ID: 1143684366

View in Genome Browser
Species Human (GRCh38)
Location 17:8502340-8502362
Sequence GGCTGAGCCAGTGGAACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143684366_1143684371 -3 Left 1143684366 17:8502340-8502362 CCCCAAGTTCCACTGGCTCAGCC 0: 1
1: 0
2: 2
3: 16
4: 266
Right 1143684371 17:8502360-8502382 GCCAGAGGTCAAAGACGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 139
1143684366_1143684373 2 Left 1143684366 17:8502340-8502362 CCCCAAGTTCCACTGGCTCAGCC 0: 1
1: 0
2: 2
3: 16
4: 266
Right 1143684373 17:8502365-8502387 AGGTCAAAGACGTGCTGGTCTGG 0: 1
1: 0
2: 1
3: 3
4: 86
1143684366_1143684374 19 Left 1143684366 17:8502340-8502362 CCCCAAGTTCCACTGGCTCAGCC 0: 1
1: 0
2: 2
3: 16
4: 266
Right 1143684374 17:8502382-8502404 GTCTGGTCCTGTCCTCTGCAAGG 0: 1
1: 0
2: 0
3: 35
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143684366 Original CRISPR GGCTGAGCCAGTGGAACTTG GGG (reversed) Intronic
900344798 1:2205447-2205469 GGCTGGGCCTGTGGACCTGGAGG - Intronic
902996642 1:20230525-20230547 GGCCCAGCCAGTGGCACTTCAGG + Intergenic
904255935 1:29255005-29255027 GACTGAGCCAGTGGTGGTTGGGG + Intronic
905086798 1:35387079-35387101 GGCTGACACTGTGGAACCTGTGG - Exonic
905383808 1:37584845-37584867 GGCTGAGGCAGTGGATCATAAGG + Intronic
906288571 1:44604342-44604364 GGCTGGGCCAGTGGAGGGTGGGG - Intronic
908202870 1:61815615-61815637 GGCTGAGGCAGAGGATCTCGAGG + Intronic
910488876 1:87746187-87746209 TCCTCTGCCAGTGGAACTTGGGG - Intergenic
912043834 1:105427861-105427883 GGCTGGGTCAGTGAAAATTGAGG + Intergenic
913014231 1:114716657-114716679 AGCAGAGGCAGTGGAGCTTGAGG - Exonic
913026636 1:114849779-114849801 AGCAGAGCCAGTGGGATTTGTGG - Intergenic
915468537 1:156112536-156112558 GGGTAAGCCAGTGAAACGTGAGG - Intronic
915562024 1:156693070-156693092 GGCTGGGCCAGTCGCACCTGAGG - Intergenic
920758806 1:208761801-208761823 GGATGAGCCAGTACAACTTAAGG + Intergenic
921022481 1:211248868-211248890 GGCTCACACAGTGGAACTTCGGG + Intergenic
922095657 1:222440880-222440902 GGGTGAGCAGGTGGAACTGGGGG - Intergenic
922535837 1:226379985-226380007 GGCAGAGCCTGTTGAAGTTGTGG - Exonic
923202460 1:231725492-231725514 GGGTGAGCTAGTGCAAATTGAGG - Intronic
923242896 1:232102888-232102910 GGCTGAGGCAGTGGATCACGAGG - Intergenic
923466835 1:234255777-234255799 GGATGAATCAGTGGAGCTTGGGG + Intronic
924552440 1:245091067-245091089 GGCCGAGCCAGTGGCACATCAGG - Intronic
1063324826 10:5087606-5087628 GGCTGAGGCAGGGTCACTTGAGG - Intronic
1063681549 10:8192819-8192841 GCCTGAGCCAGGGGAGGTTGAGG - Intergenic
1065056038 10:21843625-21843647 GGCTGAGGCAGTGGATCACGAGG - Intronic
1065615789 10:27521666-27521688 GAATGATACAGTGGAACTTGGGG + Intronic
1066183680 10:32987973-32987995 GGCTGAGCCAGAGAGACTTGAGG - Intronic
1066396840 10:35033634-35033656 GGCTGAGGCAGGGGAACTGCTGG + Intronic
1068104101 10:52592099-52592121 CTCTGAACCAGTGGAATTTGGGG - Intergenic
1070404348 10:76081367-76081389 GGCTGAGCCTGGGGAGGTTGAGG + Intronic
1070592303 10:77809863-77809885 CGCCGAGCCAGTAGAACTAGAGG - Intronic
1072142798 10:92604633-92604655 GGCTGTGCCAGGGGAAGTTGAGG + Intronic
1075039607 10:119097478-119097500 GGCTGAGGCAGTGGATCACGAGG + Intergenic
1075141663 10:119842852-119842874 GGCTGAGGCAGGAGAACTGGAGG - Intronic
1075760150 10:124849440-124849462 GACTGAGCAAGTGGAAGGTGTGG - Intergenic
1075829525 10:125394459-125394481 GGCTGAGGGAGTGGATCATGAGG + Intergenic
1077181970 11:1220803-1220825 GCCTGGGCCAGTGGGCCTTGAGG - Intergenic
1078251537 11:9620591-9620613 ACCTGAGCCAGGGGAAGTTGAGG - Intergenic
1078600574 11:12726752-12726774 GGCTGAGCCTGGGGAGGTTGAGG + Intronic
1079360124 11:19763666-19763688 AGCTGAGACAGTGGCATTTGGGG - Intronic
1080918552 11:36685430-36685452 GGCTGGGTCTGTGTAACTTGGGG + Intergenic
1084556526 11:69879308-69879330 GGCTGGGCCAGTGGCAGTGGCGG + Intergenic
1085405237 11:76257620-76257642 GGCTGAGGCTGTGGAAGCTGGGG - Intergenic
1085532113 11:77198079-77198101 GGCTGAGCCAGTGGCCTGTGTGG - Intronic
1086989025 11:93282404-93282426 GCCTTAGCCAGTGAAACATGTGG + Intergenic
1089286206 11:117409643-117409665 GGCTAAGCCCGTGGATCTTGCGG - Exonic
1089467184 11:118692861-118692883 GGCTGTGGCAGTGGAACTCCTGG - Intergenic
1089532230 11:119137698-119137720 GCCTGAGCCTGGGGAAGTTGAGG + Intergenic
1089534308 11:119151096-119151118 GGCTGAACCAATGGAAACTGAGG + Intronic
1089749533 11:120640807-120640829 GGCTGAGGCAGGGGAACTGCTGG - Intronic
1091262185 11:134243462-134243484 GGCTGAGTGTGTAGAACTTGAGG + Intronic
1091403719 12:196325-196347 GGATGAGCCAGGGGAAGTGGAGG - Intronic
1091514720 12:1167815-1167837 GGCTGAGGCAGGGGAACTGCTGG - Intronic
1091972336 12:4797802-4797824 AGGTGAGCCAGTGGACCTAGCGG + Intronic
1093213675 12:16337441-16337463 GGCAGAGCCAGTGAGACTTCAGG - Intergenic
1096231362 12:49898607-49898629 GCCTGAGCCAGGGGAAGTCGAGG - Intronic
1097922100 12:65086906-65086928 GGCTGAGGCAGTGGATCATGAGG + Intronic
1098757725 12:74387439-74387461 TGCTCTGCCAGTGGAGCTTGGGG + Intergenic
1101172278 12:102110422-102110444 GGCTGAGCCAAGGGAGGTTGAGG + Intronic
1101909430 12:108850558-108850580 AGCTGAGGGAGGGGAACTTGGGG + Intronic
1101990179 12:109477705-109477727 GGCTGAGACAGTGGCAGCTGCGG + Exonic
1103478424 12:121235225-121235247 GGCTGAGGCGGTGGATCATGAGG - Intergenic
1103734477 12:123050575-123050597 GGCAGAGCCAGAGGACCTAGAGG + Intronic
1104404703 12:128507840-128507862 GGCTGAGGCATGGGAACCTGAGG + Intronic
1104769486 12:131352211-131352233 GGCTGAGCCACTGGCCCTGGAGG + Intergenic
1106654807 13:31731968-31731990 TGCTGAGCCTGAGAAACTTGAGG - Intergenic
1107482905 13:40799850-40799872 GTCTGAGCCAGATGAACTTGAGG + Intronic
1108461161 13:50668735-50668757 GGCTGAGCCAGTGTCATCTGTGG + Intronic
1109182743 13:59233306-59233328 GCCTGAGCCAGTGGGAAATGCGG - Intergenic
1110321437 13:74164754-74164776 GGATCATCCAGTGGAACTGGAGG + Intergenic
1111154632 13:84306759-84306781 AGCTGAGAAATTGGAACTTGGGG - Intergenic
1112384600 13:98927362-98927384 AGCTGTGCCAGTGGACCTAGGGG - Intronic
1112392206 13:98995837-98995859 GGCTGAGTTAGTGCAAATTGAGG + Intronic
1114480751 14:23032830-23032852 GGCTGAGACAGTGGATCACGAGG - Intronic
1114657927 14:24327212-24327234 GACTGAGCCCCTGGAACTTCAGG + Intronic
1115032736 14:28816155-28816177 GGCTGAGGCAGGGGAACTGCTGG + Intergenic
1115379753 14:32722572-32722594 TGCTCTGCCAGTGGAGCTTGGGG - Intronic
1115859462 14:37667900-37667922 GGCTGAGCGGGTGGATCATGAGG + Intronic
1117055985 14:51912366-51912388 GGCTGAGCCACTGGAATTAAGGG - Intronic
1117838746 14:59835335-59835357 GGCAGGCCCAGTGAAACTTGTGG + Intronic
1118021829 14:61724774-61724796 GGCTGAGCCAGTAGAGTATGAGG - Intronic
1118857596 14:69636295-69636317 GTCTGAGCCACTGGAATTTCAGG - Intronic
1120385005 14:83833704-83833726 GGCTGAGGCAGTGGATCACGAGG - Intergenic
1121616228 14:95315517-95315539 GCCTGAGCCAGTGGAACAAAAGG + Intronic
1121979094 14:98438051-98438073 GGCTGAGGCAGGGGAATTGGAGG + Intergenic
1123828814 15:24111969-24111991 GGATGAGTCTCTGGAACTTGGGG - Intergenic
1123863441 15:24492073-24492095 GGATGAGTCTCTGGAACTTGGGG - Intergenic
1124967048 15:34441239-34441261 GGCTGAGGCAGTGGATCACGAGG - Intergenic
1125367244 15:38931523-38931545 GGCCGAGGCAGGCGAACTTGAGG - Intergenic
1125789978 15:42357838-42357860 GGCTGTGCCTGTGTAACTTTAGG - Intergenic
1127691145 15:61398887-61398909 GGCTTGGCCACTGGAACTTTTGG + Intergenic
1127919115 15:63479534-63479556 GTCAGAGACAGTAGAACTTGGGG - Intergenic
1129137046 15:73563562-73563584 GAGTGAACCACTGGAACTTGGGG - Intronic
1129463035 15:75709506-75709528 ATCTGGGCCAGTGGCACTTGCGG - Intronic
1130362009 15:83197932-83197954 GGCTGAGGCAGGAGAACCTGGGG + Intronic
1130577782 15:85107575-85107597 GGCTGACCCAGTGGAAGGAGAGG + Intronic
1132600320 16:770126-770148 GGCTGGGCCAGTGGGGCTGGTGG + Exonic
1133234790 16:4382731-4382753 GGCTGGGCCCCTGGAACTGGAGG + Exonic
1133275202 16:4634172-4634194 GGCTCAGCCAGGGAAACCTGGGG - Intronic
1133924246 16:10181106-10181128 CGCTGTGCCTGGGGAACTTGGGG + Intronic
1135134529 16:19877859-19877881 GGCTCAGCAAGTGGCACTTCTGG - Intronic
1136999416 16:35216243-35216265 GGCTGAGCCTCTGGGACTTCTGG + Intergenic
1137003539 16:35251763-35251785 GGCTGAGCCCCTGGGACTTCTGG - Intergenic
1137348365 16:47685973-47685995 GGCTGAGGCAGCGGATCATGAGG - Intronic
1137567239 16:49540974-49540996 GGCTCAGCCATGGGAAGTTGGGG - Intronic
1138413057 16:56854761-56854783 AGCTGACCCAATGGGACTTGGGG - Intergenic
1139394978 16:66631992-66632014 GGCTCAGCCAGTGGCCCCTGTGG + Intronic
1139563206 16:67756861-67756883 GGTTCAGCCAAGGGAACTTGGGG - Intronic
1141392705 16:83678062-83678084 GGCTAAGCCTGTGTAACTGGGGG - Intronic
1142304346 16:89277270-89277292 GGCTGAGCCAGAGGAAGGGGTGG - Intronic
1142614381 17:1126154-1126176 GGCTGAGCCAGTGCAGCGAGCGG + Intronic
1142707209 17:1703205-1703227 TGGTGAGCCAGTGAAACTTGAGG - Exonic
1142849864 17:2699407-2699429 GCCTGAGCCAGGGGAAGTCGAGG - Intronic
1143684366 17:8502340-8502362 GGCTGAGCCAGTGGAACTTGGGG - Intronic
1144479241 17:15615269-15615291 GGAAGACCCAGTGGAACTGGAGG - Intronic
1144617284 17:16788215-16788237 GGCTGACCCAGAGGAAGTGGGGG + Intronic
1144919061 17:18748463-18748485 GGAAGACCCAGTGGAACTGGAGG + Intronic
1145048941 17:19644215-19644237 GGCTGAGGCAGCGGATCATGAGG + Intergenic
1145136802 17:20416771-20416793 GGCTGACCCAGAGGAAGTCGGGG + Intergenic
1146591446 17:34131386-34131408 GGCCTAGGCAGTGGAGCTTGGGG - Intronic
1146632962 17:34483906-34483928 GTCAGAGCCAGAGGAACCTGAGG - Intergenic
1146970663 17:37069050-37069072 GGCAAAGCTAGAGGAACTTGTGG - Intergenic
1148046475 17:44748007-44748029 GGCTGTGCAAGTTGAGCTTGAGG - Intronic
1151684822 17:75640279-75640301 GGCTGAGCCCGTGGAGATCGTGG + Exonic
1152287616 17:79421923-79421945 TGCTGAGCCTGTGGAACATGGGG - Intronic
1152340033 17:79719239-79719261 GGCTGAGACAGTGGATCACGAGG + Intergenic
1152389485 17:79994189-79994211 GGCGGAGCCAGTGCATCTGGTGG - Intronic
1153217335 18:2832925-2832947 GGCCGAGGCAGTGGATCATGAGG + Intergenic
1153877167 18:9384300-9384322 GACTGAGACAGTTGAATTTGAGG + Intronic
1156773862 18:40763652-40763674 GACTGATCCAGTGGCAGTTGTGG + Intergenic
1157870951 18:51229729-51229751 AGCAGATCCAGTGGTACTTGAGG - Intergenic
1158406780 18:57166647-57166669 GGCTGAGTCAGAGGAGCTTGGGG + Intergenic
1159044020 18:63351675-63351697 GGGAGAGCCAGTGGTTCTTGAGG - Intronic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159708003 18:71717424-71717446 GGCTGAGCTTGGGCAACTTGTGG - Intergenic
1160463017 18:79053847-79053869 GGCTGAGCCATGGTAACTTCTGG - Intergenic
1160932279 19:1576451-1576473 GGCTGAGCCAGCGGCACCTCAGG + Intronic
1161273627 19:3403966-3403988 CGCTCAGCCAGTGGCACATGTGG + Intronic
1161278925 19:3434612-3434634 GGCTGAGCCGGCAGGACTTGAGG - Intronic
1161547839 19:4892868-4892890 GGCTGAGCGGGTGGATCATGAGG + Intronic
1163535147 19:17872571-17872593 GGCACATCCAGAGGAACTTGAGG - Exonic
1163813279 19:19447960-19447982 GGCTGAGCCAGGCGAAGCTGTGG - Intronic
1164162209 19:22634586-22634608 GGCTGGGCAAGGCGAACTTGGGG - Intronic
1165109327 19:33492680-33492702 GGCTGAGCTCCTGGAATTTGTGG - Intronic
1165226118 19:34356377-34356399 GGCTGAGACAGTAGATCATGAGG + Intergenic
1168311219 19:55461752-55461774 GGCAGAGGCAGTGGCACATGCGG - Intronic
925779905 2:7372687-7372709 GGCAGAGCCAGTGGGATTTAGGG - Intergenic
926150879 2:10425021-10425043 GGAGGAGCCAGTGGAACCTTCGG + Intronic
927192194 2:20524444-20524466 GGCTGAGGCAATGGCACTGGTGG + Intergenic
927433474 2:23047208-23047230 GGCAAAGCCAGGTGAACTTGGGG - Intergenic
928824588 2:35404690-35404712 GCCTGAGAAACTGGAACTTGTGG + Intergenic
931613979 2:64136668-64136690 GGCTGAGGCAGTGGATCACGAGG + Intronic
932739983 2:74283919-74283941 ACCTGAGCCAGGGGAAGTTGAGG - Intronic
932930350 2:76029062-76029084 GGCTGAGGCGGTGGATCATGAGG - Intergenic
936146119 2:109981563-109981585 GGCTGACCCAGGGGACCTTAGGG + Intergenic
936198571 2:110389916-110389938 GGCTGACCCAGGGGACCTTAGGG - Intergenic
938140087 2:128787868-128787890 GGCTGAGCCAGTGGGTCGGGAGG + Intergenic
938286443 2:130121338-130121360 GGCTAAGCGTCTGGAACTTGAGG + Intronic
938337081 2:130510045-130510067 GGCTAAGCGGCTGGAACTTGAGG + Intergenic
938352757 2:130610686-130610708 GGCTAAGCGGCTGGAACTTGAGG - Intergenic
938429157 2:131217528-131217550 GGCTAAGCGTCTGGAACTTGAGG - Intronic
938474000 2:131590856-131590878 GGCTAAGCAGCTGGAACTTGAGG - Intergenic
939438679 2:142212686-142212708 GGCTAAGCCACTGAAATTTGGGG + Intergenic
940444517 2:153762406-153762428 GGCTGAGCAAGTGGCAGTTCTGG - Intergenic
943364767 2:186958475-186958497 GGCCAAGACAGTAGAACTTGAGG + Intergenic
944255099 2:197617595-197617617 ACCTGAGCCAGGGGAAGTTGAGG + Intronic
945579554 2:211576228-211576250 GGCTGAGTCAAAGGAACATGTGG + Intronic
946227591 2:218272505-218272527 GCCTGAGCCAGAGGAGCTGGGGG - Intronic
946537259 2:220645297-220645319 GGCAGACTCAGTTGAACTTGGGG - Intergenic
947651338 2:231788626-231788648 GGCTGAGCCACTGGTACCTTTGG - Exonic
948457721 2:238114583-238114605 GGCTGAGCCAGTGGCTGGTGTGG - Intronic
948891750 2:240910160-240910182 GGGTGAGCAAGTCGGACTTGGGG + Intergenic
948972325 2:241438862-241438884 GGCTGAGCAGGTGGATCATGGGG - Intronic
1170894957 20:20404527-20404549 TGCTGAGCCAGGAGGACTTGAGG + Intronic
1171181353 20:23093227-23093249 TGCTAAGTCAGTGGAGCTTGGGG - Intergenic
1172501917 20:35433709-35433731 TCCTCAGCCAGGGGAACTTGTGG + Exonic
1173069655 20:39750770-39750792 GGCTGAGGCAGTGGATCATGAGG - Intergenic
1173611433 20:44371055-44371077 GGCAGAGCCAGAGAAACTGGAGG + Intronic
1174001672 20:47379384-47379406 GGCTGAGGCAGTGGAATTGCTGG - Intergenic
1175938042 20:62524007-62524029 GGGTGAGTCAGAGGAACTAGGGG + Intergenic
1177333641 21:19695528-19695550 GGCTGCCCCAGTGGAATCTGGGG + Intergenic
1178222391 21:30674988-30675010 TGCTCTGCCAGTGGAGCTTGGGG - Intergenic
1179732725 21:43376472-43376494 GGAGGAGCCAGTGAAGCTTGTGG - Intergenic
1183513848 22:38251715-38251737 GGCACAGCCTGTGGACCTTGGGG + Intronic
1184259914 22:43308796-43308818 GGATGTGCAAGTGGCACTTGAGG - Intronic
1184654538 22:45934482-45934504 GGCCCAGCCGGTGGACCTTGAGG + Intronic
1185244402 22:49765562-49765584 GGCTGAGCCAGGGGCTCGTGGGG - Intergenic
951901914 3:27665336-27665358 GGCGGAGTCAGTGGAAATTATGG + Intergenic
954018861 3:47720355-47720377 GGCTGAGGCAGTGGATCATGAGG - Intronic
954570619 3:51637888-51637910 GACAGAGACAGGGGAACTTGAGG - Intronic
957526105 3:81380360-81380382 GGTTGGGCCAATGCAACTTGTGG + Intergenic
957873428 3:86115137-86115159 GGCTGAGGCAGTGGATCACGAGG - Intergenic
960352154 3:116607035-116607057 GGCTGGGCCAGTGGTGGTTGAGG - Intronic
960979656 3:123211102-123211124 TCCTGAGACAGTGGAACTTAGGG + Intronic
961693877 3:128690599-128690621 GGCTGAGGCAGGGGAGGTTGAGG - Intergenic
966707567 3:182933293-182933315 GACTGAACCAGGGGAACTGGAGG + Intergenic
966856025 3:184194203-184194225 GGCTGAGCCAGTGGAATGAAGGG + Intronic
967720483 3:192811012-192811034 GGCAGAGTCACTGGCACTTGAGG - Intronic
968042314 3:195598949-195598971 GGCTGAACAAGCTGAACTTGGGG + Intergenic
970455651 4:16221225-16221247 GGCTGAGCCAGGGGAATTGCTGG - Intronic
972278524 4:37581769-37581791 GCCAGAGCCAGTGGACCTGGGGG - Intronic
975247008 4:72131111-72131133 TGCTGTGCCATTGGAACCTGGGG + Intronic
977721514 4:100244857-100244879 TGCTCTGCCAGTGGAGCTTGGGG + Intergenic
978349671 4:107808520-107808542 GGCTGAGGCGGTGGACCATGAGG - Intergenic
979935463 4:126689012-126689034 TGCTGAGTCAGTGGAAGATGTGG + Intergenic
981100991 4:140829009-140829031 GGATGAGCCAGTGGACTTTATGG + Intergenic
983204755 4:164901059-164901081 GGCTTAGGGAGTGGAACTTAGGG + Intergenic
984129559 4:175856818-175856840 TCCTCTGCCAGTGGAACTTGGGG + Intronic
985274241 4:188222379-188222401 GGCCGAGGCAGTGGATCATGAGG + Intergenic
986261620 5:6152396-6152418 AGCAGATCCAGTGGTACTTGAGG - Intergenic
986631165 5:9775429-9775451 GGCTGAGCTGGTGGTACCTGAGG + Intergenic
987411031 5:17615145-17615167 GGCTGAGCCAGGTTAACTGGAGG + Intergenic
989215677 5:38902197-38902219 GAATAAGCCATTGGAACTTGGGG + Intronic
989726010 5:44587629-44587651 GTCTGATCGAGTGGTACTTGAGG + Intergenic
990625217 5:57603025-57603047 GGCTGCTCCAGTGGAAATTCAGG + Intergenic
994433241 5:99695509-99695531 TGCTCTGCCAGTGGAGCTTGGGG + Intergenic
994671044 5:102762138-102762160 GGCTGAGGAAGGGGAATTTGGGG - Intronic
996380156 5:122855170-122855192 GGCTGAGGCAGGAGAAATTGTGG - Intronic
996576256 5:124979354-124979376 GGCTGAGTGAGTGGAAAGTGAGG + Intergenic
997043093 5:130280346-130280368 GGCTGAGGCGGTGGATCATGAGG + Intergenic
997427032 5:133810278-133810300 GGCTGTGCCAGAAGAACTGGAGG - Intergenic
999098266 5:149000745-149000767 GGCAAAGACAGTGGTACTTGAGG - Intronic
1000101513 5:158021564-158021586 GCCTGAGCCTGGGGAAGTTGTGG - Intergenic
1001983263 5:176051478-176051500 GGCTGAGGCAGTGGAACTGGAGG + Intronic
1002234202 5:177792574-177792596 GGCTGAGGCAGTGGAACTGGAGG - Intronic
1002818187 6:698018-698040 GGTGGAACCAGTGGAGCTTGCGG - Intergenic
1005006294 6:21290511-21290533 GGCTGAGGCAGGAGAACCTGTGG + Intergenic
1008090197 6:47286008-47286030 GGCTGTGCCAGGGGAAGGTGAGG + Exonic
1010638347 6:78288081-78288103 GGCCGAGGCAGTGGATCATGAGG - Intergenic
1015042844 6:128742660-128742682 TGCTCTGCCAGTGGAGCTTGGGG - Intergenic
1016314657 6:142772269-142772291 GTCTGAGTCAGCCGAACTTGTGG - Exonic
1016380790 6:143476604-143476626 GGTTGAACCAGTAGTACTTGTGG + Intronic
1017876055 6:158525022-158525044 GGCTGAGCCATGGGGACTTCTGG - Intergenic
1017895214 6:158673671-158673693 GGCTGAGGCAGTGGATCACGAGG - Intronic
1019352696 7:562373-562395 GGCTGGGCCTGTGGAGCTGGAGG - Intronic
1020198362 7:6059657-6059679 GGCTGAGGCGGTGGATCATGAGG + Intergenic
1021283116 7:18745256-18745278 GGATGAGTCAGTGGAAGTTTGGG + Intronic
1021943104 7:25699337-25699359 TGCTAAGCCACTGGAACTTGGGG - Intergenic
1022446267 7:30473195-30473217 GTCTGGGTCAGTGGAATTTGGGG - Intronic
1023392877 7:39727423-39727445 GGCTGGGCCAGTGGGAGTAGTGG - Intergenic
1027241691 7:76334514-76334536 GGCTGAGGCAGAGGAGTTTGTGG - Intronic
1027706120 7:81535714-81535736 TGCTCTGCCAGTGGAGCTTGGGG - Intergenic
1028774390 7:94660846-94660868 GGCTGCAACAATGGAACTTGGGG - Intronic
1029166523 7:98595349-98595371 GGCTGCGCCAGTGGCAAATGGGG - Intergenic
1029249431 7:99225515-99225537 GGCTGAGGCAGGGGAGCTTGAGG - Intergenic
1030898591 7:115093029-115093051 GGCTGAGGCAGTGGATCACGAGG - Intergenic
1032032676 7:128497581-128497603 GGCTGAGGCAGGAGAACTTCTGG - Intronic
1034648376 7:152669141-152669163 GGCTGAGGCAGGAGTACTTGAGG + Intronic
1035483039 7:159202540-159202562 GGCACAGCCAGTGGAACAAGGGG + Intergenic
1035556783 8:573054-573076 GTCTGACCCAGTGGACCTGGTGG - Intergenic
1036412742 8:8517909-8517931 GACTTGGCCAGTGGAATTTGAGG - Intergenic
1036807323 8:11844529-11844551 GGGTGAGCCAGTGGAACAGCGGG - Exonic
1037334077 8:17775088-17775110 GGCTGGGGCAGGGGAACATGGGG + Intronic
1037909611 8:22736159-22736181 GGCTGAGCCACAGGAAATTGTGG + Intronic
1039450888 8:37674326-37674348 GGCTGAGCAAGTGGAGCTCCGGG + Intergenic
1039987022 8:42456330-42456352 GACTGAGCCAGTGAAAGCTGAGG - Intronic
1042354334 8:67809757-67809779 GGCTGAGACAGTGTAACTCTAGG - Intergenic
1043220429 8:77655621-77655643 TTCTCTGCCAGTGGAACTTGGGG - Intergenic
1045962046 8:107979800-107979822 AGCTAAGGCAGTGGTACTTGAGG - Intronic
1046016083 8:108606946-108606968 AGCTGAGGCAGTGGGACTGGAGG + Intronic
1047068935 8:121320662-121320684 GGCCGAGGCAGTGGATCATGAGG - Intergenic
1049800669 8:144516149-144516171 GGCTGAGTCCGTGGTACCTGGGG + Exonic
1049817064 8:144609634-144609656 GGCTGAGGCGGTGGATCATGAGG - Intergenic
1051416179 9:16843433-16843455 GGCTGAGGCAGTGGAGGCTGAGG - Intronic
1053583942 9:39436631-39436653 GGCCGAGGCAGTGGATCATGAGG - Intergenic
1054105523 9:60995375-60995397 GGCCGAGGCAGTGGATCATGAGG - Intergenic
1054987546 9:71279976-71279998 GGCTGAGCCAGTAGAATTGCTGG + Intronic
1055605540 9:77966891-77966913 GGCAGAGGCAGTGGACCTGGTGG - Intronic
1057141423 9:92728801-92728823 GCCAGAGGCAGTGGAACTTGTGG + Intronic
1057880312 9:98788116-98788138 GTCTGAGCCACTGCATCTTGGGG + Intronic
1058043903 9:100335433-100335455 GGCTGAGGCAGCGGACCATGAGG - Intronic
1060657204 9:125380369-125380391 TGCTGAGCCAGCAGACCTTGGGG + Intergenic
1062616255 9:137397377-137397399 GGCTGAGTCCCTTGAACTTGGGG - Intronic
1062743855 9:138198481-138198503 GGCCGAGCCAGTGGATCACGAGG + Intergenic
1186776075 X:12865802-12865824 GGCTGAGACAGTGGGTCTGGTGG + Intergenic
1188438084 X:30185527-30185549 TGCTCTGCCAGTGGAGCTTGGGG - Intergenic
1190512294 X:51185609-51185631 GCCTGACCCAGTGGCACTAGTGG - Intergenic
1191126684 X:56963115-56963137 GGCTGAGGCAGGGGATCATGAGG + Intergenic
1195350072 X:103987076-103987098 GACTGAGCCAGTGGAAAGTGGGG + Intergenic
1195351848 X:104004034-104004056 GACTGAGCCAGTGGAGAGTGGGG - Intergenic
1195357372 X:104051763-104051785 GACTGAGCCAGTGGAAAGTGGGG - Intergenic
1195383304 X:104290856-104290878 GCCTGAGCCCGGGGAAGTTGAGG + Intergenic
1196925087 X:120625730-120625752 GGCAAATCCATTGGAACTTGGGG + Intergenic
1197323633 X:125064839-125064861 GGCTGAGGCAGTGGATCCCGAGG - Intergenic
1201157934 Y:11149921-11149943 GGCTGAGCCACTGTGGCTTGGGG + Intergenic