ID: 1143683187

View in Genome Browser
Species Human (GRCh38)
Location 17:8492775-8492797
Sequence GAAGCAGAAGAAGTTTGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 217}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143683187_1143683192 7 Left 1143683187 17:8492775-8492797 CCTGGTCAAACTTCTTCTGCTTC 0: 2
1: 0
2: 1
3: 14
4: 217
Right 1143683192 17:8492805-8492827 AGTTGGAGGCGACCTGGCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 119
1143683187_1143683190 1 Left 1143683187 17:8492775-8492797 CCTGGTCAAACTTCTTCTGCTTC 0: 2
1: 0
2: 1
3: 14
4: 217
Right 1143683190 17:8492799-8492821 TCTCCAAGTTGGAGGCGACCTGG 0: 1
1: 0
2: 0
3: 8
4: 96
1143683187_1143683196 28 Left 1143683187 17:8492775-8492797 CCTGGTCAAACTTCTTCTGCTTC 0: 2
1: 0
2: 1
3: 14
4: 217
Right 1143683196 17:8492826-8492848 GGTGGTCCAGGTCCACCGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 103
1143683187_1143683194 16 Left 1143683187 17:8492775-8492797 CCTGGTCAAACTTCTTCTGCTTC 0: 2
1: 0
2: 1
3: 14
4: 217
Right 1143683194 17:8492814-8492836 CGACCTGGCGCTGGTGGTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 146
1143683187_1143683189 -7 Left 1143683187 17:8492775-8492797 CCTGGTCAAACTTCTTCTGCTTC 0: 2
1: 0
2: 1
3: 14
4: 217
Right 1143683189 17:8492791-8492813 CTGCTTCTTCTCCAAGTTGGAGG 0: 1
1: 0
2: 1
3: 25
4: 273
1143683187_1143683188 -10 Left 1143683187 17:8492775-8492797 CCTGGTCAAACTTCTTCTGCTTC 0: 2
1: 0
2: 1
3: 14
4: 217
Right 1143683188 17:8492788-8492810 CTTCTGCTTCTTCTCCAAGTTGG 0: 1
1: 0
2: 3
3: 26
4: 337
1143683187_1143683193 10 Left 1143683187 17:8492775-8492797 CCTGGTCAAACTTCTTCTGCTTC 0: 2
1: 0
2: 1
3: 14
4: 217
Right 1143683193 17:8492808-8492830 TGGAGGCGACCTGGCGCTGGTGG 0: 1
1: 0
2: 0
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143683187 Original CRISPR GAAGCAGAAGAAGTTTGACC AGG (reversed) Exonic