ID: 1143674503

View in Genome Browser
Species Human (GRCh38)
Location 17:8422078-8422100
Sequence GTGGGAGCCCTGAGAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143674495_1143674503 20 Left 1143674495 17:8422035-8422057 CCAAGGTGAATAACATGAGGCAT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG 0: 1
1: 0
2: 6
3: 40
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143674503 Original CRISPR GTGGGAGCCCTGAGAAAAGG TGG Intronic
900704843 1:4073962-4073984 CTGTGAGCCCTGAGGGAAGGGGG + Intergenic
900785783 1:4649461-4649483 GACTGAGCCCTGAGTAAAGGGGG - Intergenic
900857734 1:5199487-5199509 GTGTGAACACAGAGAAAAGGAGG + Intergenic
900981358 1:6047935-6047957 GTGGGAGCCCTGCGGCACGGAGG - Intronic
901065223 1:6491071-6491093 GAGGGGGCCCAGAGAAAAGCGGG - Intronic
901758577 1:11456144-11456166 GAGGGAGCCCTGGGAGACGGGGG - Intergenic
903392194 1:22972508-22972530 GGGGGAGCCATGGGAAGAGGAGG - Intergenic
903538953 1:24086052-24086074 GTGGGAGCCCTGGGAAGCTGGGG + Intronic
905237940 1:36563087-36563109 GTGGGAGTCCTGAGAGAGGAAGG - Intergenic
905498740 1:38418935-38418957 GTGGGGGTGGTGAGAAAAGGTGG + Intergenic
906084887 1:43123192-43123214 GTGGGTGTACTGAGAAAAGCAGG + Intergenic
906149999 1:43582133-43582155 CTGGGAGCCCTGAGAATTTGGGG - Intronic
906256683 1:44355740-44355762 GGGGGAGACCTGAGACAAGGAGG + Intergenic
906963280 1:50432377-50432399 GTGGAGGCCCTGAGAAGAGATGG - Intergenic
907873679 1:58465913-58465935 GAAGCAGTCCTGAGAAAAGGTGG - Intronic
908782276 1:67701234-67701256 GTGAGAGCCCAGAGGAAAGAGGG - Intergenic
909604956 1:77498726-77498748 GAGAGAGTCTTGAGAAAAGGAGG + Intronic
911609535 1:99945449-99945471 ATGGGAGTCATGAGAAAAAGTGG + Intergenic
912872410 1:113321194-113321216 GTGTGAGAACAGAGAAAAGGGGG - Intergenic
915709758 1:157884379-157884401 GTGGGTGACCTCAGCAAAGGCGG + Intronic
916022986 1:160810408-160810430 GTGGGGGCACAGTGAAAAGGTGG - Intronic
916295685 1:163216782-163216804 GTGATGGCCCTGAGAAAGGGTGG + Intronic
918399046 1:184145336-184145358 GGGAGAGACCTGAGAAAATGCGG + Intergenic
919867577 1:201793876-201793898 GTGAGAGGCCTGGGAAAGGGTGG + Intronic
920190841 1:204192801-204192823 TGGGGAGCCATTAGAAAAGGTGG - Exonic
920245149 1:204582295-204582317 GAGGCAGCCCTGAAAAGAGGAGG - Intergenic
920265094 1:204715713-204715735 GGGGGATCCCTGAGAAACGCTGG - Intergenic
922614754 1:226955179-226955201 GTGGGAGCCCTGGGAGGATGAGG + Intronic
1063616573 10:7605261-7605283 GTGGGTGGCATGAGAAGAGGGGG - Intronic
1064581398 10:16796527-16796549 GTGGGAGCTCTGATAAGAGGGGG - Intronic
1066658962 10:37721069-37721091 GTGGGGGCCCAGTGAGAAGGAGG + Intergenic
1068102290 10:52570646-52570668 GTGGCAGCTCTCAGAATAGGAGG - Intergenic
1068733080 10:60381599-60381621 GTGGAAGAACTGAGAAAAAGAGG - Intronic
1069305203 10:66960795-66960817 GTGACTGCCCTTAGAAAAGGGGG + Intronic
1071256580 10:83877240-83877262 GGGGGAGGCATGGGAAAAGGTGG - Intergenic
1071532860 10:86402242-86402264 AGGGGATCCCTGAGAAATGGGGG + Intergenic
1072191525 10:93080353-93080375 ATGGGAGCGCTGAGAGGAGGTGG + Intergenic
1072963957 10:99955445-99955467 CTGTGAGACCTTAGAAAAGGAGG - Exonic
1073069110 10:100782173-100782195 GCGGGAACCATGAGAAAATGGGG - Intronic
1073959074 10:108905078-108905100 TTGAGAGGCCAGAGAAAAGGAGG + Intergenic
1074789888 10:116876472-116876494 CTGGTAGCCCTCAGTAAAGGGGG - Intronic
1075280591 10:121135025-121135047 TTAGGAGCCCTCACAAAAGGTGG - Intergenic
1076375139 10:129978721-129978743 GCTGGAGCCCTGAGAAAGAGAGG + Intergenic
1076525624 10:131110773-131110795 GCGTCAGCCCTGAGAAAAGGGGG + Intronic
1077194740 11:1273698-1273720 GTGGGACTCCTGAGCAAAGATGG - Intergenic
1077328154 11:1972506-1972528 GTGAGAGACCCGAGAGAAGGGGG - Intronic
1077562536 11:3272885-3272907 GTGAGAGCTCTGAGCAAGGGAGG - Intergenic
1077568429 11:3318704-3318726 GTGAGAGCTCTGAGCAAGGGAGG - Intergenic
1078642241 11:13107658-13107680 GTGGGAGTCGGGAGAAGAGGAGG - Intergenic
1080061194 11:27958701-27958723 GGAGGAGCGCTGAGCAAAGGGGG - Intergenic
1080922325 11:36721461-36721483 GTGAGAGCAGTGAGAGAAGGGGG - Intergenic
1081794337 11:45809278-45809300 GTGGGAGCTCTGGGCAAGGGAGG + Intronic
1082765103 11:57161350-57161372 ATGGGAGCCCTGAGGAAGGAGGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083571032 11:63762574-63762596 GTGGGAGCCCGGGGCACAGGCGG - Exonic
1083594405 11:63912052-63912074 GTGGGAGCCGTGGGCAAAGGTGG + Exonic
1083716569 11:64580879-64580901 GTGGGAGCCCACAGGAAGGGGGG + Intergenic
1085385783 11:76157389-76157411 GTGGGAGGCCTGGGAAGGGGAGG + Intergenic
1086063799 11:82726450-82726472 TTGTGAGCCCAGAGACAAGGAGG + Intergenic
1090351326 11:126110319-126110341 GTGGGTGCCCCTAGAGAAGGAGG - Intergenic
1091051840 11:132379467-132379489 GTGGGTGGCCTCAGAAGAGGAGG + Intergenic
1202811133 11_KI270721v1_random:27686-27708 GTGAGAGACCCGAGAGAAGGGGG - Intergenic
1092357693 12:7810238-7810260 GTAGGAACACTGAGAAAAGCAGG - Intergenic
1092652863 12:10653526-10653548 GTGTAAAACCTGAGAAAAGGTGG + Intronic
1093115479 12:15205348-15205370 GTGGGAGACCTAAGAAATCGTGG + Intronic
1095190948 12:39257420-39257442 GTTGGGGCCTTGAGAAAAAGAGG - Intergenic
1096671187 12:53199143-53199165 GTGGGAGCCCAGATAAGAGATGG - Intronic
1097198218 12:57256260-57256282 GTGGGAGACATGAGTATAGGAGG + Intronic
1098036527 12:66308424-66308446 CTGGGACTCATGAGAAAAGGAGG + Intronic
1098167145 12:67710325-67710347 GTGGAAGCCCTGAGAAACGCAGG + Intergenic
1098302010 12:69064092-69064114 GTGAGAGCCCAGTGAGAAGGCGG + Intergenic
1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG + Intronic
1099465113 12:82975057-82975079 GTGGGAGACAGGAGAACAGGAGG + Intronic
1100086593 12:90918166-90918188 GAGGAAGCCCTGAGAAAAGAAGG - Intronic
1100390235 12:94141170-94141192 GTGGGAGCCGTGGGCAAAGGTGG - Intergenic
1101811872 12:108114452-108114474 GTGGGTCCCCTCAGGAAAGGGGG + Intergenic
1102118812 12:110424660-110424682 GTAGAAGCCCAGAGAAAAAGAGG - Intergenic
1108520263 13:51240816-51240838 TTGGGATCCCTGAGAAGAGCAGG - Intronic
1113425019 13:110200539-110200561 GTGGGAGCCGTGGGAAAAGAGGG + Intronic
1113498461 13:110753704-110753726 TTGTGAGCCATGAGAAAAGGTGG + Intergenic
1114522508 14:23348063-23348085 GTGGGGACCCTGGGAGAAGGTGG + Intronic
1116504006 14:45655423-45655445 TTGTGAGCACTTAGAAAAGGAGG - Intergenic
1117438727 14:55741365-55741387 GTGGGAGGCCTGGGGGAAGGAGG + Intergenic
1118064022 14:62171110-62171132 GTGGGAGGCAAGAGAAAATGAGG + Intergenic
1118364354 14:65081792-65081814 GATGGAGCCCTGAGACAGGGTGG + Intronic
1118513216 14:66499195-66499217 GTGGGATGTATGAGAAAAGGGGG - Intergenic
1118594237 14:67423592-67423614 GTGGTAAGTCTGAGAAAAGGTGG + Intergenic
1118615209 14:67570268-67570290 GAGGCAGACATGAGAAAAGGTGG - Intronic
1118883615 14:69849278-69849300 GTGCCAGCCCTCAGAAGAGGTGG + Intergenic
1119378562 14:74214348-74214370 GTGAGAGCCATGAGAAAAGCTGG + Intergenic
1119427880 14:74547582-74547604 TTCTGAGCCCTGAGACAAGGAGG + Intronic
1120298041 14:82669774-82669796 GTTGGAGCTTTTAGAAAAGGTGG + Intergenic
1120780429 14:88481401-88481423 GTGGCAGCAGTGAGGAAAGGGGG - Intronic
1121254603 14:92522009-92522031 GTGGGAGCCCTAAGAATCTGGGG + Intronic
1121280004 14:92691313-92691335 GTGAGGGCCCTGAGAGAAGGTGG - Intergenic
1121323551 14:93006824-93006846 GTGGCAGGCCTGGAAAAAGGGGG - Intronic
1121786028 14:96661662-96661684 TTGTGAGAGCTGAGAAAAGGTGG + Intergenic
1122359736 14:101152176-101152198 GGGGGAGCCTTGAGAAAACCAGG - Intergenic
1123896523 15:24836118-24836140 GTGAGAGCACAGAGAGAAGGTGG - Intronic
1123920800 15:25068438-25068460 ATGGTACCCCAGAGAAAAGGTGG + Intergenic
1124054139 15:26226071-26226093 ATGGGAGCCCAGAGGAAAGCAGG + Intergenic
1124100110 15:26685061-26685083 ATCTGACCCCTGAGAAAAGGAGG - Intronic
1124636176 15:31366364-31366386 GTGGGGGCCGTGGGACAAGGCGG - Intronic
1125157373 15:36603198-36603220 TGGGGAGCACAGAGAAAAGGTGG - Intronic
1125532674 15:40423857-40423879 TTGGGAGCCCTGAAATCAGGTGG + Intronic
1125677537 15:41511005-41511027 GCAGGAGCTCTTAGAAAAGGAGG - Intronic
1126362612 15:47861734-47861756 GCTGCAGACCTGAGAAAAGGAGG + Intergenic
1126674918 15:51152683-51152705 AGAGGAGCCCTGAGAAATGGGGG - Intergenic
1129018139 15:72487739-72487761 CTGGAAGCCCAGAGACAAGGAGG - Intronic
1130316235 15:82799473-82799495 TTTGGAGCCCTCAGAAAAGACGG - Intronic
1130461783 15:84164641-84164663 GCAGGAGCCTGGAGAAAAGGAGG - Intergenic
1131510469 15:93047152-93047174 GTGGGAGGCCTGAGAGGAGGAGG + Intronic
1131622091 15:94079123-94079145 CTGGGAGCCTAGAGAAAAAGGGG + Intergenic
1134467841 16:14495001-14495023 GTGTGAGCCCTGAGAAAGAATGG + Intronic
1134803735 16:17107867-17107889 GTGGCAGCCTTGAGGGAAGGAGG + Exonic
1135838429 16:25850602-25850624 GTGGGAGCTTGGAGAATAGGAGG - Intronic
1136234298 16:28904743-28904765 GTGTGATCCCTGAGAACAGGAGG + Exonic
1136482527 16:30551422-30551444 GTGGTAGCAGAGAGAAAAGGAGG + Intronic
1136683083 16:31979111-31979133 GTGGGAGCCATGAGGCAAGGAGG + Intergenic
1136783723 16:32922667-32922689 GTGGGAGCCATGAGGCAAGGAGG + Intergenic
1136886065 16:33931139-33931161 GTGGGAGCCATGAGGCAAGGAGG - Intergenic
1137441125 16:48499200-48499222 GAGGGGGGCCTGAGAAAAGGGGG - Intergenic
1137783676 16:51119548-51119570 TTGGGAGGCCTGAGAGAAGAAGG - Intergenic
1138541192 16:57688835-57688857 GTGGGAGGCCAGTGACAAGGAGG - Exonic
1138547331 16:57727674-57727696 GTGGGAGCCCTGAGTAGAGGTGG - Intronic
1139160298 16:64498008-64498030 GGGTGAGACATGAGAAAAGGGGG - Intergenic
1141436704 16:84003803-84003825 GTGGGAGCCCTGAGGGGAAGGGG + Intergenic
1142304542 16:89278184-89278206 CTGGGGGGCCTGAGAACAGGAGG + Intronic
1203086375 16_KI270728v1_random:1186669-1186691 GTGGGAGCCATGAGGCAAGGAGG + Intergenic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1143881058 17:10030460-10030482 GTTGGACCCGTGTGAAAAGGGGG + Intronic
1143898734 17:10157150-10157172 ATGGGACCCCTGGGAGAAGGAGG + Intronic
1144256772 17:13476168-13476190 TTGGGAGCCCTGAGTCTAGGTGG - Intergenic
1144461697 17:15463804-15463826 GTGGGTGGCCTGAGGAAATGGGG + Intronic
1145103801 17:20098285-20098307 CTGTGAGACATGAGAAAAGGAGG - Intronic
1146255713 17:31390849-31390871 GTGGGAACCCGGCGAAAGGGAGG + Intergenic
1146748713 17:35355886-35355908 GTGGGAGCTCTGAGGACAGAAGG - Intronic
1146835158 17:36104824-36104846 GTGGGAGCCGAGAGAGAAGGGGG + Intronic
1147143993 17:38474820-38474842 GTGGGAGCCATGAGGCAAGGAGG + Intronic
1147314460 17:39612899-39612921 GTGGGAGCCCAGGGAGCAGGCGG - Intergenic
1149389640 17:56175946-56175968 GTGGGAGGTCTGGGAAAGGGAGG + Intronic
1149629433 17:58110138-58110160 GTGGGAGACCCGGGACAAGGAGG + Intergenic
1151223960 17:72634813-72634835 GTGGCAGCCCTGGGAAGAGAAGG + Intergenic
1151509666 17:74550539-74550561 GTGGGAGGCGTGAGCAAAGAAGG + Intergenic
1151606065 17:75136867-75136889 GTGGGACCTCTGGGAATAGGGGG - Intronic
1151817637 17:76479059-76479081 GTGGGATCCATGGGGAAAGGAGG - Intronic
1152755552 17:82085585-82085607 GTGGCTGCCCTGAGAGAAGGGGG - Exonic
1152897683 17:82922729-82922751 GTGGGGGCCATGAGCAGAGGAGG - Intronic
1155084736 18:22446857-22446879 CTGGGAGCACTGAGAAAAGGAGG + Intergenic
1155095973 18:22556946-22556968 GTTGGAGCTGTGAGAAAAGCAGG - Intergenic
1155191085 18:23431211-23431233 CTGGTAGCCCTGGGAAAAAGTGG - Intronic
1155328518 18:24690846-24690868 GTAGCAGCCCTGAGACAATGTGG - Intergenic
1158274132 18:55748175-55748197 GTGGGAACACTGAGGAAAAGTGG - Intergenic
1159120499 18:64163630-64163652 GGGGGAGGCCTGAGAATAGCTGG + Intergenic
1162938148 19:13992094-13992116 GTGGGAGCCCGGATCAAAGCTGG - Intronic
1163870263 19:19815393-19815415 GTGGCAGCTGTGGGAAAAGGGGG + Intronic
1163948346 19:20561428-20561450 GTGGCAGCTGTGGGAAAAGGGGG + Intronic
1163969760 19:20780854-20780876 GTGGCAGCTGTGGGAAAAGGGGG - Intronic
1164000287 19:21092204-21092226 GTGGCAGCTGTGGGAAAAGGGGG - Intronic
1164006653 19:21155988-21156010 GTGGCAGCTTTGTGAAAAGGGGG - Intronic
1164022661 19:21322241-21322263 GTGGCAGCTGTGGGAAAAGGGGG + Intronic
1164048494 19:21563482-21563504 GTGGCAGCTGTGGGAAAAGGGGG + Intergenic
1164306445 19:24007886-24007908 GTGGCAGCTGTGGGAAAAGGGGG + Intergenic
1164749936 19:30645970-30645992 GTTGGAGCCCTGAGGACAGCAGG + Intronic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
1165264189 19:34646723-34646745 TGGGGAGCCCTGAGGAAGGGAGG - Intronic
1165457970 19:35925889-35925911 GTGGGAGCCCTGAGGCACTGGGG + Intergenic
1165820387 19:38671117-38671139 GTGACAGCTCTGATAAAAGGTGG + Intronic
1166211282 19:41308210-41308232 GTGGGAGCTCTGTGAGAACGGGG - Intronic
1166660144 19:44641673-44641695 TTGGGAGCCCAGAGAAGTGGGGG + Intergenic
1166662682 19:44657527-44657549 GTGGAAGCCCTGAGGAGAGGTGG + Intronic
1166862249 19:45817199-45817221 GGGGGAGCTCTGGTAAAAGGCGG - Intronic
1166982462 19:46639331-46639353 GCGGGAGCCCTAGGAAGAGGTGG + Intergenic
926061138 2:9805933-9805955 GGGGGAGCCCAGAGACAAGGGGG - Intergenic
926181357 2:10646713-10646735 GTGGTGGCCCTGAGCAAGGGAGG - Intronic
926760207 2:16271776-16271798 GTGGAAGTCCTGGGAAAAGCAGG - Intergenic
927965597 2:27265691-27265713 GTGTGAGCCTTGAGAGAAGCAGG - Intronic
928370482 2:30736781-30736803 AAGGAAGCCCTGAGGAAAGGAGG + Intronic
931587403 2:63842577-63842599 GCGGGAGGACTGAGAAAAGCCGG + Intronic
932715960 2:74100936-74100958 GTTGGAGCTCTGGGCAAAGGGGG - Exonic
935725528 2:106020839-106020861 GTGGAGGCCCTGAGAAACGTCGG - Intergenic
936441232 2:112555247-112555269 GTGGGATCCCTGAGCCCAGGAGG + Intronic
936947008 2:117940251-117940273 GTAGGAGCCTGGAGAAGAGGTGG + Intronic
938299766 2:130201614-130201636 GTTGGAGCCCTGAGGAAGGGGGG - Intergenic
939338493 2:140862530-140862552 GTGGGAAACCTGGGGAAAGGAGG - Intronic
940431759 2:153599870-153599892 GTGTCAGCTCTGAGAAGAGGGGG - Intergenic
940776698 2:157892165-157892187 GGGGGAGCTCTAAGAAAAGTAGG + Intronic
941975974 2:171405900-171405922 GTAGGGGGCATGAGAAAAGGAGG + Intronic
942274237 2:174307332-174307354 GTTGGAGTCCTGAGGAAAAGGGG - Intergenic
942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG + Intergenic
944158414 2:196633704-196633726 GTGTGTGCCCTGAGATAGGGTGG + Intergenic
947686211 2:232087840-232087862 GTGGCAGCTTTCAGAAAAGGGGG + Intronic
947752553 2:232540446-232540468 GTGGGACCCCTGATGGAAGGAGG - Intronic
947987004 2:234456818-234456840 GTGGCAGCCCTGAAAAAAAAAGG + Intergenic
948059297 2:235031670-235031692 GTGGAAGGCCTAAGAACAGGTGG - Intronic
948204515 2:236156197-236156219 GGAGGAGCCTTGAGAAAAGAGGG + Intergenic
948866643 2:240778461-240778483 CTGAGAGCTCTGAGAAATGGAGG - Intronic
949075935 2:242057899-242057921 GCAGGAGCCCTGAGAACAAGGGG + Intergenic
1169953094 20:11069929-11069951 GAGGGAGCTCTGAGAAGACGGGG - Intergenic
1170353286 20:15465644-15465666 GTGTGAGGCATGAGAAAACGGGG + Intronic
1170391338 20:15878027-15878049 GTGGGTGGCATGAGAAAAGGAGG - Intronic
1170815343 20:19709112-19709134 GTGGGAGCTCTGGGAAACAGAGG + Intronic
1170880138 20:20289730-20289752 GGGTGAGACCTGAGGAAAGGTGG + Intronic
1171230267 20:23478884-23478906 GAGGGAGCCCTGACACCAGGTGG - Intergenic
1172110453 20:32541635-32541657 GTGGGGGCCCAGAGAGAAGCTGG - Intronic
1172358371 20:34295230-34295252 GTGGCAGCACTGGGAAACGGAGG + Intronic
1173539724 20:43842456-43842478 GTGGGGGCTGTAAGAAAAGGGGG - Intergenic
1175112069 20:56655403-56655425 GTGGGAGGACTGGGAAGAGGAGG + Intergenic
1175522265 20:59609453-59609475 GTGGGAGACCTGAAACAAGTGGG - Intronic
1175784792 20:61705636-61705658 GTGGGAGCGTGTAGAAAAGGGGG + Intronic
1175841689 20:62031986-62032008 GGGGGAGCTCTGAGGAAAGGAGG - Intronic
1175853274 20:62104959-62104981 GAGGGAGCCCTTGGGAAAGGAGG + Intergenic
1175903971 20:62370905-62370927 GTGGCAGCCCTGGGGGAAGGCGG - Intergenic
1178685016 21:34703733-34703755 TGGGGAGCCCTGAGACAGGGAGG + Intronic
1179233690 21:39527063-39527085 GAGGGAGCCCTGAGGTAAGAGGG - Intergenic
1179342984 21:40530416-40530438 TTGGGAGCTCTGATAACAGGTGG + Intronic
1179614795 21:42575475-42575497 GCAGGAGCCCAGAGAAAAGGGGG - Intronic
1179631656 21:42682625-42682647 GTGGGGGCCTTGAGAAGAGAGGG - Intronic
1181473413 22:23154381-23154403 GTGGAAGTCCTGAGAGAAGGGGG - Intronic
1181629912 22:24145321-24145343 TTTGGAGCCCTGAGGAATGGTGG - Intronic
1184266441 22:43349409-43349431 CTGGGAGTCCTGAGAGAAGCAGG - Intergenic
1184590317 22:45477608-45477630 GTGAGATCCCTGAGAAGAGGTGG - Intergenic
1184807307 22:46803380-46803402 GTTGGAGGCCTGAGGAAGGGCGG + Intronic
1184916235 22:47570873-47570895 GTGGGTGTCCTGAGGAATGGTGG + Intergenic
1185142813 22:49112806-49112828 CTGGGAGCAGTGAGAAACGGAGG + Intergenic
1185165777 22:49261383-49261405 ATGTGAGCCCTGAGAAAGAGGGG + Intergenic
1185353774 22:50353357-50353379 TAGGGAGCCCTGAGGAGAGGGGG + Intronic
950627981 3:14262261-14262283 GTGGGAGCCCTGAGCACACTGGG - Intergenic
953517712 3:43612429-43612451 GTGGTATCCCTGAGAAAGGCAGG - Intronic
953773190 3:45794412-45794434 GTGGGTGCACAGACAAAAGGAGG - Intronic
953791830 3:45953444-45953466 ATGGGACCCATAAGAAAAGGAGG - Intronic
954845311 3:53550742-53550764 ATAGGAGCCCTGAGAAGTGGTGG + Intronic
955655563 3:61241289-61241311 TTTGGAGCCCTGAGGACAGGTGG - Intronic
956129067 3:66037952-66037974 GGGGGCGCCCCGAGAAAAGGAGG - Intronic
958436182 3:94098626-94098648 GTAGGAGTCCTGAGACAATGAGG - Intronic
959242073 3:103808870-103808892 GTGAGTGCCCTCAGAAAGGGAGG + Intergenic
961450189 3:126999164-126999186 GTGGGGGTCCTGAGAAGAGAGGG + Intronic
964847796 3:161062512-161062534 TTGGGAGCAGTGAGAACAGGTGG - Intronic
965816692 3:172643784-172643806 CTTGCAGGCCTGAGAAAAGGAGG - Intronic
965941256 3:174184737-174184759 GTGGGATCAGTGAGAAACGGTGG + Intronic
966924815 3:184637461-184637483 GTGGGACTCCTGAGAAGAGAGGG + Intronic
967023124 3:185540196-185540218 GTGGGACCTCTGAGAAGATGGGG - Intronic
967814804 3:193789505-193789527 ATGGGAGTCCTGAGAAAGAGAGG - Intergenic
967914962 3:194571920-194571942 GTAGGAGGCCTGAGAAAACTGGG + Intergenic
968969492 4:3786179-3786201 TTGGGAGCCCTGAGCACAGATGG + Intergenic
969309467 4:6345150-6345172 GTGTGAGCCCTGTGGGAAGGAGG - Intronic
969422885 4:7107573-7107595 GTGGGTGCCTGGAGACAAGGGGG + Intergenic
969425161 4:7120010-7120032 GTGGGAGCTCTGGGAACAGGAGG + Intergenic
969615225 4:8248020-8248042 GTGGGACCCCAGAGCATAGGTGG - Intergenic
970117970 4:12720542-12720564 GTCAGAGCCCTGGGTAAAGGTGG + Intergenic
970202772 4:13626868-13626890 GTGGGAGCGCAAAGATAAGGAGG - Intronic
970436950 4:16045046-16045068 GTGGGATCCCAGAGTAGAGGTGG - Intronic
975381288 4:73703168-73703190 CTGGAAGTCCTGAGCAAAGGGGG + Intergenic
976398455 4:84582764-84582786 GGTGGGGGCCTGAGAAAAGGTGG - Intergenic
978096399 4:104784269-104784291 GTGGGAGGCCTGAGGAACAGTGG - Intergenic
978264332 4:106804478-106804500 CTGGGAACCCTGAAAAAATGTGG + Intergenic
980108209 4:128608490-128608512 GTGGAAGCCCTGAGCAAGAGAGG + Intergenic
980689952 4:136282048-136282070 GTAGCAGCCCTTAGAAAAGAAGG + Intergenic
983346735 4:166536245-166536267 GGGGAACCCCTGAGAAAAAGAGG - Intergenic
983718714 4:170818161-170818183 GTGGGAGCCAGGAAGAAAGGAGG - Intergenic
984712667 4:182898625-182898647 GCGGGAGCCCTCAGAGATGGAGG - Intronic
984926358 4:184810660-184810682 GTGCGAGCCCTGAGGTCAGGAGG - Intronic
986626077 5:9725080-9725102 GGGGGACTCCTGAGAGAAGGGGG + Intergenic
990749753 5:59001558-59001580 TAGGGAGACCAGAGAAAAGGAGG - Intronic
991035591 5:62124454-62124476 GTGGGGGCCCTGAGCAACGGAGG + Intergenic
992664595 5:78994810-78994832 GTGGCAGACCTGGGAAAAGCAGG + Intergenic
993486933 5:88498312-88498334 GTAGGAGCCCAGAGAAGTGGTGG - Intergenic
995106019 5:108379718-108379740 GTGGGAGAAGAGAGAAAAGGAGG + Intronic
998372122 5:141668691-141668713 GTAGGAGACCTGGGAGAAGGGGG + Intronic
998854860 5:146384892-146384914 TTGGGAGCCCAGAGAAAAATGGG + Intergenic
999357291 5:150947180-150947202 GTGGGGAGCCTGGGAAAAGGAGG + Intergenic
1000188050 5:158880165-158880187 CTGGGTGCTCTGAGAAAGGGAGG + Intronic
1001884150 5:175273702-175273724 GTGGGATCCTTGAGAAAAGGGGG - Intergenic
1002053671 5:176586111-176586133 GGGGGAGCCTTTAGAAAGGGGGG + Intronic
1002474162 5:179454470-179454492 GTGGGGGCCATGAGCAGAGGAGG - Intergenic
1003123026 6:3333588-3333610 CTTAGAGACCTGAGAAAAGGAGG - Intronic
1003312573 6:4982557-4982579 TTGGGAGGCGTGAGAATAGGGGG - Intergenic
1005605914 6:27477389-27477411 GTAGCAGCCCTCAGAATAGGTGG + Intergenic
1006021433 6:31120304-31120326 CTGGGGGCCCTGGGAACAGGAGG - Intronic
1006787126 6:36676076-36676098 GTGAGACCCCAGAGAAGAGGCGG - Intergenic
1007045931 6:38774216-38774238 GTGGGAGAGAAGAGAAAAGGTGG + Intronic
1007712511 6:43833710-43833732 GTGGGAGCGCTGGGGAACGGGGG + Intergenic
1007725038 6:43911035-43911057 GTGGGACTCCAGAGAAAGGGAGG - Intergenic
1008199816 6:48572460-48572482 GTGGGAGACATGAGATATGGAGG + Intergenic
1008657200 6:53627943-53627965 GTGGGAGCACGGAAAAAAGCTGG + Intergenic
1010120106 6:72365292-72365314 TTGGGTGCCCTGAATAAAGGTGG - Intronic
1010588491 6:77684481-77684503 GTGGGGGACCTGGGGAAAGGTGG - Intergenic
1011194947 6:84771953-84771975 GGGGGAGCCCTGGGCAAAGCAGG - Intergenic
1013569773 6:111410408-111410430 GTGGGAGCCATGATTAAAAGAGG - Intronic
1014169989 6:118267827-118267849 GGGGGAGCCCTGAGTCAGGGTGG + Intronic
1016550760 6:145277223-145277245 ATAGGAGCCCTGAGAAAAATAGG + Intergenic
1016895088 6:149043547-149043569 GGGCCAGCCCTCAGAAAAGGAGG - Intronic
1017563411 6:155658155-155658177 GTGGCAGCCTTGATAGAAGGAGG + Intergenic
1018743705 6:166748601-166748623 GTGGGGGCCCAGGGAAATGGGGG - Intronic
1018788827 6:167130911-167130933 GTGGGGTCCCTGAGAGAAGGAGG - Intronic
1018948783 6:168365064-168365086 CTGAGAGCCCTGAGAAAGGGCGG - Intergenic
1019375391 7:688628-688650 GAGGGAGCCCTGAGACATTGAGG - Intronic
1019913418 7:4115605-4115627 CTGGGAGCCCCAAGGAAAGGAGG - Intronic
1020021419 7:4871753-4871775 GTTGGTGCCCTGAGGAGAGGAGG - Intronic
1020765056 7:12308953-12308975 GAGGGAGGCCTGAGAAAAGGAGG + Intergenic
1021653701 7:22854506-22854528 GTGGGATCCTCGAGGAAAGGGGG - Intergenic
1022188727 7:27996413-27996435 GTGGGAGGCCTGAGAGGATGTGG + Intronic
1022195478 7:28062492-28062514 GTGGGAGGCCTGTGGAAAGGTGG - Intronic
1025150466 7:56542732-56542754 GTGGGAACCCAGAGAAACGGTGG - Intergenic
1025775629 7:64558381-64558403 GTGGCAGCTGTGGGAAAAGGGGG + Intronic
1026848530 7:73710931-73710953 GAGGGAGGGCTGAGAAAAAGTGG + Intronic
1026991161 7:74586606-74586628 GTTGGAGCCCTGGGAAAAGGAGG + Intronic
1029372774 7:100159782-100159804 CTGGGAGCCCAGCGAAGAGGGGG + Exonic
1029617480 7:101668215-101668237 GTGGAAGCACTGGGACAAGGGGG - Intergenic
1030319085 7:108145552-108145574 GCGGGATTCCTGAAAAAAGGTGG + Intergenic
1034467494 7:151238486-151238508 GGTGGAGCCCTGAGAACCGGAGG - Exonic
1034501360 7:151452975-151452997 GTGGGGGCCCTGAGCTAAGCTGG - Intergenic
1034540671 7:151756068-151756090 GGGAGAGGCCTGAGAAGAGGAGG - Intronic
1034984041 7:155496580-155496602 GTGGTAGCCATGAGGGAAGGAGG - Intronic
1035058342 7:156051527-156051549 GCAGCAGCCCTGAGAAGAGGGGG - Intergenic
1035319500 7:158019721-158019743 GTGGGGTCCCTGAGACCAGGTGG - Intronic
1035824101 8:2626572-2626594 TGGGGATCCCTGAGAAAAAGAGG + Intergenic
1036168591 8:6460897-6460919 CTGTGAGCCCTCAGAAAAGCTGG - Intronic
1037802438 8:22043021-22043043 GTGGGAGTCCCGGGAAGAGGAGG - Intronic
1037829367 8:22178875-22178897 GTAGAAGCACTGAGAAGAGGGGG - Intronic
1037917525 8:22781609-22781631 GTGGGAGGCCTGGGTACAGGGGG - Intronic
1039599264 8:38820467-38820489 GTAGGAGCCCTCAGAAGAGAGGG - Exonic
1042389627 8:68218483-68218505 GTGGTAGCCCAAAGAAAAGGTGG - Intronic
1042514017 8:69641142-69641164 TTGGGAGCCCCGGGAAAGGGTGG + Intronic
1043006392 8:74824304-74824326 GTGGAAGCCCAGAGAAAAAGGGG + Intergenic
1045459654 8:102414467-102414489 CTGGGAGCCCTGAGGAAGGAAGG + Intergenic
1047211252 8:122842266-122842288 CTGGGGGCCCTGAGAGAAGAAGG - Intronic
1047220855 8:122917106-122917128 CTGGGAGCCCTGAGAAACGCAGG - Intronic
1047252408 8:123190913-123190935 CTGGGACTCCTGGGAAAAGGAGG - Intronic
1047527147 8:125643330-125643352 GTGGGGGAACTGAGAAATGGAGG - Intergenic
1048127130 8:131648365-131648387 TGTGGAGCCCTGAGATAAGGAGG - Intergenic
1048199469 8:132359860-132359882 GTGAGAGCCAGGAGAAAAGTTGG - Intronic
1048254977 8:132898740-132898762 GTGGGAGCCAAGAGAAAGAGGGG - Intronic
1048593769 8:135845429-135845451 GTCAGAGGCCTGAGAAGAGGAGG + Intergenic
1048599311 8:135902201-135902223 GAGGGAGCCTTGAGAACAAGTGG - Intergenic
1049643331 8:143725215-143725237 GGGGAGGCCCTGAGAACAGGAGG + Exonic
1051192011 9:14523137-14523159 ATGAGAGCCCTGAGGAAAAGTGG + Intergenic
1057208008 9:93184769-93184791 CTGGGGGCCCTGGGAAAGGGGGG - Intergenic
1057259467 9:93576106-93576128 GTGGGACCCCGGGGAGAAGGTGG - Intergenic
1057786188 9:98089139-98089161 GTGGGAGACAGGAGAAAAAGGGG - Intronic
1058124047 9:101171289-101171311 GTGGGAGCCCTGAGGAAACCTGG + Intronic
1058969901 9:110071466-110071488 CTGGGAGCCATGAGTAGAGGTGG - Intronic
1059593594 9:115691981-115692003 GTGGGCTCCCTGAGGGAAGGAGG + Intergenic
1060224297 9:121781944-121781966 GGTGCAGCCCTGAGTAAAGGAGG - Intronic
1060571284 9:124642801-124642823 GTGGAAGCCATGAGAGAGGGAGG + Intronic
1060911206 9:127352540-127352562 GTGGGAGCCCAGGGTAGAGGAGG + Intronic
1061099114 9:128478770-128478792 GAGGGAGCCCTGAGCACAGATGG - Intronic
1061245500 9:129399423-129399445 CTGGGGACCCTGAGAGAAGGAGG - Intergenic
1061884965 9:133586791-133586813 GTGGCAGTCCTGAGAAAGGCAGG - Intergenic
1062407158 9:136402325-136402347 GAGGGAGCCCTGAGCATCGGCGG + Exonic
1187229154 X:17404302-17404324 GAGTGGGCCCTCAGAAAAGGTGG + Intronic
1187319867 X:18229239-18229261 GAGCCAGCCCTGAGAACAGGCGG + Intergenic
1187358967 X:18606597-18606619 GTGGGAGCTCCTAGAACAGGTGG + Intronic
1187942089 X:24392180-24392202 GTGTGAGCCCTGAGGGAAAGGGG + Intergenic
1188839992 X:35005374-35005396 GTGGGAGAGATGAGAGAAGGAGG - Intergenic
1190062986 X:47222853-47222875 CTGGCAGCCCTGAGAAGAGCTGG + Intronic
1190828870 X:54043166-54043188 GAGGGAGCCCTGTGAAACAGGGG - Intronic
1192260283 X:69502139-69502161 GTGGGAGCACTGCCAAAATGAGG - Intergenic
1193845592 X:86466467-86466489 GTGGGAGACCTGAGATTCGGAGG - Intronic
1196483253 X:116175838-116175860 TTGGGTGACTTGAGAAAAGGTGG - Intergenic
1197712370 X:129680534-129680556 TTGGGAGCCATGAGGATAGGGGG + Intergenic
1199785352 X:151100347-151100369 GTGGGAGACCTGGGATAGGGTGG - Intergenic
1200240222 X:154489451-154489473 GTGGGAGCTCTGACAAAAGGAGG - Intronic
1202115461 Y:21466634-21466656 GTGGGAGCCGTGAGAGCACGTGG - Intergenic