ID: 1143674652

View in Genome Browser
Species Human (GRCh38)
Location 17:8423027-8423049
Sequence CTGCTTCGAAATTACAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143674652_1143674656 7 Left 1143674652 17:8423027-8423049 CCCTCCTTGTAATTTCGAAGCAG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1143674656 17:8423057-8423079 GATTTGTGTTGTATCTCATAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1143674652_1143674655 6 Left 1143674652 17:8423027-8423049 CCCTCCTTGTAATTTCGAAGCAG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1143674655 17:8423056-8423078 AGATTTGTGTTGTATCTCATAGG 0: 1
1: 0
2: 0
3: 24
4: 245
1143674652_1143674657 11 Left 1143674652 17:8423027-8423049 CCCTCCTTGTAATTTCGAAGCAG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1143674657 17:8423061-8423083 TGTGTTGTATCTCATAGGGATGG 0: 1
1: 0
2: 1
3: 23
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143674652 Original CRISPR CTGCTTCGAAATTACAAGGA GGG (reversed) Intronic
906269348 1:44462726-44462748 CAGCTTAGAAAATACAAGAAAGG + Intronic
908640569 1:66218409-66218431 CTGTTTGGAAAGTACAAAGAAGG + Intronic
912036391 1:105322259-105322281 TTGCTTTGAAATTACCATGAGGG + Intergenic
912641695 1:111352293-111352315 CTTCTTCGTAATTACCAGAAAGG + Exonic
913102074 1:115577589-115577611 CTGGTTGGAAATGACAGGGACGG - Intergenic
913529513 1:119723742-119723764 CTGCCTGGAGATAACAAGGAAGG + Intronic
915105914 1:153535148-153535170 CTGCTTCCAAAGGACAAGGGTGG + Intronic
916554724 1:165884338-165884360 CTGCTTCAGAATCACAGGGAGGG - Intronic
918594428 1:186276652-186276674 CTACTTCAAAGTCACAAGGATGG + Intergenic
919110369 1:193211343-193211365 CTTCTTCGCAGTTACACGGATGG + Intronic
1063917483 10:10898154-10898176 CTGCTTCCAAAATACAATGGTGG - Intergenic
1065117252 10:22495051-22495073 CTTCTTGGAGATTCCAAGGAGGG + Intergenic
1066454332 10:35560046-35560068 CTGCTTCTAAAATACAATGGTGG - Intronic
1067383057 10:45793123-45793145 CTGCTTCCACAAGACAAGGATGG - Intergenic
1067837206 10:49648976-49648998 CTGCTTCCAAATCCCAAGGCTGG + Intronic
1067890764 10:50133670-50133692 CTGCTTCCACAAGACAAGGATGG - Intergenic
1072058180 10:91781677-91781699 CTGCTTCCAAAATACACTGATGG + Intergenic
1074375581 10:112938581-112938603 CTGCTTTGCAATGAAAAGGAAGG - Intergenic
1074876161 10:117614925-117614947 CTGCTTTCAAGTTACAAGGGCGG + Intergenic
1075881382 10:125854923-125854945 TTGTTTAGAAATTAAAAGGAAGG + Intronic
1078480941 11:11674742-11674764 CTGCTTGGAATGTGCAAGGATGG + Intergenic
1079461288 11:20680523-20680545 CTGCTTCCAAAATACAATGGCGG + Intronic
1081821760 11:46004044-46004066 CTGCTTCAAAATTACAGAGTTGG + Intronic
1088252323 11:107871631-107871653 CTGCTTCCAAAATACAATGATGG - Intronic
1090392489 11:126398209-126398231 CTGCTTCCAAAGTACAGTGATGG + Intronic
1091347395 11:134864508-134864530 CTGCTTGGAAAGAGCAAGGAGGG - Intergenic
1094422407 12:30284615-30284637 TTGCTTCAAAATAACAAGGGAGG - Intergenic
1095887622 12:47205583-47205605 CAGCTTGGAAATTAGAAGCAAGG + Intronic
1096045541 12:48558990-48559012 CAGCTTAGAAATTAAAAAGATGG - Intergenic
1096317479 12:50580945-50580967 GAGCTACCAAATTACAAGGAAGG - Intronic
1097765180 12:63518248-63518270 CTGCTAAGAGATTACAAGGCAGG + Intergenic
1102790962 12:115644854-115644876 CTGCTTCCATACTACAATGATGG + Intergenic
1105264800 13:18806244-18806266 CTGCTTCTAAGGTACAATGATGG + Intergenic
1106559723 13:30837825-30837847 CTGCTTAGATATGACATGGAAGG + Intergenic
1108235788 13:48403640-48403662 ATGCATCAAAATTACCAGGAGGG + Intronic
1109848904 13:68035055-68035077 CTGCTTATAAAATACAATGATGG + Intergenic
1112683868 13:101799882-101799904 TTTCATGGAAATTACAAGGAGGG + Intronic
1112884075 13:104147418-104147440 GTGCTTCCAAAATACAATGATGG + Intergenic
1112996193 13:105577787-105577809 GTGCTTCCAAAATACAATGATGG + Intergenic
1116115378 14:40642393-40642415 GTGCTTGGAAATTAAAGGGAGGG - Intergenic
1118036327 14:61872008-61872030 CTGCTACAATATTGCAAGGAAGG - Intergenic
1120507969 14:85376637-85376659 CTGCTTCTGATGTACAAGGAGGG - Intergenic
1123098540 14:105777934-105777956 CTGCTTCCAAAGTACAATGATGG + Intergenic
1123107397 14:105848921-105848943 CTGCTTCCAAAGTACAATGATGG - Intergenic
1123142667 14:106095820-106095842 CTGCTTCTAGATTTCAGGGAGGG + Intergenic
1129802603 15:78427402-78427424 CTGCTTCTACCTTACAAGGAAGG - Intergenic
1133663877 16:7946216-7946238 CAGCTTTGAAAATATAAGGAAGG - Intergenic
1134283532 16:12839354-12839376 CTGCTTCCAAAATGCAATGATGG - Intergenic
1135923300 16:26670424-26670446 CTGCTTCCAAAATACAATGGTGG + Intergenic
1137634799 16:49976665-49976687 TTAATTCGAAATTGCAAGGAAGG - Intergenic
1143674652 17:8423027-8423049 CTGCTTCGAAATTACAAGGAGGG - Intronic
1153733004 18:8034480-8034502 CTGCTTCTAAAATACAGTGATGG + Intronic
1154423597 18:14255310-14255332 CTGCTTCTAAGGTACAATGATGG - Intergenic
1155449564 18:25949653-25949675 CTGCCTTGAATTTCCAAGGAAGG + Intergenic
1156708482 18:39912706-39912728 GAGCTTCAAAAGTACAAGGATGG - Intergenic
1156867419 18:41904312-41904334 GTGCTTCCAAAATACAAAGACGG - Intergenic
1160446674 18:78933508-78933530 CTGCTCCGAAATGAAACGGAGGG + Intergenic
1161800219 19:6413287-6413309 CCGCTTCAAAACTACAGGGAGGG + Intergenic
1161926747 19:7306402-7306424 CTGCTTCACAATAAAAAGGAAGG + Intergenic
1162945880 19:14043211-14043233 TTGCTTCGAAGATTCAAGGATGG + Intronic
1163895951 19:20059409-20059431 CTGCTTCGGATTTACAAATAAGG - Intergenic
1164445476 19:28314056-28314078 CTGCTTCGAATTTACATGGCAGG + Intergenic
1167838858 19:52097379-52097401 CTGCTTCCAAAATACAATGGTGG - Intergenic
925016719 2:533327-533349 GTGCTTCCAAAATACAATGATGG + Intergenic
925301913 2:2823015-2823037 GTGCTTCCAAAATACAATGATGG + Intergenic
925719272 2:6812035-6812057 CTGCCTGAAAATGACAAGGAGGG + Intergenic
926530604 2:14040266-14040288 TTGCTTCCAAATGACAAGGGTGG + Intergenic
927260312 2:21081623-21081645 ATGCTTCCAAATTACAATGGTGG - Intergenic
927489128 2:23509046-23509068 CTGCTTGGAAGTGCCAAGGATGG + Intronic
929198641 2:39212173-39212195 ATGCATCAAAATCACAAGGAGGG - Intronic
930375233 2:50557257-50557279 CAGCTTGGAAATTACAATGGGGG + Intronic
934878062 2:97944766-97944788 CTGCTTCAAAAACAAAAGGATGG + Intronic
940372518 2:152918702-152918724 GTGCTTCCAAAATACAATGATGG - Intergenic
948238007 2:236404726-236404748 CTGCTTTGAAATTATATGAATGG + Intronic
1171132363 20:22665527-22665549 CTGCTTCTAAAATACAATAATGG + Intergenic
1172052077 20:32125558-32125580 ATGCATGGAAATTACCAGGAGGG - Intronic
1176849878 21:13904697-13904719 CTGCTTCTAAGGTACAATGATGG + Intergenic
1177128646 21:17229064-17229086 CTGCTTCCAAAATACAAAGGTGG + Intergenic
1177301677 21:19253846-19253868 CTTCTTTCAAATAACAAGGATGG - Intergenic
1179560623 21:42213838-42213860 GTGCTTCCAAAATGCAAGGATGG - Intronic
1184919042 22:47592827-47592849 CTGCTTCTGAAGTTCAAGGAAGG + Intergenic
949093853 3:62432-62454 CTGCCTCCAAAATACAATGATGG - Intergenic
949140532 3:627759-627781 CTACTTCCAAATTACAGTGATGG + Intergenic
950200365 3:11037973-11037995 CCGCTGAGAAATTTCAAGGAAGG - Exonic
950746796 3:15097212-15097234 CTGCTTCAAAAATAAAAGGCTGG + Intronic
953196512 3:40739252-40739274 CTCCCTGGAACTTACAAGGAAGG + Intergenic
954936559 3:54332418-54332440 CTGCTTAAAAATTGCAAGGGTGG - Intronic
955721496 3:61886167-61886189 CTGATTTGAAATTGGAAGGAAGG - Intronic
956460459 3:69466516-69466538 GTGCTTCAAAATAATAAGGAGGG + Intronic
957375494 3:79351820-79351842 CTTCTGGGAAATTAAAAGGAGGG + Intronic
957505659 3:81116950-81116972 ATGCTCCCAAATTACAATGATGG - Intergenic
960375226 3:116892729-116892751 CTGCTTCCAAAATACAACGTTGG + Intronic
960479440 3:118170990-118171012 GTGCTTCCAAAATACAATGACGG - Intergenic
965699473 3:171445064-171445086 ATGCTTCTGAATTACTAGGAGGG + Intronic
967076846 3:186011118-186011140 CTGCTTCCAAAATACAATGATGG - Intergenic
968032498 3:195512370-195512392 CTGCTTTGCAAGAACAAGGAAGG - Intergenic
968426592 4:527684-527706 CTCGTTATAAATTACAAGGACGG - Intronic
970947541 4:21712832-21712854 ATGCTTAGAAATAAAAAGGAGGG - Intronic
973086273 4:46065385-46065407 CTGCTTCGAATTTGGAATGATGG - Exonic
973369261 4:49232251-49232273 CTGCTTCTAAGGTACAATGATGG + Intergenic
973391777 4:49563165-49563187 CTGCTTCTAAGGTACAATGATGG - Intergenic
976428350 4:84932299-84932321 CTGCTTAGAAATGATAAGAATGG + Exonic
978367465 4:107997289-107997311 GTGCCTAGACATTACAAGGAGGG - Intronic
980340859 4:131545100-131545122 CAGCTTCAAAATTAAAAGGATGG - Intergenic
982331629 4:154187380-154187402 GTGCTTCCAAAATACAATGATGG - Intergenic
982948190 4:161653447-161653469 CTGCTCCCTAACTACAAGGAGGG + Intronic
984462448 4:180055520-180055542 CTGGTTGCAAATTACAAGTAGGG + Intergenic
984715497 4:182920820-182920842 CATCTTCAAAATTACAATGAAGG + Intergenic
987737885 5:21868679-21868701 CTGCTTCCAAAATACAATGGTGG - Intronic
989457078 5:41656825-41656847 CTGCTCAGTAATTACAAGGTGGG + Intergenic
991132270 5:63136316-63136338 CTGCTTCCAAAATACAATAATGG - Intergenic
991220908 5:64215056-64215078 CTCCTACGAAATTACAATAAGGG - Intronic
991357022 5:65779139-65779161 GTGCATCAAAATTACACGGAGGG + Intronic
992415618 5:76550146-76550168 TTGCTTCCAAAATACAATGATGG + Intronic
992775458 5:80085034-80085056 CAGCTTCAAAAATATAAGGAGGG - Intergenic
995368758 5:111394301-111394323 GTGCTTCAAAATAATAAGGAAGG + Intronic
995494161 5:112723887-112723909 CTGCTTCTAAACTACTGGGAGGG + Intronic
995907607 5:117144377-117144399 CAGCTTGGAAATTAAAAGAAGGG + Intergenic
996264988 5:121528970-121528992 CTTCTTAGAATTTATAAGGAAGG + Intergenic
1005713388 6:28523849-28523871 ATGCTTTGAAACTACAAGAAAGG - Intronic
1008667667 6:53732280-53732302 CTGCATTGAAATAGCAAGGAAGG - Intergenic
1009248460 6:61269836-61269858 CTGTTTCAAAATTCCAAGGCAGG + Intergenic
1011880728 6:92022158-92022180 CTGCCTTGACATTACAAGGATGG + Intergenic
1012521489 6:100126536-100126558 CTGCTTCCAAATTATAAGGAAGG - Intergenic
1014576833 6:123083499-123083521 CAGCTACTAAATGACAAGGACGG - Intergenic
1015866181 6:137729159-137729181 TTGCTTCATAATTACAAGGTAGG + Intergenic
1017869312 6:158473337-158473359 CTGCTTACAAAATACAAGGATGG + Intronic
1018037790 6:159896593-159896615 CTGCTTTAAAATTAGAAGAAAGG + Intergenic
1020451258 7:8322976-8322998 CTGCTTTAACCTTACAAGGAAGG + Intergenic
1021662360 7:22932507-22932529 CTGCTTCCAAAATACAATGGTGG - Intergenic
1023340422 7:39213718-39213740 CTGCTTGGAAATTAACAGAAAGG - Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG + Intergenic
1024431617 7:49294890-49294912 CTGCTTCCAAAATACAATGGTGG + Intergenic
1024489794 7:49967326-49967348 CTGCTTCCAAATTAAAAGATTGG - Intronic
1025056696 7:55771020-55771042 CTTCTTTGAAATTACAGGGCAGG + Intergenic
1026120423 7:67532069-67532091 CTGCTTCCAAAATACAATGGTGG + Intergenic
1029958214 7:104661721-104661743 CTTCTTCGCAATTTCATGGATGG + Intronic
1031095649 7:117416393-117416415 TTGCTTAGAAATTAAAAGAAAGG - Intronic
1031728649 7:125269262-125269284 CTGCTCCTAAAATACAATGATGG + Intergenic
1032297030 7:130648579-130648601 CTGCTCCCAAAATACAAGGACGG + Intronic
1037219974 8:16506979-16507001 CTGCTTAGCAATGAAAAGGAAGG + Intronic
1042655152 8:71087705-71087727 GTGCATCGAGATTCCAAGGAAGG + Intergenic
1042804799 8:72759650-72759672 CTGCTTCCAAAGTACAGGAATGG - Intronic
1045844504 8:106617485-106617507 CTGCTTAGTAATTAAAAGAATGG - Intronic
1047261992 8:123272147-123272169 CTCTTTCGAAAATACAAGAATGG + Intronic
1051323228 9:15933933-15933955 CTTCTTCAAAATTAAAAGCATGG + Intronic
1051572946 9:18581659-18581681 CTGCTTCCAAAATACAATGGTGG + Intronic
1052199135 9:25756783-25756805 GTGCTTCCAAAATACAATGATGG - Intergenic
1053525125 9:38822045-38822067 CAACTTCTAAATTACAAGGGGGG - Intergenic
1054197356 9:62046467-62046489 CAACTTCTAAATTACAAGGGGGG - Intergenic
1054641054 9:67542215-67542237 CAACTTCTAAATTACAAGGGGGG + Intergenic
1055268354 9:74525948-74525970 CTAGTTAGAAAATACAAGGATGG + Intronic
1056194078 9:84212584-84212606 CTGATTCCACATTACTAGGAAGG + Intergenic
1056281577 9:85046088-85046110 CTACTTCCAAAATACAATGATGG - Intergenic
1057073295 9:92119103-92119125 CTGCTTCGAAAACACAAAGGTGG + Intergenic
1057161604 9:92892615-92892637 CTGCTTCTAAGGTACAATGATGG + Intergenic
1057677988 9:97150817-97150839 CTGCTTCTAAGGTACAATGATGG + Intergenic
1057690490 9:97279408-97279430 CTGCTTGGAAATTGAAAGCAGGG - Intergenic
1059006416 9:110407631-110407653 CTGCTCCCAAATGATAAGGAGGG + Exonic
1059808503 9:117830147-117830169 CTTGTCCAAAATTACAAGGATGG + Intergenic
1061633117 9:131886152-131886174 GTGCTTGGAAATTAAAAGCAGGG + Intronic
1185927225 X:4161093-4161115 TTGATTCCAAATTTCAAGGAAGG - Intergenic
1190146352 X:47894840-47894862 CTGCTTCCAAAATACAATGGTGG - Intronic
1190240465 X:48654283-48654305 TTGCTTCCAAAATACAATGATGG + Intergenic
1194106341 X:89771718-89771740 CTGCGTCCAAAATACAATGATGG - Intergenic
1194313660 X:92346177-92346199 CTACTTCAAAATGTCAAGGAAGG - Intronic
1194743363 X:97602430-97602452 CTGCTTTCAAATTACAATGGTGG + Exonic
1194890847 X:99376569-99376591 CTGCTTCCAAAATATAATGATGG + Intergenic
1195623835 X:106986952-106986974 CTGAATGGAAAATACAAGGAAGG - Intronic
1197058458 X:122148467-122148489 CTACTTCCAAAATACAATGATGG - Intergenic
1197658525 X:129144639-129144661 CTGGTTCAAGATTACAAGGAAGG + Intergenic
1198075987 X:133193393-133193415 CTGCCTCAAAATAACAAAGAAGG + Intergenic
1200621932 Y:5460295-5460317 CTACTTCAAAATGTCAAGGAAGG - Intronic