ID: 1143685615

View in Genome Browser
Species Human (GRCh38)
Location 17:8513208-8513230
Sequence CCTCATAAACAGACATAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 617}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143685608_1143685615 20 Left 1143685608 17:8513165-8513187 CCTCTACTCAAGCATCTCGTCCT 0: 1
1: 0
2: 1
3: 7
4: 96
Right 1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 617
1143685610_1143685615 -7 Left 1143685610 17:8513192-8513214 CCATTTTTCTATTTCCCCTCATA 0: 1
1: 2
2: 10
3: 48
4: 600
Right 1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 617
1143685609_1143685615 0 Left 1143685609 17:8513185-8513207 CCTTTGACCATTTTTCTATTTCC 0: 1
1: 0
2: 6
3: 79
4: 724
Right 1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143685615 Original CRISPR CCTCATAAACAGACATAGGA AGG Intronic
901637710 1:10678039-10678061 CCCCATCAACACACATTGGAAGG - Intronic
903305833 1:22412424-22412446 ACTCTTAAACAGGCGTAGGAAGG + Intergenic
906036273 1:42751951-42751973 GCTCATAAAGAGAGATAAGAAGG - Intronic
906587103 1:46988516-46988538 CCTCATAAAAAGACTTAGCAAGG - Intergenic
907116034 1:51969342-51969364 CCTCATAGACAGAGAAAGGAGGG - Intronic
908862447 1:68505033-68505055 ACTCATAACTAGACATAGCATGG - Intergenic
909041598 1:70659728-70659750 CCTCCTAAACAGTAATAGGAAGG - Intergenic
909439423 1:75681239-75681261 CCTCATAAACTGAGTTAGGGAGG - Intergenic
909552226 1:76911452-76911474 CCTCATAAAATGAGTTAGGAAGG + Intronic
909560231 1:77001999-77002021 CCTCATAAAATGAGTTAGGAAGG + Intronic
910314876 1:85871328-85871350 CCTCATAAAAAGAGTTAGGGAGG - Intronic
911243101 1:95486704-95486726 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
911338955 1:96614280-96614302 CCTCATAAAATGAGTTAGGAAGG + Intergenic
911352449 1:96770901-96770923 TCTCATAAACATTAATAGGAAGG + Intronic
913035906 1:114965855-114965877 CCTCATAAACTGAGTTAGGCAGG + Intronic
913388432 1:118284384-118284406 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
916221887 1:162452788-162452810 CCTCATAAAATGAGATAGGGAGG - Intergenic
916545722 1:165802206-165802228 CCTCATAAAATGAGTTAGGAAGG - Intronic
916700745 1:167291835-167291857 CCTCCTAAACAGTCAGAGGCAGG + Intronic
916835374 1:168539248-168539270 CCTCATAAAATGAGTTAGGAAGG + Intergenic
916855737 1:168747558-168747580 CCTCATAAAATGAGTTAGGAAGG - Intergenic
916872228 1:168928198-168928220 CCTCATAAAATGAGTTAGGAAGG - Intergenic
916964732 1:169925782-169925804 CCTCACAAACAGCCAGAGGTAGG - Intronic
917541985 1:175923192-175923214 CCTGAACAACAGACATATGAGGG - Intergenic
917742343 1:177972857-177972879 CCTTATAAAAAGACACAAGAGGG + Intronic
917915574 1:179697941-179697963 CCTCATAAAATGAGTTAGGAAGG - Intergenic
918484549 1:185015515-185015537 CCTTATAAAAAGAGATAAGAGGG + Intergenic
918505944 1:185254288-185254310 CCTCATAAAAAGAGTTAGGGAGG + Intronic
918624388 1:186640826-186640848 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
919427260 1:197448182-197448204 CCCCAGAAACAAAAATAGGAGGG - Intronic
919602229 1:199636470-199636492 CCTCATAAAGAGAGTTAGGGAGG - Intergenic
920624381 1:207582191-207582213 CCTCATAAATATTTATAGGATGG - Intronic
920745781 1:208626899-208626921 CATCATAGACAGATACAGGAGGG - Intergenic
920804734 1:209222206-209222228 CCTCCTACACAGACATGTGAGGG - Intergenic
921624021 1:217358203-217358225 CCTCATAAAATGAGTTAGGAAGG + Intergenic
921947933 1:220899981-220900003 CCTCATAAACTGAGTTAGGGAGG + Intergenic
921978063 1:221224838-221224860 CCTTATAAACAACCATAAGACGG - Intergenic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
922415599 1:225419710-225419732 CCTCATAAAAATACACAGGTGGG - Exonic
922551035 1:226494740-226494762 CCTCATACACAGACAGAGGGAGG + Intergenic
922647850 1:227308639-227308661 TTTCATAAAGAGACATAGGGAGG + Intronic
923787134 1:237078759-237078781 CCTCATAAAATGACTTAGGGAGG - Intronic
924202738 1:241676496-241676518 CCTCAAAAACAGAACTAAGATGG + Intronic
924893712 1:248313412-248313434 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1065472766 10:26099920-26099942 CCTCATAAAATGACTTAGGGAGG + Intronic
1065621937 10:27590921-27590943 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1065781398 10:29171681-29171703 CCTCATACAGAGACAGAGGGAGG + Intergenic
1066310701 10:34192891-34192913 CCTCAAAAACAGACTTAGAGAGG - Intronic
1066724386 10:38375158-38375180 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1066751811 10:38665492-38665514 CCTCATAAAATGACTTAGGGAGG - Intergenic
1066799181 10:39165366-39165388 CCTCATAAACTGAGTTAGGGAGG - Intergenic
1067006473 10:42668768-42668790 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1067256061 10:44643258-44643280 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1069567823 10:69475173-69475195 CCACAGAAACAGCCATGGGAAGG - Intronic
1070286341 10:75086636-75086658 CCTGATAAACTGACTTAGCAGGG - Intergenic
1071001685 10:80838261-80838283 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1071190413 10:83092807-83092829 CCTCATAAAATGACTTAGGGAGG - Intergenic
1071236531 10:83656841-83656863 GCTCAATAACAGAAATAGGAAGG + Intergenic
1071354044 10:84775567-84775589 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1071373275 10:84975575-84975597 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1071418718 10:85466502-85466524 CCTGATAAAAAGACATAGATTGG + Intergenic
1074282477 10:112065885-112065907 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1074307982 10:112296747-112296769 CCTCAGAAACAGACAACGGGGGG - Intronic
1075845140 10:125539289-125539311 CCACATATACAGACAGAGGTGGG + Intergenic
1075858360 10:125651129-125651151 CCTCATAAAAAGATTTAGGGAGG - Intronic
1078557034 11:12336962-12336984 CCTCATAAAATGAGTTAGGAAGG + Intronic
1078681746 11:13483598-13483620 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1079300692 11:19276509-19276531 AGTCATAAACTGACATAGCATGG + Intergenic
1079834120 11:25309663-25309685 TCTCAGAAACAGACATACAAAGG + Intergenic
1080246230 11:30182074-30182096 CCTCATAAAATGACTTAGGGAGG - Intergenic
1080253712 11:30265651-30265673 CCTCATAAAATGACTTAGGGAGG + Intergenic
1080926512 11:36762364-36762386 TCTCATAAAAAGACAGAGTAGGG - Intergenic
1080949988 11:37020373-37020395 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1080968552 11:37243205-37243227 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1080995662 11:37597367-37597389 ACTCATATACACACATAAGATGG + Intergenic
1081257420 11:40914179-40914201 CCTCATAAAATGACTTAGGGAGG - Intronic
1081454073 11:43203739-43203761 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1081682078 11:45014312-45014334 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1082123545 11:48405944-48405966 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1082148572 11:48702339-48702361 CCTCATTAAAAGAGTTAGGAAGG + Intergenic
1082298362 11:50472916-50472938 CCTCATAAAATGAGATAGGGAGG + Intergenic
1082559087 11:54597806-54597828 CCTCATAAAATGACTTAGGGAGG + Intergenic
1082571418 11:54744888-54744910 CCTCATAAAAAGAATTAGGGAGG + Intergenic
1082624214 11:55463411-55463433 CCTCATAAAATGAGATAGGGAGG - Intergenic
1082667276 11:55989500-55989522 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1082723880 11:56711883-56711905 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1083532684 11:63438792-63438814 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1084859422 11:72008649-72008671 CTCCATAAACAGACATAGGGAGG + Intronic
1085197703 11:74682425-74682447 CTTCATAAACAGGCCCAGGAAGG - Intergenic
1085434260 11:76485180-76485202 CCTCATAAAATGAGTTAGGAAGG - Intronic
1086030174 11:82345249-82345271 CCTCATAAAAGGAGTTAGGAAGG - Intergenic
1086523713 11:87700604-87700626 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1087052389 11:93899149-93899171 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1087101953 11:94373983-94374005 CCTCATAAAATGACTTAGGGAGG - Intergenic
1087482891 11:98723388-98723410 CCTCATAAAATGAGTTAGGAGGG + Intergenic
1087600025 11:100302509-100302531 GCCCATAAACAGAAATAGTAAGG - Intronic
1087950247 11:104212412-104212434 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1088160571 11:106864925-106864947 CCTCATAAAATGAATTAGGAAGG + Intronic
1088309831 11:108448266-108448288 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1088336725 11:108713637-108713659 CATCATAACCAGACATGGCAGGG - Intronic
1092031234 12:5287453-5287475 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1092327410 12:7547561-7547583 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1092703580 12:11259953-11259975 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1092706154 12:11287220-11287242 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1093493620 12:19731193-19731215 CCTCATAAAATGACTTAGGGAGG + Intergenic
1093599658 12:21006313-21006335 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1094016889 12:25874366-25874388 CCTCACACACACACACAGGAGGG + Intergenic
1094560920 12:31552572-31552594 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1095677358 12:44935324-44935346 CCTCATAAAATGAGATAGGGAGG - Intergenic
1096920805 12:55083875-55083897 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1096952430 12:55487505-55487527 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1097517490 12:60623358-60623380 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098438440 12:70493680-70493702 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1098555457 12:71813722-71813744 CCTCTTAAACAGACAGAGGTAGG - Intergenic
1098866737 12:75772099-75772121 CCTGATAAACACACATATAAAGG + Intergenic
1098887292 12:75973389-75973411 CCTCATAGATAAACATTGGAGGG + Intergenic
1099185121 12:79507606-79507628 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1099388533 12:82049470-82049492 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1099418346 12:82422029-82422051 CCTCATAAAATGAGTTAGGAAGG - Intronic
1099720866 12:86359962-86359984 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1099962470 12:89409937-89409959 CCTCATAAAATGAGATAGGGAGG - Intergenic
1100919584 12:99466921-99466943 CCTCATAAAATGAGTTAGGAAGG - Intronic
1102325478 12:111978632-111978654 CCTTATAAAAAGACATGAGAGGG + Intronic
1103279029 12:119739242-119739264 CCTCTAAAACAGACTTAGGTAGG + Intronic
1104360541 12:128128949-128128971 GCTCATTCACAGACATTGGAAGG - Intergenic
1105804483 13:23944815-23944837 CCTCACAAGCAGACATTTGAAGG - Intergenic
1106875945 13:34072932-34072954 CCACATAAACAGAATTAGCATGG - Intergenic
1107487133 13:40839351-40839373 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1108049035 13:46411466-46411488 CCCAATTAAAAGACATAGGATGG + Intronic
1108203844 13:48068196-48068218 CCTAATAAACAGGCATAGGTTGG - Intronic
1108414394 13:50182809-50182831 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1108476848 13:50828666-50828688 CCTTATAGACAGAATTAGGAAGG - Intronic
1108491404 13:50985554-50985576 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1108545052 13:51484752-51484774 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1109366846 13:61366924-61366946 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1109541558 13:63784739-63784761 CCCAATTAAAAGACATAGGATGG + Intergenic
1109843184 13:67948298-67948320 CCTGAGAAAGAGACATATGATGG + Intergenic
1110001811 13:70212360-70212382 CCTCATAAAATGAGATAGGGAGG - Intergenic
1110606631 13:77440341-77440363 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1111149456 13:84230403-84230425 CTTCTTAAACAGCAATAGGAGGG + Intergenic
1111184186 13:84709587-84709609 CCCTATAAATATACATAGGAAGG + Intergenic
1111214124 13:85121284-85121306 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1111232074 13:85356659-85356681 CCTCATAAAATGACTTAGGGAGG - Intergenic
1111712406 13:91833374-91833396 CCTCATAAAATGACTTAGGGAGG - Intronic
1111723014 13:91970975-91970997 CCTCATAAAATGAGTTAGGAAGG + Intronic
1111947373 13:94679933-94679955 CGTAATCAAAAGACATAGGATGG - Intergenic
1112050219 13:95637938-95637960 GTTCATAAACATAAATAGGAAGG + Intronic
1112647946 13:101356666-101356688 CCTCATAAAATGAGTTAGGAAGG - Intronic
1113671428 13:112178171-112178193 CCTGATATTCAGCCATAGGATGG - Intergenic
1113718261 13:112530090-112530112 CCACAGAAATACACATAGGATGG + Intronic
1114828534 14:26109894-26109916 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1114843907 14:26298087-26298109 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1115278665 14:31636599-31636621 CCTCATAAAATGAGTTAGGAAGG + Intronic
1115720769 14:36158762-36158784 CCTCATAAAATGACTTAGGGAGG + Intergenic
1116155149 14:41194881-41194903 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1117305201 14:54467262-54467284 CCACATGAAGACACATAGGAGGG + Intergenic
1117626596 14:57646132-57646154 CCTCATAAAATGAGTTAGGAAGG + Intronic
1117716041 14:58582400-58582422 CCTCATAAACTGGGTTAGGAAGG + Intergenic
1118550404 14:66943879-66943901 CCTAATAAACAGGCATAGATGGG + Intronic
1119156037 14:72412076-72412098 CCTCATAAAATGAGTTAGGAAGG + Intronic
1119184018 14:72624640-72624662 CCTGGTAAAGAGACATAGGTTGG - Intronic
1120137608 14:80888262-80888284 CCTCATAAAATGAGTTAGGAAGG - Intronic
1120201949 14:81546926-81546948 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1120478608 14:85020884-85020906 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1120619602 14:86747538-86747560 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1121213689 14:92229945-92229967 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1123666485 15:22612600-22612622 CCTCACAACCACAGATAGGAAGG + Intergenic
1124561572 15:30778876-30778898 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1124668957 15:31620276-31620298 CCTCATAAAATGAGTTAGGAAGG + Intronic
1125285690 15:38090230-38090252 CCTCAGAAACAGAGAAGGGAGGG - Intergenic
1125286534 15:38099073-38099095 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1125937990 15:43653470-43653492 CCTCATAAAATGAGTTAGGAAGG - Intronic
1128989692 15:72249354-72249376 CCTAATAAATAGCCATGGGAGGG - Intronic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1132287628 15:100676076-100676098 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1202981597 15_KI270727v1_random:365220-365242 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1134541052 16:15065891-15065913 CCTCAAAAACAGGCACAGAAAGG + Intronic
1134825187 16:17278818-17278840 CTTCAGAATCAGACCTAGGATGG - Intronic
1134908322 16:18001079-18001101 CATCATAAACTGAGATATGATGG + Intergenic
1135225468 16:20652885-20652907 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1135436504 16:22430435-22430457 CCTCAAAAACAGGCACAGAAAGG + Intronic
1135834702 16:25814638-25814660 ACTAAAAAACAGACATAGGCCGG - Intronic
1136263753 16:29101480-29101502 CCTCAAAAACAGGCACAGAAAGG - Intergenic
1137025709 16:35472166-35472188 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1137239622 16:46644465-46644487 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1137356568 16:47771678-47771700 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1139207466 16:65043243-65043265 ATTCATGCACAGACATAGGAAGG + Intronic
1142682490 17:1558528-1558550 CCTCATCTACAGACACAGGCAGG + Exonic
1143142158 17:4746859-4746881 CCTCAAAAAAAGACATCTGAGGG + Intergenic
1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG + Intronic
1145354419 17:22128145-22128167 CCATATACACAAACATAGGAGGG - Intergenic
1147443567 17:40461857-40461879 CCTCACACACAGCCACAGGAGGG - Intergenic
1149901174 17:60480874-60480896 CCTCACTAACAGATACAGGAAGG - Intronic
1150865449 17:68844527-68844549 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1153707784 18:7764361-7764383 ATACATAAACACACATAGGATGG + Intronic
1153827238 18:8886575-8886597 CCTCATAAAAAGAATTAGGGAGG + Intergenic
1156029992 18:32701588-32701610 CATGATAAAAAGGCATAGGAGGG + Intronic
1157123110 18:44930445-44930467 CCTCATAAAATGAATTAGGAAGG + Intronic
1158003592 18:52646915-52646937 CCTCCTAAATAGACTTAGGATGG - Intronic
1158105323 18:53879375-53879397 CTTCATAAAATGAGATAGGAAGG + Intergenic
1158417645 18:57263194-57263216 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1159320921 18:66846822-66846844 CCTTATAAAAAGAGTTAGGAAGG + Intergenic
1160018536 18:75162898-75162920 CCTCACAACCAGACAAAGGAAGG + Intergenic
1160081860 18:75735564-75735586 CCACATAAACACACAAAAGAAGG + Intergenic
1164046757 19:21549911-21549933 CCTCATAAAATGAGTTAGGAAGG + Intronic
1164232104 19:23298803-23298825 CCTCATAGAAAGAGTTAGGAAGG + Intergenic
1164603592 19:29579927-29579949 CCTCAGAAACAGGCATATGGGGG + Intergenic
1165003442 19:32784497-32784519 CCTCATAAAATGAGTTAGGAAGG + Intronic
1165265386 19:34658733-34658755 CCTCATAAACTGAGTTAGGGAGG - Intronic
925841660 2:7997779-7997801 CCTCATAAACTGACAGAGCTGGG + Intergenic
925882410 2:8363806-8363828 CCTCATCAGCAGAGACAGGAAGG - Intergenic
925894976 2:8464072-8464094 CCTCCTACTCAGACATAGGCCGG + Intergenic
926533822 2:14085242-14085264 CCTCATAAAATGAGTTAGGAAGG - Intergenic
926543971 2:14215835-14215857 CTTCATAAAGAGATATAGAAAGG + Intergenic
927155944 2:20221764-20221786 CCTCATTAACACACATTGGTAGG - Intronic
929705082 2:44202344-44202366 CTTCATAATCAGGCATAAGATGG - Intronic
930175681 2:48299198-48299220 CCTCATAAAATGAGTTAGGAAGG + Intergenic
930933258 2:56915597-56915619 CCTCATAAAATGAGATAGAAAGG - Intergenic
930983678 2:57559047-57559069 CCTCATAAAATGAGTTAGGAAGG - Intergenic
931130472 2:59329921-59329943 CCTCATAAAATGACTTAGGGAGG - Intergenic
931815224 2:65893901-65893923 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
931843687 2:66180671-66180693 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
932643990 2:73482587-73482609 CCTCATAAAAAGAGTTAGGGAGG + Intronic
933009522 2:77041685-77041707 TCTCAAAAAAAGACATAGAAAGG - Intronic
933018830 2:77165444-77165466 CCTCATAAAATGAGTTAGGAAGG - Intronic
933169354 2:79108205-79108227 CCTCATAAATAGAGTTAGGGAGG + Intergenic
933487950 2:82947097-82947119 CCTCATAAAAGGAGATAGGGAGG + Intergenic
933534469 2:83554820-83554842 CCTCATAAAATGAGTTAGGAAGG + Intergenic
933569968 2:83998733-83998755 CCTCATAAAGAAACTTAGGTTGG - Intergenic
934468866 2:94496683-94496705 CCTCATAAAATGACTTAGGGAGG - Intergenic
936643007 2:114336725-114336747 CCTCATAAAATGAGATAGGGAGG - Intergenic
936873346 2:117159519-117159541 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
938167178 2:129040650-129040672 CCTCATAAAATGAGTTAGGAAGG + Intergenic
938525655 2:132127669-132127691 CCTCATAAAATGAGTTAGGAAGG + Intergenic
940439701 2:153699973-153699995 CCTCATAAAATGAGTTAGGAAGG - Intergenic
940644137 2:156372778-156372800 CCTCATAAAATGAGTTAGGAAGG + Intergenic
941518392 2:166508111-166508133 CCTCATAAAATGAGTTAGGAAGG + Intergenic
941832052 2:169972396-169972418 CCTCATAAAAAGAGTTAGGGAGG - Intronic
942118575 2:172753814-172753836 CCTCACAAACCGAAAGAGGAAGG - Intronic
942399920 2:175591061-175591083 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
942939595 2:181600601-181600623 CATCAAAAAGAGACAAAGGAGGG + Intronic
943147359 2:184062628-184062650 CCTCATAAAATGAGTTAGGAAGG + Intergenic
943163195 2:184281744-184281766 CCTCATAAAATGAGTTAGGAAGG + Intergenic
943284184 2:185976234-185976256 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
943583895 2:189715571-189715593 CCTCATAAAATGAGTTAGGAAGG - Intronic
943781307 2:191827391-191827413 CCACATAAAGAAACATAGTAAGG - Intergenic
944292379 2:198021877-198021899 CCTCATAAAATGAGTTAGGAAGG - Intronic
944477847 2:200125541-200125563 CCCCATACAGAGACAGAGGAGGG + Intergenic
945123714 2:206485780-206485802 CCACATAAAGACATATAGGATGG + Intronic
945164647 2:206930006-206930028 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
945355533 2:208835201-208835223 CCTCATAAAATGAGTTAGGAAGG - Intronic
945433283 2:209790792-209790814 CCTCTTACATAGACACAGGATGG + Intronic
945714985 2:213346893-213346915 CCTCATAAAATGAGTTAGGAAGG + Intronic
945984979 2:216346323-216346345 CCTCATGAACACACATAGCTAGG + Intronic
947033830 2:225828212-225828234 CCTCATAAAATGAGTTAGGAAGG - Intergenic
948045440 2:234940222-234940244 CATCAGAAACAGACGTAGGAGGG + Intergenic
948435438 2:237950545-237950567 ACTAATAAAAAGACATAGGCCGG + Intergenic
1168937234 20:1675920-1675942 CCTCATAACCAGTTCTAGGAAGG - Intergenic
1169079929 20:2791620-2791642 TCTCATAAAAAGAAAAAGGAAGG + Intergenic
1169576766 20:6971195-6971217 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1170131899 20:13029845-13029867 CCTAATAAACACACAGAGAAGGG + Intronic
1174670527 20:52303453-52303475 CCTGAAAAACAGACTTCGGAAGG - Intergenic
1174790778 20:53476141-53476163 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1175374568 20:58515331-58515353 CCTCATTTACAGACAGAGGCCGG - Intergenic
1177122486 21:17155373-17155395 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1177691576 21:24516867-24516889 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1180519807 22:16187206-16187228 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1180614214 22:17117419-17117441 CCTTGTAGACAGACATAAGAGGG - Exonic
1181353491 22:22279302-22279324 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1182179032 22:28324985-28325007 CCTCATAAAATGAGTTAGGAAGG + Intronic
1182245053 22:28950651-28950673 CCTCAGAAACAGAGATATGGAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184886456 22:47348298-47348320 CCTCATAAACTGAGTTAGGGAGG + Intergenic
1185186990 22:49407171-49407193 GCTCATAAACACACATGGGATGG - Intergenic
949683068 3:6538001-6538023 CCTCATAAAATGAGTTAGGACGG + Intergenic
949983367 3:9518177-9518199 TCACATAAACAGACTAAGGAAGG - Intronic
951167182 3:19496700-19496722 CCTCATAAAATGAGTTAGGAAGG + Intronic
951660792 3:25063423-25063445 GCCCATAAAAAGAAATAGGATGG - Intergenic
951861697 3:27260729-27260751 CCTCATAAAATGAGTTAGGAAGG + Intronic
952517317 3:34118576-34118598 CCTCATAAAATGAGTTAGGAAGG + Intergenic
952587252 3:34907739-34907761 CCTCATAAAACGAATTAGGAAGG - Intergenic
953053247 3:39365456-39365478 CCTCATAAAATGAGTTAGGAAGG - Intergenic
953266095 3:41389881-41389903 CCTCATAAAATGAGTTAGGAAGG + Intronic
953711736 3:45277102-45277124 CCTCCTCAACAGACAAAGCAAGG + Intergenic
954226894 3:49187961-49187983 CCTCAGAAACAGACATGTAAGGG - Intronic
955453627 3:59097022-59097044 CCTCATAAAATGAGTTAGGAAGG + Intergenic
956215698 3:66846416-66846438 CCTCATAAAATGAGTTAGGAAGG - Intergenic
957486339 3:80867637-80867659 CCTCATAAAATGAGATAGGGAGG + Intergenic
957638426 3:82816369-82816391 CCTTATAAACACAGATAAGAAGG - Intergenic
958030088 3:88098463-88098485 CCTCATAAAAAGAGTTAGGGAGG - Intronic
958076955 3:88692474-88692496 CCTAATGAAAAGACATAGAATGG + Intergenic
958205395 3:90384957-90384979 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
958253261 3:91294750-91294772 CCTCATAAAATGAGTTAGGAAGG - Intergenic
958413654 3:93849269-93849291 CCTCATAAAATGAGTTAGGAAGG + Intergenic
958447933 3:94237836-94237858 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
958489081 3:94748963-94748985 CCTCATAAAATGAGTTAGGAAGG - Intergenic
958523595 3:95223694-95223716 CCTCATAAAATGAGTTAGGAAGG + Intergenic
958811238 3:98862351-98862373 CCTCATAAAAAGAGTTAGGGAGG - Intronic
958826608 3:99038406-99038428 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
958828530 3:99061174-99061196 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
958848258 3:99291108-99291130 CCTCATAAAATGACTTAGGGAGG + Intergenic
959290390 3:104466349-104466371 CCTCATAAAATGAGATAGGGAGG + Intergenic
959454093 3:106537676-106537698 CCTCATAAAATGAGTTAGGAAGG - Intergenic
960177627 3:114535623-114535645 CCTCATAAAAAGAGTTAGGGAGG - Intronic
960278516 3:115754524-115754546 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
960690816 3:120344616-120344638 CATCATGAACAGAAAAAGGAAGG + Intronic
960745203 3:120880037-120880059 CCTCATAAAATGAGTTAGGAAGG - Intergenic
960772829 3:121213722-121213744 CCTCATAAAAAGAGTTAGGGAGG + Intronic
960775372 3:121245492-121245514 CCTAATCAAAAGACATAGAATGG + Intronic
962125193 3:132609760-132609782 CCTCATAAAACGAGTTAGGAAGG - Intronic
962287345 3:134098223-134098245 CCTCATAAACTGAGTTAGGGAGG + Intronic
962666373 3:137657822-137657844 CCTCATAAAATGAGTTAGGAAGG - Intergenic
962761996 3:138522856-138522878 CCTCATAAAATGAGTTAGGAAGG - Intronic
962822807 3:139068438-139068460 CCTCATAAAAAGAGTTAGGGAGG - Intronic
962882787 3:139594444-139594466 CCTCATAAACTGAGTTAGGGAGG - Intronic
962907692 3:139820049-139820071 CCTCATAAACTGAGTTAGGGAGG - Intergenic
962995668 3:140625751-140625773 CCTCATAAACTGAGTTAGGGAGG - Intergenic
963307180 3:143665963-143665985 CCTCATAAAATGAGTTAGGAAGG - Intronic
964270348 3:154948776-154948798 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
964533048 3:157688820-157688842 CCTCATAAAATGAGTTAGGAAGG - Intergenic
964663552 3:159148280-159148302 AAACAAAAACAGACATAGGAAGG - Intronic
964779805 3:160324261-160324283 CCTCATAAAATGAGTTAGGAAGG - Intronic
964783072 3:160362501-160362523 CCTCATAAAATGAGTTAGGAAGG - Intronic
964860159 3:161192820-161192842 CCTCATAAAATGAGTTAGGAAGG + Intronic
964961328 3:162431199-162431221 CCTCATAGAATGACATTGGAAGG - Intergenic
965015223 3:163148986-163149008 CCTCATAAACTGAGTTAGGGAGG + Intergenic
965855760 3:173086044-173086066 CCTCATAAAATGAGTTAGGAAGG + Intronic
970685570 4:18563034-18563056 CCTCATAAAATGACTTAGGGAGG - Intergenic
970985305 4:22149923-22149945 CCTCATAAAAAGAATTAGGGAGG - Intergenic
971855471 4:32037493-32037515 CCTATTAAACAGACATATGAGGG + Intergenic
972043558 4:34636256-34636278 CCTCATAAAATGAGTTAGGAAGG + Intergenic
973288410 4:48445243-48445265 CCTCATAAAATGACTTAGGGAGG - Intergenic
973591283 4:52444483-52444505 CCTCATAAAATGAGTTAGGAAGG + Intergenic
973714891 4:53666318-53666340 CCTCATAAAATGAGTTAGGAAGG + Intronic
974350177 4:60734266-60734288 CCTCATAAAATGAGATAGGGAGG + Intergenic
974836295 4:67255105-67255127 CCTCATAAAATGAGTTAGGAGGG + Intergenic
975022522 4:69506705-69506727 CCTCATAAAATGACTTAGGGAGG - Intronic
975304878 4:72838047-72838069 CCTCATAAAATGAGTTAGGAAGG + Intergenic
975514021 4:75224983-75225005 CCTCATAAAATGAGTTAGGAAGG - Intergenic
975842607 4:78491289-78491311 CCTCATAAAATGAATTAGGAAGG - Intronic
976357035 4:84130280-84130302 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
976665423 4:87585429-87585451 CCTCATAAAATGAGTTAGGAAGG - Intergenic
976676949 4:87713869-87713891 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
976684399 4:87796035-87796057 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
977468934 4:97417898-97417920 CCTCATAAAATGAGTTAGGAAGG - Intronic
977511512 4:97968418-97968440 CCTCATAAAATGAGTTAGGAAGG - Intronic
977517040 4:98033585-98033607 CCTCATAAAATGAGTTAGGAAGG - Intronic
977653493 4:99495740-99495762 CCTCATAAAATGAGTTAGGAAGG - Intergenic
977775979 4:100919785-100919807 CCTCATAAAATGAATTAGGAAGG - Intergenic
977819564 4:101456357-101456379 CCTCATAAAATGAGATAGGGAGG + Intronic
978274974 4:106938593-106938615 CCTCATAAAAAGAGTTAGGGAGG - Intronic
978517474 4:109583958-109583980 CCTCATAAAATGAGTTAGGAAGG + Intronic
978565801 4:110080223-110080245 CCTCATAAAATGAGTTAGGAAGG - Intronic
978743138 4:112161791-112161813 CCTCATAAAATGAGTTAGGAAGG - Intronic
979031386 4:115652686-115652708 CCTCATAAAATGAGTTAGGAAGG + Intergenic
979042434 4:115815291-115815313 CCTCATAAAATGAGTTAGGAAGG - Intergenic
979409193 4:120353860-120353882 CTTGAGAAACAGACATAGGAAGG - Intergenic
979658681 4:123226719-123226741 CCTCATAAAATGAGTTAGGAAGG + Intronic
980016149 4:127652730-127652752 CCTCATAAAATGAGTTAGGAAGG + Intronic
980503666 4:133687687-133687709 CCTCATAAAATGAGATAGGGAGG + Intergenic
980732871 4:136845271-136845293 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
980891682 4:138822254-138822276 TATAATAGACAGACATAGGAGGG - Intergenic
981609015 4:146572211-146572233 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
981618442 4:146667108-146667130 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
982664140 4:158240507-158240529 CCACATATACACACAGAGGATGG - Intronic
982826065 4:160005307-160005329 CCTCATAAACTGAATTAGGAAGG - Intergenic
983788376 4:171762554-171762576 CCTCATAAACTGAGTTAGGGAGG - Intergenic
983799303 4:171906626-171906648 CCTCATAAAATGAGTTAGGAAGG - Intronic
983915683 4:173288392-173288414 CCTAATAGAGGGACATAGGAGGG + Intronic
983958486 4:173724453-173724475 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
984044662 4:174781949-174781971 CCTCATAAAATGAGTTAGGAAGG - Intronic
984057724 4:174949731-174949753 GTTCAGAAACAGAAATAGGACGG - Intronic
984268590 4:177523778-177523800 CCTCATAAAATGAGTTAGGAAGG - Intergenic
984307926 4:178018530-178018552 CCTCATAAAATGACTTAGGGAGG - Intergenic
984494003 4:180472021-180472043 CCTCATAAAATGACTTAGGGAGG - Intergenic
985028590 4:185764984-185765006 ACTCACAACCAGACAAAGGAAGG - Intronic
986654179 5:9994340-9994362 CCTCATAAAATGAATTAGGAAGG - Intergenic
986656059 5:10013540-10013562 CCTCATAAAATGAGTTAGGAAGG + Intergenic
987013730 5:13795682-13795704 CCTCATAAAATGACTTAGGGAGG - Intronic
988871902 5:35399710-35399732 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
989028765 5:37095064-37095086 CTTCATAGAAAGACTTAGGAGGG - Intergenic
989197664 5:38731602-38731624 CCTGGAAAACTGACATAGGATGG + Intergenic
989674379 5:43956502-43956524 CCTCATAAAAAGAGTAAGGAAGG - Intergenic
989861857 5:46387736-46387758 CCTCATAAAATGACTTAGGGAGG + Intergenic
990239903 5:53806404-53806426 CCTCATAAAATGACTTAGGGAGG - Intergenic
990668689 5:58102648-58102670 CCTCATAAAATGAGTTAGGAAGG + Intergenic
991161713 5:63510936-63510958 CCTCATAAAATGAGTTAGGAAGG - Intergenic
991572137 5:68066180-68066202 CATCAGAACCAGACATAGAAGGG - Intergenic
992336971 5:75781469-75781491 CCTCATAAAATGAGTTAGGAAGG - Intergenic
992605770 5:78454692-78454714 CCTCATAAAATGACTTAGGGAGG + Intronic
992632031 5:78690883-78690905 CCTCATAAAGGGGCATAGGCTGG - Intronic
993358008 5:86938859-86938881 CCTCATAAAATGAGTTAGGAAGG + Intergenic
993364492 5:87019573-87019595 GCTCAGAAACAGATATAAGAGGG - Intergenic
993459899 5:88170524-88170546 CCTCATAAAATGACTTAGGAAGG + Intergenic
994307398 5:98223376-98223398 CCTCATAAAATGAGATAGGGAGG - Intergenic
994442805 5:99831466-99831488 CCTCATAAAATGAGATAGGGAGG + Intergenic
994696296 5:103076592-103076614 CCTCATAAAATGAGTTAGGAAGG + Intergenic
995263495 5:110132934-110132956 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
995603013 5:113819456-113819478 CCTCATAAAATGAGTTAGGAAGG - Intergenic
995628314 5:114103934-114103956 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
995633486 5:114159512-114159534 CCTCATAAAATGAGTTAGGAAGG + Intergenic
995699383 5:114917175-114917197 CCTCATAAAATGAGATAGGGAGG + Intergenic
996113502 5:119592734-119592756 CCTCCCAAACAGACAAAGCAAGG + Intronic
996462875 5:123767264-123767286 CCTCATAAAATGACTTAGGGAGG + Intergenic
996830070 5:127730504-127730526 CCTCATAAAATGAGATAGGGAGG - Intergenic
997108021 5:131044112-131044134 CCTCATAAAATGAGTTAGGAAGG - Intergenic
997809106 5:136949695-136949717 CCTCATAAAATGAGTTAGGAAGG + Intergenic
998683057 5:144492301-144492323 CCTCATAAAATGAGTTAGGAAGG - Intergenic
998873024 5:146571542-146571564 CCTCATAAAATGACTTAGGGAGG + Intergenic
999065615 5:148682741-148682763 CCTGCTGCACAGACATAGGAAGG + Intergenic
999548354 5:152656476-152656498 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1000590345 5:163150369-163150391 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1000720214 5:164696538-164696560 CCTCATAAAAGGAGTTAGGAAGG - Intergenic
1001190148 5:169622518-169622540 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1002167391 5:177356839-177356861 CCTTATAAAAAGAGACAGGAGGG + Intergenic
1002615122 5:180448182-180448204 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1003618532 6:7676571-7676593 CAAGACAAACAGACATAGGAAGG - Intergenic
1005100615 6:22168878-22168900 CCTCATAAAATGAGATAGGGAGG + Intergenic
1005101556 6:22177365-22177387 CCTCATAAAATGAGATAGGGAGG + Intergenic
1005705030 6:28443173-28443195 GCTCAGGAACAGACATAGGGTGG + Intronic
1005723385 6:28624862-28624884 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1005724698 6:28637248-28637270 CATCAGAAACAGACATGGGCAGG - Intergenic
1007134028 6:39503988-39504010 CCTCATAAAATGAGTTAGGAAGG - Intronic
1007142062 6:39585999-39586021 CCTCATACACAGATTTTGGAAGG - Intronic
1008207700 6:48683595-48683617 CCTCATAAAAAGAATTAGGGAGG - Intergenic
1008236859 6:49061268-49061290 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1008297301 6:49793991-49794013 CCTCATAAAATGACTTAGGGAGG + Intergenic
1008436540 6:51482877-51482899 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1008462846 6:51796017-51796039 CCTCATAAAATGAGATAGGGAGG + Intronic
1008732727 6:54502161-54502183 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1009037313 6:58133465-58133487 CCTCATAAAATGACTTAGGGAGG - Intergenic
1009213108 6:60887081-60887103 CCTCATAAAATGACTTAGGGAGG - Intergenic
1009291750 6:61891442-61891464 CCTCATAAAATGAGTTAGGAAGG + Intronic
1009782401 6:68287527-68287549 CCTCATAAAATGACTTAGGGAGG - Intergenic
1010362944 6:75015935-75015957 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1010521776 6:76846988-76847010 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1010594922 6:77751748-77751770 CCTCATAAAATGAGTTAGGAAGG - Intronic
1011297974 6:85844054-85844076 CCTCATAAAATGAGATAGGGAGG + Intergenic
1011841225 6:91501487-91501509 CCACATAAACAGCACTAGGAAGG + Intergenic
1011868140 6:91857781-91857803 CCTCATGAGGAGTCATAGGAGGG - Intergenic
1011924731 6:92627972-92627994 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1012043614 6:94240956-94240978 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1012363584 6:98412484-98412506 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1012528598 6:100206792-100206814 GCTCAAAAACAGACATTGAATGG - Intergenic
1012740155 6:103006502-103006524 CCTCATAAAATGACTTAGGGAGG - Intergenic
1013383478 6:109600587-109600609 CCTCATAAAATGACTTAGGGAGG + Intronic
1014065799 6:117123954-117123976 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1014422673 6:121264547-121264569 CCTCATAAAATGAGTTAGGAAGG - Intronic
1014765338 6:125399715-125399737 CCTCATAAAATGACTTAGGGAGG - Intergenic
1015795273 6:137005045-137005067 TCTCATAGCCAGACATACGATGG - Intronic
1016232130 6:141818311-141818333 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1016333400 6:142977899-142977921 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1016593930 6:145777313-145777335 CCTCATAAACTGAGTTAGGGTGG + Intergenic
1016655327 6:146512166-146512188 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1017792003 6:157808513-157808535 CATCATAAACAGACATACAGTGG - Intronic
1019885587 7:3901762-3901784 CCTAATAAACACACAAAGGATGG - Intronic
1020371392 7:7435825-7435847 CCTCATAAACAGAGATATGCTGG + Intronic
1020690611 7:11350208-11350230 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1020773826 7:12428849-12428871 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1021015002 7:15521329-15521351 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1021208206 7:17810633-17810655 CCTCATAAAATGAGTTAGGAAGG - Intronic
1021235470 7:18137814-18137836 CCTCATAAAATGAGTTAGGAAGG + Intronic
1021374206 7:19886473-19886495 CCTCATAAAATGACTTAGGGAGG + Intergenic
1021375596 7:19903061-19903083 CCTCATAAAATGACTTAGGGAGG + Intergenic
1021953768 7:25802968-25802990 CCTCCTAAAAAGATATTGGAAGG + Intergenic
1022190445 7:28012573-28012595 CCTCTTAAAGACAGATAGGAGGG + Intronic
1022619417 7:31967592-31967614 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1023509086 7:40931431-40931453 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1023510766 7:40950968-40950990 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1023717904 7:43062593-43062615 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1026379374 7:69783752-69783774 CCTCAGAAACAGGCAAAGGAAGG - Intronic
1027330431 7:77087018-77087040 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1027427081 7:78071979-78072001 CCTCAATAAAAGACAAAGGACGG - Intronic
1027447521 7:78291564-78291586 CCTCATAAAATGAGTTAGGAAGG - Intronic
1027639578 7:80716604-80716626 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1027843690 7:83345252-83345274 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1027864235 7:83626215-83626237 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1028144642 7:87308047-87308069 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1028282310 7:88946611-88946633 CCTCATAAAATGAGTTAGGAAGG + Intronic
1028346625 7:89791498-89791520 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1028685894 7:93588252-93588274 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1029785330 7:102784316-102784338 CCTCATAAAATGAGTTAGGAAGG - Intronic
1029879086 7:103787816-103787838 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1030132407 7:106213580-106213602 CCTCATAAAATGACTTAGGGAGG - Intergenic
1030341870 7:108390064-108390086 CCTCATAAAATGACTTAGGGAGG + Intronic
1030392039 7:108940045-108940067 CCTCATAAAATGACTTAGGGAGG + Intergenic
1030398062 7:109013200-109013222 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1030475856 7:110032642-110032664 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1030526172 7:110657637-110657659 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1030572561 7:111246028-111246050 CCTCATAAAATGAGATAGGGAGG + Intronic
1030757313 7:113302946-113302968 ACTCAAAAACAGACGTAAGATGG + Intergenic
1030833220 7:114252301-114252323 CCTCATAAAATGACTTAGGGAGG + Intronic
1031488596 7:122360625-122360647 CTTCATAACAAGACATAGCAAGG - Intronic
1031733834 7:125331691-125331713 CCTCATAAAACGACTTAGGGAGG - Intergenic
1033102600 7:138487853-138487875 CCTCATAAAATGAGATAGGGAGG + Intronic
1035182821 7:157102360-157102382 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1037664870 8:20959843-20959865 CCTCATAAAATGACTTAGGGAGG - Intergenic
1038539382 8:28379113-28379135 CCTGGTTATCAGACATAGGAAGG - Intronic
1039170704 8:34741668-34741690 CCTCATAAAATGAGGTAGGAAGG - Intergenic
1040364541 8:46701772-46701794 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1040390488 8:46946065-46946087 CCTCATAAAATGACTTAGGGAGG - Intergenic
1040405454 8:47097474-47097496 CCTCATAAAATGACTTAGGGAGG + Intergenic
1040632500 8:49231807-49231829 GCTAATAAAAATACATAGGATGG - Intergenic
1041195298 8:55396016-55396038 CCTTATAAAAAGAGACAGGAGGG - Intronic
1041817552 8:61992106-61992128 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1042579009 8:70255963-70255985 CATCCAAAACAGACTTAGGAAGG - Intronic
1043071363 8:75640105-75640127 CTTCATAAAAAGACTTAGGGAGG + Intergenic
1043362889 8:79496244-79496266 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1043586117 8:81771709-81771731 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1043786318 8:84404681-84404703 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1043891030 8:85652922-85652944 CCTCATAAAATGAGATAGGGAGG + Intergenic
1043893459 8:85717581-85717603 CCTCATAAAATGAGATAGGGAGG - Intergenic
1043896141 8:85739030-85739052 CCTCATAAAATGAGATAGGGAGG - Intergenic
1043896539 8:85742778-85742800 CCTCATAAAATGAGATAGGGAGG + Intergenic
1043898861 8:85761145-85761167 CCTCATAAAATGAGATAGGGAGG + Intergenic
1043900474 8:85773339-85773361 CCTCATAAAATGAGATAGGGAGG + Intergenic
1043902436 8:85788614-85788636 CCTCATAAAATGAGATAGGGAGG + Intergenic
1043904047 8:85800807-85800829 CCTCATAAAATGAGATAGGGAGG + Intergenic
1043905659 8:85813001-85813023 CCTCATAAAATGAGATAGGGAGG + Intergenic
1043907266 8:85825188-85825210 CCTCATAAAATGAGATAGGGAGG + Intergenic
1044268180 8:90207808-90207830 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1044323683 8:90835409-90835431 CCTCATAGACAGATAGTGGAGGG - Intronic
1044816658 8:96120166-96120188 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1044882729 8:96740983-96741005 CCTCATAAAATGAGTTAGGAAGG + Intronic
1045134677 8:99202679-99202701 CCTCATAAAATGAGATAGGGAGG - Intronic
1045151457 8:99413067-99413089 CCTCATAAAATGAGTTAGGAAGG + Intronic
1045173134 8:99693177-99693199 CCTCATAAAATGAGATAGGGAGG - Intronic
1045202056 8:99993747-99993769 CCTCATAAAACGAGTTAGGAAGG - Intronic
1045591690 8:103605509-103605531 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1045606731 8:103785779-103785801 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1045790051 8:105973002-105973024 CCCCATTAAGAGACATTGGAGGG - Intergenic
1045887052 8:107111157-107111179 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1046545129 8:115639882-115639904 CCTCATGAAGTGACATAGGCAGG - Intronic
1046862503 8:119109849-119109871 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1046887186 8:119380289-119380311 CCTCATAAAATGAGATAGGGAGG - Intergenic
1047083587 8:121492032-121492054 CCTAATAAACAGACAGAGCCAGG + Intergenic
1048381222 8:133866986-133867008 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1048587367 8:135787343-135787365 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1049429583 8:142553922-142553944 CCTCATAAACACAAAGAAGAAGG - Intergenic
1049796569 8:144499819-144499841 CCCCATAAACATGCATTGGATGG - Intronic
1050068007 9:1780982-1781004 CCTCATAAAATGACTTAGGGAGG + Intergenic
1050370084 9:4911971-4911993 CCACATTAACAGACTAAGGAAGG - Intergenic
1050675176 9:8044119-8044141 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1050699860 9:8326578-8326600 CCTCATAAAATGAGTTAGGAAGG + Intronic
1050700662 9:8335130-8335152 CCTCATAAAATGAGTTAGGAAGG - Intronic
1051435477 9:17026542-17026564 CATCGTGGACAGACATAGGAAGG + Intergenic
1051611295 9:18964280-18964302 CCTCATAAACGGAATTAGGGAGG + Intronic
1052257950 9:26481448-26481470 CCTCATAAAATGACTTAGGGAGG - Intergenic
1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG + Intergenic
1052579668 9:30339181-30339203 CCTCATAAAATGACTTAGGGAGG + Intergenic
1052724590 9:32214338-32214360 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1052992600 9:34529053-34529075 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1053521339 9:38782979-38783001 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1053628054 9:39897140-39897162 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1053834331 9:42118158-42118180 CCTCATAAAATGAGTTAGGAAGG - Intronic
1054215833 9:62353561-62353583 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1054671649 9:67801789-67801811 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1055705431 9:78995418-78995440 CCTCAAAAATGGACACAGGAAGG - Intergenic
1056439704 9:86608543-86608565 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1057109380 9:92452608-92452630 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1057121617 9:92580311-92580333 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1057848436 9:98544308-98544330 CCTCTGAAACAGACATGGAAAGG - Intronic
1058064195 9:100530718-100530740 CCTCATAAAAAGAGTTAGGAAGG - Intronic
1058338356 9:103862027-103862049 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1058943907 9:109839017-109839039 CCTCATAAAATGAGTTAGGAAGG - Intronic
1059602986 9:115801543-115801565 CCTCATAAAATGAGATAGGGAGG + Intergenic
1059954924 9:119505805-119505827 CCTCATAAAATGAGTTAGGAAGG - Intronic
1203778593 EBV:88036-88058 CCTCATAAACATACGTACGACGG - Intergenic
1203373904 Un_KI270442v1:346341-346363 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1185659161 X:1713147-1713169 ACTCAAAGACAGACAGAGGAGGG + Intergenic
1186066176 X:5767435-5767457 CCTCATAAAATGAGATAGGGAGG - Intergenic
1186177097 X:6936116-6936138 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1186436294 X:9545755-9545777 CCTCATAATTAAACATATGATGG + Intronic
1186914284 X:14203200-14203222 CCTCATAAAATGACTTAGGGAGG + Intergenic
1186956254 X:14685325-14685347 CCTCATAAAATGACTTAGGGAGG + Intronic
1187238584 X:17491629-17491651 CCTCATAAAATGAGTTAGGAAGG + Intronic
1187596130 X:20774796-20774818 CCTCATAAAATGACTTAGGGAGG - Intergenic
1187729888 X:22241909-22241931 CCTCATAAAATGAGTTAGGAAGG - Intronic
1187769588 X:22680443-22680465 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1187963734 X:24590514-24590536 CCAAATGAACAGACACAGGAGGG + Intronic
1188560897 X:31467674-31467696 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1189525160 X:41812221-41812243 CCTCATAAAATGAGTTAGGAAGG - Intronic
1190341043 X:49296026-49296048 CCTCATAAAATGAGTTAGGAAGG + Intronic
1190903431 X:54701113-54701135 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1190943613 X:55069552-55069574 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1191091863 X:56632083-56632105 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1191124169 X:56936670-56936692 CCTCATAAAATGACTTAGGGAGG + Intergenic
1191124512 X:56940397-56940419 CCTCATAAAATGACTTAGGGAGG + Intergenic
1191154333 X:57255407-57255429 CCTCATAAACTGAGTTAGGGAGG - Intergenic
1191643031 X:63448869-63448891 CCTCATAAAATGACTTAGGGAGG + Intergenic
1191705425 X:64089258-64089280 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1191768529 X:64729780-64729802 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1191874263 X:65778971-65778993 CCTCATAAAATGACTTAGGGAGG - Intergenic
1191950625 X:66587779-66587801 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1191990481 X:67029801-67029823 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1192010771 X:67270040-67270062 CCTCATAAAATGAGATAGGGAGG - Intergenic
1192352196 X:70365752-70365774 CCTCATAAAATGAGATAGGGAGG + Intronic
1192396217 X:70783958-70783980 CCTCATAAAATGAGATAGGGAGG - Intronic
1192701454 X:73478817-73478839 CCTCATAAAATGAATTAGGAAGG + Intergenic
1192910492 X:75599013-75599035 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1192960847 X:76129022-76129044 CCCAATAAAAAGACAAAGGATGG + Intergenic
1193036168 X:76953786-76953808 CCTCATAAAATGAGATAGGGAGG - Intergenic
1193113413 X:77752976-77752998 CCTCATAAAATGAGTTAGGAAGG + Intronic
1193157777 X:78192471-78192493 CCTCATAAAATGACTTAGGGAGG - Intergenic
1193582519 X:83283418-83283440 CCTCATAAAATGAAATAGGGAGG + Intergenic
1193782113 X:85716171-85716193 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1193949663 X:87782036-87782058 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1194222544 X:91213607-91213629 CTTCATATAGAGACAGAGGAAGG + Intergenic
1194227448 X:91278956-91278978 CCTAATAAACAGGCATAGCTGGG + Intergenic
1194404524 X:93478202-93478224 CCTCAAAAAAAGACAGAGTAAGG + Intergenic
1194436875 X:93877322-93877344 CCTCATAAAATGACTTAGGGAGG - Intergenic
1195123580 X:101782108-101782130 CCTCCTAAATAGAAATAGAAGGG + Intergenic
1195261376 X:103135013-103135035 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1195508587 X:105687706-105687728 CCTCATAAACTGAGTTAGGGAGG - Intronic
1195602829 X:106768224-106768246 CCTCATAAAATGAGTTAGGAAGG + Intronic
1195661045 X:107378532-107378554 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1195831968 X:109069146-109069168 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1195874361 X:109523230-109523252 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1196359244 X:114833209-114833231 CCTCATAAAATGACTTAGGGAGG + Intronic
1196546240 X:116967325-116967347 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1197676970 X:129340540-129340562 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1197681513 X:129390449-129390471 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1198544393 X:137675728-137675750 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1198660053 X:138958530-138958552 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1198669719 X:139066758-139066780 CCTCATAAAATGATTTAGGAAGG - Intronic
1198758325 X:140004078-140004100 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1198888638 X:141367513-141367535 CCTAATTAAAAGACATAGAATGG + Intergenic
1198939393 X:141936204-141936226 CCTAATAAACAGCCATAGGTAGG - Intergenic
1199829683 X:151537242-151537264 CCTAGTAAACAGACATAGGTGGG + Intergenic
1200733738 Y:6771497-6771519 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1200847208 Y:7842955-7842977 CCTCATAAACTGAGTTAGGGAGG - Intergenic
1201021329 Y:9660641-9660663 CCTCATAAAGTGACTTAGGGTGG - Intergenic
1201238600 Y:11935820-11935842 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1201244633 Y:11991126-11991148 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1202026713 Y:20531819-20531841 CCTCATAAAATGAGTTAGGAAGG - Intergenic
1202077359 Y:21050276-21050298 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1202087929 Y:21158341-21158363 CCTCATAAAATGAGTTAGGAAGG + Intergenic
1202329490 Y:23732129-23732151 CCTCATAAAATGACTTAGGGAGG + Intergenic
1202541281 Y:25937925-25937947 CCTCATAAAATGACTTAGGGAGG - Intergenic