ID: 1143683196

View in Genome Browser
Species Human (GRCh38)
Location 17:8492826-8492848
Sequence GGTGGTCCAGGTCCACCGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143683191_1143683196 1 Left 1143683191 17:8492802-8492824 CCAAGTTGGAGGCGACCTGGCGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1143683196 17:8492826-8492848 GGTGGTCCAGGTCCACCGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 103
1143683187_1143683196 28 Left 1143683187 17:8492775-8492797 CCTGGTCAAACTTCTTCTGCTTC 0: 2
1: 0
2: 1
3: 14
4: 217
Right 1143683196 17:8492826-8492848 GGTGGTCCAGGTCCACCGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143683196 Original CRISPR GGTGGTCCAGGTCCACCGTG AGG Exonic