ID: 1143688496

View in Genome Browser
Species Human (GRCh38)
Location 17:8539313-8539335
Sequence CATTCCAGGGATGAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143688496 Original CRISPR CATTCCAGGGATGAGTTTTA TGG (reversed) Intronic
903156673 1:21449256-21449278 CATTCTAGGGATGTTTTTTGGGG + Intronic
903771250 1:25765794-25765816 AATTCCTGGGTTGAGTTTTCTGG - Intronic
905910490 1:41650054-41650076 CATTCCAAGGGTGAATCTTAAGG - Intronic
906730077 1:48073446-48073468 CATTCCAGGAATGAGTTTTGAGG - Intergenic
907099660 1:51818051-51818073 CATTACAGGTAAGAGTTTAAGGG - Exonic
907990592 1:59578660-59578682 CATTCCTGGGATGAAATTTCAGG - Intronic
908608000 1:65821806-65821828 ATATCCAGGGATAAGTTTTAAGG - Intronic
909026150 1:70484481-70484503 CTTTCCAGGTATGGGTTATATGG - Intergenic
909100398 1:71341782-71341804 CACTCCAGGGCTAAGTTTTTTGG - Intergenic
910441526 1:87257715-87257737 CATTAAAGGGGTGAATTTTATGG - Intergenic
912671304 1:111629034-111629056 CCTTACAGTGAAGAGTTTTAAGG - Intronic
913601333 1:120424241-120424263 CATTCTAGGGATGGTTTTTGGGG + Intergenic
913992902 1:143631411-143631433 CATTCTAGGGATGATTTTTGGGG - Intergenic
914085713 1:144452354-144452376 CATTCTAGGGATGGTTTTTGGGG - Intronic
914191608 1:145416335-145416357 CATTCTAGGGATGGTTTTTGGGG - Intergenic
914362519 1:146947799-146947821 CATTCTAGGGATGGTTTTTGGGG + Intronic
914589536 1:149094337-149094359 CATTCTAGGGATGGTTTTTGGGG - Intronic
918322380 1:183376663-183376685 AATTCCAGGTTTGAATTTTATGG - Intronic
919326905 1:196119525-196119547 CATTTCAGGGATGAGAATTAAGG + Intergenic
919422551 1:197388708-197388730 CATTTCAGGGGTGAATTTCATGG - Intronic
919902104 1:202051608-202051630 CATTTAAAGGATGAATTTTATGG - Intergenic
920879871 1:209869895-209869917 GATTCCTGGGATGAGTTTGAGGG - Intergenic
921232322 1:213085406-213085428 GGTTCCAGGGATTAGCTTTAGGG + Intronic
1070972450 10:80578754-80578776 GATTCAAGTGATGAGTTTTCAGG + Intronic
1072894239 10:99351995-99352017 CTTTAAAAGGATGAGTTTTATGG - Intronic
1075907519 10:126094441-126094463 CATTCAATGGAAGAGTTTTGTGG - Intronic
1075920995 10:126212936-126212958 CATTCAAAGGCTGTGTTTTATGG - Intronic
1077174072 11:1180849-1180871 CTTTCCAGGGGTGATTTTAATGG - Intronic
1078290555 11:10006430-10006452 CGGTCCAGGGCTGAGTTTTCCGG + Intronic
1078461177 11:11516263-11516285 CATTCCAGGGATGGGCTATTTGG - Intronic
1078562318 11:12383929-12383951 AAATCCAGGGAAGGGTTTTAGGG - Intronic
1079120637 11:17682113-17682135 GATTACAGGCATGAGTTCTAAGG - Intergenic
1080638281 11:34142450-34142472 CTTTCATGGGATCAGTTTTAGGG + Intronic
1084509181 11:69592487-69592509 GATTCCAGGAATGAGATTCAAGG + Intergenic
1084795979 11:71504356-71504378 CATGTCAGTGATGAGGTTTAAGG - Intronic
1085196790 11:74677403-74677425 CATTCAGGGGAAGAGTGTTAGGG + Intergenic
1085997924 11:81943965-81943987 CATTCCAGGTATGCAATTTAAGG - Intergenic
1088099947 11:106143977-106143999 CAACCCAGGGATGAGTCTGAAGG - Intergenic
1090516124 11:127429149-127429171 CATTCCATTGAGAAGTTTTATGG - Intergenic
1091984268 12:4895300-4895322 CATTTAAGGGCTGTGTTTTAAGG + Intergenic
1092536937 12:9397926-9397948 CCTTCCAGGGAACAGTTGTATGG + Intergenic
1093138840 12:15483265-15483287 AATTCCATGGATGACTTTTCAGG + Intronic
1094513553 12:31112528-31112550 CCTTCCAGGGAACAGTTGTATGG + Intergenic
1095789799 12:46152641-46152663 CATTGGAGAGTTGAGTTTTAAGG + Intergenic
1095916589 12:47486331-47486353 CATGCCAGGCATGGGTTTGAAGG + Intergenic
1098366974 12:69713918-69713940 AAGTCCAAGGATGAATTTTAGGG - Intergenic
1099437132 12:82658415-82658437 CACCCCAGGGCTGAGTTTTCTGG - Intergenic
1099718877 12:86335580-86335602 CAATCTAGAGATGATTTTTAAGG - Intronic
1100872929 12:98931039-98931061 CATTTCAGGAATGGCTTTTAAGG + Intronic
1101623626 12:106416703-106416725 AATTCCATGGAGGAGTTTCAGGG - Intronic
1103764858 12:123272377-123272399 CGATTCAGGGATGAGTTTTCCGG - Intergenic
1106307809 13:28528998-28529020 CATTCCATGGATGTGCTTCAAGG - Intergenic
1106572805 13:30943115-30943137 CATCCCATGGATGTGTTTCATGG - Intronic
1106953427 13:34909488-34909510 AATTTTAGTGATGAGTTTTAAGG + Intergenic
1108721251 13:53135051-53135073 CATTCTAGAAATGAGTTCTATGG + Intergenic
1108794264 13:54012149-54012171 AATTTCAAGAATGAGTTTTAGGG + Intergenic
1108804519 13:54137928-54137950 CATTCCAGGCAGAAGTTATAGGG + Intergenic
1109035006 13:57246066-57246088 CATTCCAGAGAGTAGGTTTAGGG + Intergenic
1109433476 13:62267693-62267715 CATTCAAGATATGAGTTTTAGGG - Intergenic
1109535908 13:63719189-63719211 CAGTCCTGGGATAAGTCTTAGGG - Intergenic
1109540193 13:63767097-63767119 CAGTCCTGGGATAAGTCTTAGGG + Intergenic
1109981152 13:69909644-69909666 CATTCCATGCATGAGTTCTGGGG + Intronic
1111174568 13:84578087-84578109 CACTCCAGGAATGAGAATTACGG - Intergenic
1111678278 13:91413855-91413877 GTTTCCAGGGATGATTTTTGAGG - Intronic
1112171897 13:96982322-96982344 AATTCAATGGATGAGTTTAATGG + Intergenic
1113111972 13:106833048-106833070 AGTTCTAGAGATGAGTTTTAAGG - Intergenic
1114978629 14:28133755-28133777 GGCACCAGGGATGAGTTTTATGG + Intergenic
1115419251 14:33174403-33174425 CATTCCAGGAATAAGTTATTTGG - Intronic
1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG + Intergenic
1117303188 14:54448174-54448196 AGTACCATGGATGAGTTTTACGG + Intergenic
1120598871 14:86475316-86475338 TATTCCAGGAAGGAGTTTAAAGG + Intergenic
1122471477 14:101969991-101970013 CACTGCAGAGATGAGTTTTTAGG - Intronic
1122519178 14:102331111-102331133 CTTTCAAAGGATGAATTTTATGG + Intronic
1125225408 15:37389881-37389903 CATTCCAGGGATGAATGTCTAGG - Intergenic
1125557870 15:40601318-40601340 CAAACCAGGGATCAGTTTTAGGG - Intronic
1127603109 15:60558292-60558314 CGTTCCAGGGATGAACTTTTTGG - Exonic
1136051447 16:27653473-27653495 CGTTCCAGTGATGAGACTTAGGG + Intronic
1137432774 16:48432032-48432054 CCTTCCAAGGATGGGCTTTAGGG - Intronic
1137759388 16:50928138-50928160 CATTTGAGGGATGGGTTTTCTGG + Intergenic
1142553596 17:756505-756527 CTTTCCAGAGAGGATTTTTAGGG - Intergenic
1143112796 17:4562003-4562025 GATTCAAAGGATGATTTTTATGG - Intergenic
1143305686 17:5944957-5944979 CATTCCAGGGATGTGATGAAAGG - Intronic
1143688496 17:8539313-8539335 CATTCCAGGGATGAGTTTTATGG - Intronic
1147772080 17:42874714-42874736 CTTTAAAGGGATGAATTTTATGG - Intergenic
1148201265 17:45751479-45751501 TATTCCAGGTATGAATTTTATGG + Intergenic
1151149834 17:72075605-72075627 CTTTCCAGCGTTGACTTTTATGG - Intergenic
1152296454 17:79469968-79469990 ACTGCCAGGGATGTGTTTTAGGG - Intronic
1152935020 17:83131630-83131652 CCTTCCAGGGATAAGTATCAAGG - Intergenic
1156634400 18:39010247-39010269 TATTCCAGGGTTGAGATTTGTGG - Intergenic
1157263568 18:46197083-46197105 CATTCGAGGGAGGAGAATTAAGG + Intronic
1158713326 18:59856301-59856323 CTTTAAAGGGGTGAGTTTTATGG - Intergenic
1160266192 18:77342240-77342262 GATTCTAGGGCTGAGATTTAAGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162117983 19:8443518-8443540 CATTCGTGGCATCAGTTTTATGG - Intronic
1163404323 19:17112932-17112954 CATTTCAGGGATGAGATTCAGGG + Intronic
1167974592 19:53214622-53214644 GATTCCTGGTATGAGTTCTATGG - Intergenic
1168536524 19:57174856-57174878 CATTCTAGAAATGAGTTCTAGGG + Intergenic
931880375 2:66563094-66563116 CATTCCATATCTGAGTTTTAAGG + Intronic
932942203 2:76180766-76180788 CATTCTAGGGAGGACTTGTATGG + Intergenic
940358870 2:152775961-152775983 CATACCAAGGATGTGATTTATGG + Intergenic
942205544 2:173616940-173616962 AAATCCATGGATGAGCTTTAAGG - Intergenic
942950855 2:181719661-181719683 CCTTCCACAGATTAGTTTTAGGG + Intergenic
942978735 2:182052225-182052247 CTTTCCTAGGATTAGTTTTAAGG + Intronic
945262610 2:207858814-207858836 CTTTAAAGGGGTGAGTTTTATGG - Intronic
945299281 2:208200735-208200757 GAATCCTGGGATGAGTTTTGAGG - Intergenic
947050818 2:226040694-226040716 CATTCAAGGGAAGAGCTTTCTGG - Intergenic
1169298797 20:4424031-4424053 CACTCCGGGGATGAAGTTTAGGG - Intergenic
1171249185 20:23635835-23635857 CATTCCAGGTGTGATTTTCAAGG + Intronic
1171278512 20:23878267-23878289 CATTCCAGGTGTGATTTTCAAGG + Intronic
1174765662 20:53251680-53251702 CAGTCTAGCCATGAGTTTTATGG - Intronic
1179007321 21:37527272-37527294 CAGTCCAGAGATGAGTTTGCAGG + Intergenic
1179043598 21:37826245-37826267 CAATCAAGGGATGACTTTGAAGG - Intronic
951698772 3:25473288-25473310 TTTTTCAGGGATGAGTTCTAGGG - Intronic
953084374 3:39652645-39652667 CATTCCAAGGAGGACTTTCAAGG + Intergenic
954038655 3:47867777-47867799 CATTCCAGGGCCCAGATTTAAGG - Intronic
958833604 3:99118126-99118148 CATTCCTGGAAAGAGTTTTGAGG + Intergenic
958891959 3:99794041-99794063 CATGCCAGGCCTGATTTTTAAGG + Intronic
959666976 3:108933385-108933407 GATTCCAGGGAAAAGTTTAATGG + Intronic
959884445 3:111482468-111482490 CATACCAGGGGTGACTTATAAGG + Intronic
962174951 3:133143199-133143221 CATTCCAGGGGTGAATTGAAAGG + Intronic
962395393 3:135011227-135011249 CATTGCAGTGGTCAGTTTTAGGG + Intronic
965702413 3:171471471-171471493 AATTACATGGATGATTTTTAAGG + Intergenic
968680107 4:1912556-1912578 CATAATAAGGATGAGTTTTAAGG - Intronic
969528138 4:7714557-7714579 CACTCCAGGAAGGAGCTTTAAGG + Intronic
970733360 4:19135837-19135859 CATTCATGGGTAGAGTTTTACGG + Intergenic
974341252 4:60617133-60617155 CATTCTAGGTATGGGTTTAAGGG - Intergenic
975302642 4:72808426-72808448 CATTCCAACAAAGAGTTTTAAGG + Intergenic
978275620 4:106946361-106946383 CTTCCCAGGGATCATTTTTAAGG - Intronic
978963846 4:114717709-114717731 AATTCCAGGTGTGTGTTTTATGG - Intergenic
980382515 4:132042004-132042026 GATTCAATGGGTGAGTTTTATGG - Intergenic
982251505 4:153412199-153412221 CATTTCTGGAATGAATTTTATGG - Intronic
982487769 4:155988739-155988761 TTTACCAGTGATGAGTTTTAAGG + Intergenic
985393610 4:189517167-189517189 CATTCAAGGGAAGAATTTTCAGG + Intergenic
987104001 5:14618949-14618971 CATTCCAGGGATGAGGAGTGGGG - Intergenic
988563464 5:32301301-32301323 GATCCCAGGGATGAGTTGTTTGG - Intronic
988940989 5:36147308-36147330 CATTCAAGTGATGAGTTGCAAGG + Intronic
990063470 5:51681724-51681746 TATTGCAGGGAAGAGTTTTGGGG - Intergenic
990173785 5:53084440-53084462 GACTCCAGGGATGAGTTTGGAGG - Intronic
990515413 5:56527151-56527173 CATTCCAGGCTGCAGTTTTAGGG + Intronic
991976083 5:72184836-72184858 CTTTAAAGGGATGAATTTTATGG - Intronic
992366328 5:76093858-76093880 TATTCCAAGGAACAGTTTTAAGG + Intronic
993016228 5:82537568-82537590 CATTGCAGAAATGAGTTTAATGG - Intergenic
998486813 5:142510072-142510094 CATTCCAGGGATGAATGTAGTGG + Intergenic
999189303 5:149734652-149734674 GAATCCAGGAATGAGTTTGATGG - Intronic
999860107 5:155635823-155635845 CATTCCAGTGCTGACTTTGAAGG + Intergenic
1000004631 5:157171777-157171799 CTTTCAATGGATGAATTTTATGG + Intronic
1001153146 5:169249700-169249722 AATTCCATGGTTCAGTTTTAGGG - Intronic
1001831959 5:174796561-174796583 CATTCCATGGATATGTTTTAGGG + Intergenic
1003882378 6:10490352-10490374 CATTCCATGGATGAGTTACTGGG - Intergenic
1007775666 6:44223269-44223291 CAGTCCCGAGATGAATTTTATGG + Intronic
1013016062 6:106161435-106161457 AATTCCAGGGTTGCTTTTTAGGG + Intergenic
1016931439 6:149414575-149414597 CAATCCATGGATGAGTTCAAAGG - Intergenic
1017714426 6:157198803-157198825 CATTCCAGGCATGAACCTTATGG + Exonic
1021687326 7:23199754-23199776 CATTTTAGGAATGAGTTTTCAGG + Intronic
1021909231 7:25367760-25367782 CATTCCAGGCAGAAGCTTTAGGG - Intergenic
1023774961 7:43596887-43596909 GATTACAGGCATGAGTATTAAGG - Intronic
1024756430 7:52538578-52538600 TCTTCCAGGGATGAGTCTTTGGG + Intergenic
1027527481 7:79288568-79288590 GATTCCAGGAATGTGTTCTAAGG - Intronic
1030629771 7:111883236-111883258 CTTGCCAGGGATGAGATTGAGGG - Intronic
1030863135 7:114662369-114662391 CAGTCCTGTGATGATTTTTACGG - Intronic
1031933944 7:127716237-127716259 AATCCCAGTGATGATTTTTATGG - Intronic
1034648786 7:152673150-152673172 GATTCTAGGGATGAAGTTTATGG - Intronic
1037418795 8:18679634-18679656 CATTTTAGGGATGAGTCTTGGGG + Intronic
1040419591 8:47226323-47226345 TATTACATGGATGAATTTTAAGG - Intergenic
1041368679 8:57135929-57135951 CATTCAAGGTTAGAGTTTTATGG - Intergenic
1044233115 8:89801585-89801607 CAAGGCAGGGATCAGTTTTAGGG - Intergenic
1045720371 8:105102744-105102766 CATTCCAGGAGTGAGTTACAAGG - Intronic
1047042215 8:121008545-121008567 CTTTCCAGGGATCAGTTTTGTGG - Intergenic
1047786159 8:128155727-128155749 CATCCCAGGGATGAGCTGTCAGG - Intergenic
1048417869 8:134246635-134246657 CATCCCTGGGATGAGTCTGATGG - Intergenic
1051315803 9:15830105-15830127 CATTCCAGCAAGGATTTTTATGG - Intronic
1052693168 9:31842400-31842422 AATTCCTAGGATGAGTTTAATGG - Intergenic
1058828999 9:108798790-108798812 GATTCAGGGGATGATTTTTAAGG - Intergenic
1059521086 9:114942910-114942932 GATTCCAGGGAAGACTTTTGGGG + Intergenic
1189230940 X:39451763-39451785 CAGTCCAGGGGTGAGTTGGAGGG - Intergenic
1192046835 X:67684499-67684521 CATTCCAAGGAGGAGTTCCAGGG - Intronic
1194384974 X:93241498-93241520 CATTCCTTGTTTGAGTTTTAGGG - Intergenic
1195765729 X:108294882-108294904 CATTCAAGGGGTGAGCTTTATGG + Intronic
1198721331 X:139624266-139624288 GATTCCAGGCATGAGCTATAAGG - Intronic