151475893-151475915 CACTCCAGCCTGGCAATAAAGGG - Intronic
992795405 5:80251405-80251427 CATTCCTGCCTTGCATAAACTGG + Intronic
995348942 5:111153024-111153046 TGTTCCTGCCTGGCAATAATTGG - Intergenic
996124238 5:119706564-119706586 CATTCCTGCCTAGCAATACAGGG - Intergenic
996289025 5:121829466-121829488 CATTCCTGCCTGGCAACACAGGG - Intergenic
999184181 5:149693240-149693262 TTTTGCTGCCTGGCACTTACTGG - Intergenic
1000259335 5:159571692-159571714 CATAGCTGCTTTGCAAAAACTGG - Intergenic
1001454317 5:171848894-171848916 CATTCCTGCCTGGCAGAGACCGG - Intergenic
1002104861 5:176874998-176875020 CATGGCTGCCTTGCAAGAAGTGG + Intronic
1004178445 6:13360838-13360860 GTTTCCTGCCTGGCAAGAACAGG + Exonic
1005083416 6:21980325-21980347 CTTTTCTGACTGGCAGTAACTGG - Intergenic
1006359275 6:33578550-33578572 CACTGCTGCCTTGCAGTGACCGG + Intronic
1011251464 6:85376499-85376521 TATTTCTGCATGGCAAAAACTGG + Intergenic
1012806699 6:103903741-103903763 CATTCCTTCCTGGCACCAACAGG - Intergenic
1018009313 6:159655331-159655353 CATTCCTGCCTGGCACCACCAGG + Intergenic
1018689563 6:166333727-166333749 CATTGCTGCCTGGCAATCTAAGG + Intronic
1031128874 7:117807721-117807743 CAGTGCTGTCTGGCATCAACAGG + Intronic
1031718882 7:125143636-125143658 CATTGATGACTGGAAATATCAGG + Intergenic
1035915388 8:3615223-3615245 CTTTGCTGTCTGTCAATAAATGG - Intronic
1038681395 8:29671670-29671692 CATGGCTGCCTTGCAAGCACAGG - Intergenic
1044590230 8:93907230-93907252 CATAGCTGATTGGCAATAACTGG - Intronic
1044665710 8:94632497-94632519 CATTCCAGCCTGGCAACAAGAGG + Intergenic
1048776785 8:137955355-137955377 CATAGCTGCCTGTAAAGAACTGG - Intergenic
1050119054 9:2289280-2289302 CATTGGTACCTGGTAATACCCGG - Intergenic
1053861365 9:42389272-42389294 CATTAATACCTGACAATAACAGG - Intergenic
1054724216 9:68634116-68634138 CATTTCTGTATGGCAATAACTGG - Intergenic
1060118815 9:120968499-120968521 AATTGTTACCTAGCAATAACAGG + Intronic
1060603969 9:124897669-124897691 CAGTGATGCCTGGCACTTACAGG + Intronic
1061928818 9:133821772-133821794 CATTCCTGCCTGGCCATCTCGGG - Intronic
1062311259 9:135938713-135938735 CACTGCTGACTGCCCATAACAGG - Intronic
1191659500 X:63635456-63635478 CATTGCTGTCAGGACATAACAGG + Exonic
1191965326 X:66751250-66751272 CATTCCTGCCTGGCAACACAGGG - Intergenic
1193101761 X:77622499-77622521 CATTCCTGCCTGGCAACACAGGG + Intronic
1194128388 X:90048451-90048473 CATTGCTGTCTTGCAGCAACTGG + Intergenic
1194273192 X:91846189-91846211 CATAGTTGCCTGGTAATAACAGG - Intronic
1194427701 X:93760301-93760323 CATTGTTGCCTAGCAAAAAGAGG + Intergenic
1197938879 X:131767927-131767949 CAGTGTTGGCTGGCAATGACAGG - Intergenic
1200590435 Y:5067584-5067606 CATAGTTGCCTGGTAATAACAGG - Intronic