ID: 1143683191

View in Genome Browser
Species Human (GRCh38)
Location 17:8492802-8492824
Sequence GCGCCAGGTCGCCTCCAACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143683191_1143683200 22 Left 1143683191 17:8492802-8492824 CCAAGTTGGAGGCGACCTGGCGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1143683200 17:8492847-8492869 GGTCGTCCAGCTCCTGCTGCAGG 0: 1
1: 0
2: 3
3: 25
4: 241
1143683191_1143683196 1 Left 1143683191 17:8492802-8492824 CCAAGTTGGAGGCGACCTGGCGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1143683196 17:8492826-8492848 GGTGGTCCAGGTCCACCGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 103
1143683191_1143683201 25 Left 1143683191 17:8492802-8492824 CCAAGTTGGAGGCGACCTGGCGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1143683201 17:8492850-8492872 CGTCCAGCTCCTGCTGCAGGCGG 0: 1
1: 1
2: 4
3: 46
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143683191 Original CRISPR GCGCCAGGTCGCCTCCAACT TGG (reversed) Exonic