ID: 1143674456

View in Genome Browser
Species Human (GRCh38)
Location 17:8421797-8421819
Sequence TACCCTCACCCTCCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143674452_1143674456 28 Left 1143674452 17:8421746-8421768 CCTTAGGGCATAGAAAGGAACGT 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG 0: 1
1: 0
2: 1
3: 17
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143674456 Original CRISPR TACCCTCACCCTCCCAGGAG AGG Intronic
900807121 1:4774751-4774773 TGCCCTCCCCGTCCCAGGGGAGG + Intronic
902553214 1:17231444-17231466 GACCATCACCGTCCCAGCAGTGG - Intronic
903996521 1:27308191-27308213 CACCCTCACTCTCCTGGGAGCGG - Exonic
905796639 1:40819707-40819729 TCCCCTGACCAGCCCAGGAGAGG + Intronic
907269576 1:53282940-53282962 TCCCCTCCCCCTCCCTTGAGAGG - Intronic
908511621 1:64854233-64854255 AACCCTCACACCACCAGGAGTGG - Intronic
909044116 1:70688585-70688607 CACCATCACCCTTCCAGGAAAGG - Intergenic
909282085 1:73769854-73769876 TCCCCACACCCTCCCTGCAGTGG - Intergenic
909282225 1:73770454-73770476 CAGCCCCACCCTCCCAGGTGTGG + Intergenic
912913623 1:113789161-113789183 TACCCCCAACCTCCAGGGAGGGG + Intronic
912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG + Intronic
915717003 1:157954205-157954227 GACTATCTCCCTCCCAGGAGAGG - Intergenic
918114896 1:181487326-181487348 TACCCTCCCCCTCCAAGTCGGGG - Intronic
918482125 1:184990243-184990265 GACCCTCATCTTCTCAGGAGGGG - Intergenic
919851333 1:201674957-201674979 CACCCTCAACCTCCCAGGTTCGG - Intronic
920557972 1:206918162-206918184 TCCCCTCATCCTCTCAGCAGCGG + Intronic
922699346 1:227749487-227749509 TACCAGCACCCTCCCAGCAGAGG - Intronic
922970232 1:229729788-229729810 CTCCCTCACCCTTCCATGAGGGG + Intergenic
1062824196 10:556442-556464 CACCCACACCTTCCCAAGAGGGG + Intronic
1064449763 10:15431257-15431279 CTCCCTCACCCTCCCAAAAGTGG + Intergenic
1069867318 10:71511843-71511865 TGCCATCAGCCACCCAGGAGAGG - Intronic
1070252451 10:74784817-74784839 TACCCTCAACCTCCAGGAAGAGG + Intergenic
1070766798 10:79061513-79061535 TCCTCCCACCCTACCAGGAGGGG - Intergenic
1074543612 10:114385866-114385888 TACCTGCAGCCTCCCTGGAGTGG - Intronic
1075412272 10:122237311-122237333 TACACTCACCCTCTCATGAATGG - Intronic
1075659572 10:124183921-124183943 CAGCCTCAACCTCCCAGGCGAGG - Intergenic
1075980942 10:126738648-126738670 TACCTTCACCATGCCAGGTGTGG - Intergenic
1076762310 10:132611712-132611734 CTCCCTCACCCTCCCTGGACAGG - Intronic
1076772748 10:132675578-132675600 TACCCTCACTCTCCCGGGCACGG - Intronic
1077050543 11:564458-564480 TACCCATACCCTCCCTGGGGTGG - Intergenic
1077168784 11:1157206-1157228 CAGCCTCACCCTCCCTGGAGAGG - Intergenic
1077386587 11:2272100-2272122 TGCCCCCAGGCTCCCAGGAGGGG - Intergenic
1080645864 11:34186935-34186957 ATCCCTTCCCCTCCCAGGAGGGG - Intronic
1081852182 11:46281451-46281473 TCCCCACACCCTCCCAGCTGGGG - Intronic
1083594544 11:63912611-63912633 TCTCCCCACCCTCCAAGGAGTGG - Intronic
1084505138 11:69561779-69561801 CCACCTCAGCCTCCCAGGAGTGG - Intergenic
1085350149 11:75793054-75793076 TATACCCTCCCTCCCAGGAGAGG - Intronic
1085527855 11:77174452-77174474 CACCCTAACCCTGACAGGAGGGG - Intronic
1086131134 11:83403760-83403782 TACCCTTACCTTCCTAGCAGTGG + Intergenic
1087793103 11:102428103-102428125 TAGACTCACACTCCCAGGAAGGG - Intronic
1089115071 11:116088226-116088248 TAACCTCACCCTCCAGGGATGGG + Intergenic
1089762744 11:120740373-120740395 TTCCCTCACCCCCGCATGAGTGG + Intronic
1090458652 11:126870578-126870600 TACCCTCACCATGCCAGGCTTGG + Intronic
1091323802 11:134669441-134669463 TACCCTGATCCTCCTGGGAGGGG + Intergenic
1091436534 12:477860-477882 TACCCTCACACTGCCAGTAATGG - Intronic
1091622707 12:2101438-2101460 CAACCTCCCCCTCCCAGGTGGGG + Intronic
1096104043 12:48986451-48986473 TACCCTCAGCATCCCAAGAATGG - Intergenic
1096471556 12:51880769-51880791 TAGCCTCAACCTCCCAGGCTTGG + Intergenic
1097036798 12:56129496-56129518 TACCCGGCCCCTCCCAGCAGAGG + Intronic
1097449260 12:59715604-59715626 TGCCCTCACCTTCCCAGCGGAGG - Intronic
1099661968 12:85575573-85575595 TACACTTACCCTTCCAGGATGGG - Intergenic
1099888932 12:88565812-88565834 TACCACCACCCTCACAGGTGGGG + Intronic
1102609508 12:114099177-114099199 TGCCCTCCCCCTCCCATGAGGGG - Intergenic
1104750746 12:131236586-131236608 ACCCCTCAGCCTCCCAAGAGAGG - Intergenic
1110973108 13:81792161-81792183 TCCCCTCACCCTGCCAGAAGTGG - Intergenic
1111655470 13:91146407-91146429 TAGCCTCAACCTCCCAGGCACGG - Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1114667894 14:24391459-24391481 TGCCCTCACCCTGCCATCAGTGG + Intergenic
1117794152 14:59374619-59374641 TACCCTGACTCTTCCAGGATGGG + Intergenic
1118642868 14:67808534-67808556 TACCCTCACCCTGCAAACAGAGG - Intronic
1120931798 14:89856267-89856289 TACCCTCTGCCTCCCAGGTTTGG + Intronic
1121996687 14:98608284-98608306 TTCCTTCTCCCTTCCAGGAGTGG - Intergenic
1122392635 14:101400521-101400543 TACCCACACCCACCAAAGAGAGG + Intergenic
1122464355 14:101920308-101920330 TAAGGTAACCCTCCCAGGAGGGG - Intronic
1123054121 14:105561166-105561188 TGCCATCTCCCTCCCAGGAGGGG + Intergenic
1123078704 14:105681583-105681605 TGCCATCTCCCTCCCAGGAGGGG + Intergenic
1125574265 15:40744726-40744748 TACACTCCCCCTCCCAAGAGGGG + Intronic
1127760182 15:62131917-62131939 TACTTTCATCCTCCCAGGTGTGG - Intergenic
1128809173 15:70557599-70557621 TCACCTCAGCCTCCCAGCAGAGG + Intergenic
1129325442 15:74798076-74798098 TACCGTCAGCCTGCCAGGACTGG + Intronic
1129573478 15:76715486-76715508 TACCCTACCTCTCCAAGGAGTGG + Intronic
1130098712 15:80875722-80875744 CACCCTCACTTTCCCAGGAGGGG - Intronic
1130311061 15:82754802-82754824 ATTCCTCCCCCTCCCAGGAGAGG - Intergenic
1130560302 15:84952776-84952798 CAGCCTCGACCTCCCAGGAGTGG - Intergenic
1130767011 15:86880925-86880947 TCCCCTGGCCCTCCTAGGAGAGG - Intronic
1131630244 15:94168438-94168460 TTTCTTCACCCTTCCAGGAGAGG - Intergenic
1132002488 15:98194053-98194075 TTCCCTGACCTCCCCAGGAGAGG + Intergenic
1132502892 16:292490-292512 TAGCCACAGCCTCCCTGGAGTGG + Intronic
1133122966 16:3622948-3622970 TCCCCTCACTCTCCCAAAAGAGG - Intronic
1133980594 16:10630486-10630508 CTCCCTCCGCCTCCCAGGAGAGG + Intronic
1136110646 16:28062424-28062446 TAGCCTGCCTCTCCCAGGAGGGG + Intronic
1136289367 16:29262189-29262211 GACCCTCTCCATCCCTGGAGGGG - Intergenic
1137729240 16:50677621-50677643 TTCCCTCTGCCTGCCAGGAGGGG - Intronic
1138188617 16:54996309-54996331 GACGCTCACACTCCCAGGAACGG + Intergenic
1138387680 16:56647584-56647606 GCCCATCACCTTCCCAGGAGTGG + Intronic
1138405304 16:56788199-56788221 TTCCCCTACCCTCCCAGGAGAGG + Intronic
1138554462 16:57763613-57763635 CACCGGCACCCTCCCAGGTGTGG - Intronic
1139637638 16:68267810-68267832 TACCCCCAACCTCCGGGGAGGGG + Intronic
1139849414 16:69941516-69941538 CACCCTGACCCACCCTGGAGCGG - Exonic
1141365299 16:83437126-83437148 TGACATCAGCCTCCCAGGAGAGG + Intronic
1141677299 16:85524539-85524561 CACCCTCACCCTCCCACACGTGG - Intergenic
1141828958 16:86498850-86498872 TACCTTCACCAGCCCAGGGGAGG - Intergenic
1141947203 16:87318686-87318708 TGCCCTCACCCACCCAAGAATGG + Intronic
1142002343 16:87670970-87670992 TACCCTCACCTTGGCGGGAGGGG - Intronic
1142095113 16:88235169-88235191 GACCCTCTCCATCCCTGGAGAGG - Intergenic
1143416799 17:6756499-6756521 TACTCTCACCCTCCTTGGAAAGG + Intronic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1144300106 17:13915514-13915536 TCTCCTCTCCCTCCCAGAAGTGG + Intergenic
1144707269 17:17377926-17377948 TACTCTCTCCCTCCCTGGTGAGG + Intergenic
1145309306 17:21692782-21692804 AGCCGTCACCCTCCCTGGAGAGG - Intronic
1145895332 17:28454213-28454235 CACCCCCAACCTCTCAGGAGGGG - Intergenic
1147650343 17:42058442-42058464 TAGCCTCAGCCTCCCTGGAATGG + Intronic
1151353144 17:73543292-73543314 TGCCCGCACCCTCGCAGGTGTGG + Intronic
1154319126 18:13330801-13330823 CACCCCCACCCTCCAGGGAGGGG + Intronic
1156310394 18:35917220-35917242 TCCCTTCACCCTGCCAGCAGAGG + Intergenic
1157710997 18:49849698-49849720 TACCCCCACCATCCCAGGCCGGG - Intronic
1159723223 18:71919555-71919577 TACCCTCACTCCCCAAAGAGTGG + Intergenic
1160066829 18:75583311-75583333 TCACCTCACCCACCCAGGACTGG - Intergenic
1160248843 18:77183699-77183721 CCCCCTCACCCTCCCCGGACAGG + Intergenic
1160514484 18:79470895-79470917 TCCCTTCACCCTCCCTGGGGCGG + Intronic
1160535738 18:79590356-79590378 CACCCTCACCCGTGCAGGAGCGG + Intergenic
1160858106 19:1226437-1226459 TGCCGTCTCCCTCCCAGGACAGG + Exonic
1161597432 19:5157812-5157834 TATCCTTACCCTCTCAGGGGAGG - Intergenic
1161603826 19:5203293-5203315 TTCCCTCCCCCTTCCAGGGGAGG + Intronic
1163154434 19:15432403-15432425 TCCCCACACCCTCCCAAGCGCGG + Intronic
1163551299 19:17967526-17967548 CACCCTCCCCCTCCCAGGATGGG - Intronic
1166265800 19:41683567-41683589 GACCCTGAGCCTCCCAGGACAGG + Intronic
1166282989 19:41807571-41807593 GACCCTGAGCCTCCCAGGACAGG - Intronic
1166364846 19:42273102-42273124 AGCCCTCGCCCTGCCAGGAGGGG + Intronic
1166405886 19:42521705-42521727 GACCCTGAGCCTCCCAGGACAGG + Intronic
1166985805 19:46659591-46659613 GCCCCTCCCCCTCTCAGGAGTGG - Intronic
925144448 2:1571575-1571597 TGCCTTCCCACTCCCAGGAGAGG + Intergenic
926093160 2:10063594-10063616 CACCCTCACCCTCCCAGGCAGGG - Intronic
927251704 2:21000486-21000508 TTCACTCAGCCTGCCAGGAGTGG - Intergenic
927488979 2:23508053-23508075 TATTCTCAGCCTCCCAGCAGGGG + Intronic
928196391 2:29219484-29219506 CACCCTCCCGCTCCCAGGAAAGG - Intronic
928595888 2:32858480-32858502 TGTGCTCACCCTCCCAGGGGTGG - Intergenic
931006104 2:57850828-57850850 TACCCCCACCCTCCCATGGCTGG - Intergenic
932353203 2:71048281-71048303 GACCCTTACCATCCCCGGAGAGG + Intergenic
932851760 2:75194427-75194449 TTCCCTCACCCCACCTGGAGGGG - Intronic
936919612 2:117674279-117674301 TTCTCTCCCCTTCCCAGGAGTGG + Intergenic
937111236 2:119368134-119368156 TACCCTCTCCCACCCAGAGGAGG + Intronic
938682442 2:133705325-133705347 ATGCCTCAACCTCCCAGGAGGGG - Intergenic
940304698 2:152212987-152213009 AATTCTCACTCTCCCAGGAGTGG - Intergenic
944171886 2:196788203-196788225 GTCCCTTACCCTCCCAGGGGTGG - Intronic
947319932 2:228905690-228905712 TATTCCCACCCTCCAAGGAGTGG + Intronic
947942968 2:234075105-234075127 TACCCACACCTTCCCAGCTGAGG - Intronic
948789001 2:240367684-240367706 CACCCCAACCCTCTCAGGAGGGG - Intergenic
1169770914 20:9199316-9199338 TACCCTCCCCATCCCAACAGTGG + Intronic
1170402812 20:16006060-16006082 TACCCTTAGCCTTCCAGGATTGG - Intronic
1172130278 20:32650612-32650634 TGCCCTCCCCCGCCCAGCAGGGG + Intergenic
1172303094 20:33863389-33863411 CACTCCCACCCTCCCACGAGCGG - Intergenic
1173631538 20:44520015-44520037 ACCCCTGACCCTCCAAGGAGGGG + Intronic
1174178955 20:48662929-48662951 TACCCTCACCCACAAATGAGAGG + Intronic
1174416794 20:50372857-50372879 CCCCCTCACCCTCCCAGGGAAGG + Intergenic
1174418734 20:50385419-50385441 TCCCCCCACCCTCCGAGGAGGGG + Intergenic
1179630435 21:42674581-42674603 TCCCCTTCCCTTCCCAGGAGGGG + Intronic
1180090809 21:45533104-45533126 GCCCTGCACCCTCCCAGGAGGGG + Intronic
1180157747 21:45986296-45986318 AATCCACGCCCTCCCAGGAGAGG - Intronic
1181021886 22:20107891-20107913 TACCCTCCACCCCTCAGGAGTGG - Intronic
1182875867 22:33690613-33690635 TGCCCTCACCCTACAAGGAAAGG - Intronic
1183740236 22:39664931-39664953 TTCCCCCATCCGCCCAGGAGGGG - Intronic
1183766141 22:39877115-39877137 TAGGCTCAACCTCACAGGAGTGG - Intronic
1185156224 22:49195037-49195059 CACCCTCACCCTCCAGCGAGAGG - Intergenic
1185251518 22:49804142-49804164 CACCCCCACCCTCCAGGGAGAGG - Intronic
950006077 3:9691763-9691785 TCTCCTCAGCCTCCCAAGAGGGG - Intronic
950094069 3:10318019-10318041 TAATATCACCCTCCCTGGAGGGG - Intronic
950161437 3:10764048-10764070 TCCCCTCACTCACCCAGGACTGG + Intergenic
952991912 3:38837603-38837625 TCTCTTCTCCCTCCCAGGAGAGG - Intergenic
954697657 3:52436188-52436210 TATTCTCCCCTTCCCAGGAGGGG + Intronic
959063503 3:101636010-101636032 GGCCCTCACCCTCCCCGCAGCGG + Intergenic
959963933 3:112333046-112333068 TCCCCACGCCCTCACAGGAGCGG - Intronic
960982981 3:123249331-123249353 TACTCCCACCCTCCGGGGAGGGG - Intronic
961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG + Intergenic
961696642 3:128709724-128709746 TGCCCTCTGCCTCCCTGGAGAGG - Intergenic
961809553 3:129514006-129514028 TGCTCTCACCCTGCCAGGTGGGG - Intronic
962905165 3:139794725-139794747 CTCCCTCACCCTCCAAGGTGCGG - Intergenic
964255159 3:154766979-154767001 GAGCCCCACCCTCCCAGGTGGGG - Intergenic
965748914 3:171956596-171956618 AACCCTCACCCTCCGCGCAGTGG - Intergenic
967346087 3:188457466-188457488 AAGCATCTCCCTCCCAGGAGCGG + Intronic
967840561 3:194001902-194001924 TACCCTCCTTCTCCGAGGAGTGG - Intergenic
968569287 4:1331161-1331183 CACCCACACGCTCCAAGGAGGGG + Intronic
968662927 4:1806240-1806262 TTCCCACACCCTCCCAGGGCCGG + Exonic
971481100 4:27115797-27115819 TAACCTCATCCTCCCAGCACTGG - Intergenic
972014140 4:34223059-34223081 TAACCTCAGTCTCCCAAGAGAGG - Intergenic
974260466 4:59518727-59518749 TCTCCACACCCTCCCAGCAGTGG + Intergenic
975608833 4:76183714-76183736 ACCCCCCAACCTCCCAGGAGGGG - Intronic
979831989 4:125315449-125315471 TCCCCTCACCATGCCAGGGGGGG - Intergenic
980039270 4:127920683-127920705 CACCATCACCCTCCTGGGAGTGG - Exonic
980092038 4:128453191-128453213 TCCCCTCCCCCACCCAGGGGAGG - Intergenic
980534140 4:134092728-134092750 TATCCTCTCCCTCCCACAAGGGG + Intergenic
980911169 4:138995942-138995964 TACCCACATCTTCCCAGGTGTGG + Intergenic
981225359 4:142287967-142287989 TACTCTCTCCCTCCCATGTGAGG - Intronic
986752678 5:10803063-10803085 AACCATCAGCCTCCCAAGAGAGG - Intergenic
988566032 5:32320616-32320638 GAGCCCCACCCTCCCAGGAGTGG - Intergenic
989077112 5:37575473-37575495 TACCCCCATCCTCCAGGGAGAGG + Intronic
990081126 5:51915053-51915075 ACCCCTCAAGCTCCCAGGAGGGG + Intergenic
994726322 5:103440568-103440590 GACACTCACCCACCCAGGTGTGG - Intergenic
996803382 5:127427997-127428019 TCCCTTCACCCTCACAGCAGGGG - Intronic
997409317 5:133679096-133679118 TGCCCTCTCCCTCTCAGGAGAGG + Intergenic
998652868 5:144141010-144141032 TATGGTGACCCTCCCAGGAGTGG + Intergenic
999470223 5:151848623-151848645 TACTCTCCCGCTCCCATGAGGGG - Intronic
1002317005 5:178349895-178349917 TACTCTCTCCCTCCCAGGCCTGG + Intronic
1002470924 5:179435758-179435780 TACCCTCACCCTCAGAGAGGCGG - Intergenic
1003873125 6:10417076-10417098 CACCGACACCCTCCCAGCAGCGG + Intronic
1005755304 6:28920745-28920767 TACCCCCAGCCTCCCAGGCCAGG - Intronic
1007134294 6:39506822-39506844 TACCCTCATCTTCACAGGAAGGG + Intronic
1013020788 6:106215351-106215373 TACCCTCACCCCTCAAGGAATGG + Intronic
1014107473 6:117583113-117583135 TACACACTCCCTCCCATGAGGGG + Intronic
1015582150 6:134737173-134737195 GACCGTCATCCTCCCAGGAGTGG + Intergenic
1016779170 6:147939345-147939367 CACCCTCAACCTCCAGGGAGGGG - Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1019100926 6:169628627-169628649 TTCTCTCATCCTCCCAGGACAGG + Intronic
1019657921 7:2207415-2207437 ACCCCTCAACCTCCTAGGAGGGG + Intronic
1029538435 7:101169165-101169187 TCCCCTCCCCCACTCAGGAGTGG - Intergenic
1029672078 7:102040265-102040287 TTCCGTCATCCTCCCTGGAGAGG - Intronic
1029706896 7:102280876-102280898 TACCCACCCCCTCCCTGGACAGG + Intronic
1032461468 7:132114527-132114549 TACCCCACCCCACCCAGGAGGGG - Intergenic
1032538616 7:132685143-132685165 TACACTCTACCTCTCAGGAGAGG - Intronic
1034443730 7:151101231-151101253 TTCCCCCACCAGCCCAGGAGGGG - Intronic
1035068277 7:156123388-156123410 CTCCCTCCGCCTCCCAGGAGTGG + Intergenic
1035624641 8:1061733-1061755 TTCCCTCTCCCTCCCCGGTGAGG + Intergenic
1037604116 8:20423029-20423051 GACCCTCCGCCTCCCAGGAAGGG + Intergenic
1037736574 8:21571733-21571755 TTCCCTCAACCTCCCGGAAGGGG + Intergenic
1038012441 8:23485951-23485973 TTCCCTGAAACTCCCAGGAGAGG + Intergenic
1039451206 8:37676365-37676387 TTCCTTCTCCCTCACAGGAGAGG + Intergenic
1044286772 8:90419461-90419483 TACGCTCCCCCTCCCACAAGGGG - Intergenic
1045278531 8:100728408-100728430 TTGCCTCAGCCTCCCAGTAGTGG - Intergenic
1046848920 8:118951673-118951695 CACTCGCTCCCTCCCAGGAGAGG - Intronic
1048250416 8:132862456-132862478 AACCCTGACCCTCCCAGGCAGGG - Intergenic
1048740301 8:137551055-137551077 AACCCTCACCCTCCCCCGAGAGG + Intergenic
1049266814 8:141671944-141671966 TGGCCTGTCCCTCCCAGGAGAGG - Intergenic
1055194198 9:73567147-73567169 TACCCACACCCTCAAAGAAGGGG + Intergenic
1059311613 9:113392123-113392145 TATCACCAGCCTCCCAGGAGTGG - Exonic
1060211955 9:121716044-121716066 GACCCTGACCCTCCCAGGGTGGG - Intronic
1061352767 9:130078839-130078861 TACCCCATCCCACCCAGGAGGGG - Intronic
1061798748 9:133103075-133103097 TACCCTCACCCTCCAGTGGGAGG + Intronic
1062058678 9:134482909-134482931 TCTCCTCACCCTCTCATGAGAGG + Intergenic
1062387179 9:136317381-136317403 GACTCTCACCACCCCAGGAGAGG + Intergenic
1185486342 X:484533-484555 TGCAGTCTCCCTCCCAGGAGTGG + Intergenic
1185486392 X:484773-484795 TGCGGTCTCCCTCCCAGGAGTGG + Intergenic
1185486428 X:484971-484993 TGCAGTCTCCCTCCCAGGAGTGG + Intergenic
1185486460 X:485130-485152 TGCAGTCTCCCTCCCAGGAGTGG + Intergenic
1187953771 X:24495745-24495767 TACCCTCAACCTCTGGGGAGGGG - Intronic
1188182470 X:27072942-27072964 TGTGCTCACCCTCCCACGAGGGG + Intergenic
1189725712 X:43966447-43966469 CACCCACTCCCTCCCAGGAAGGG + Intronic
1190369305 X:49726499-49726521 TACCCTCACAAAGCCAGGAGGGG + Intergenic
1191609721 X:63100050-63100072 ACCCCTCTCTCTCCCAGGAGGGG - Intergenic
1195325667 X:103756323-103756345 CACCCCCAGCCTCCTAGGAGGGG - Intergenic
1198438052 X:136636333-136636355 CACCCCCACCCTCCCAGGCAGGG + Intergenic
1198517515 X:137424868-137424890 TCCCCTCCCCCTCCCAGGAATGG + Intergenic
1199651593 X:149950249-149950271 TGCTCTCTCCCTCCCATGAGGGG - Intergenic