ID: 1143689125

View in Genome Browser
Species Human (GRCh38)
Location 17:8545916-8545938
Sequence CAGCACAAGGACAAGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143689116_1143689125 28 Left 1143689116 17:8545865-8545887 CCGCCTGGATTCAGCTCAGTTAA 0: 1
1: 0
2: 1
3: 5
4: 174
Right 1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 188
1143689117_1143689125 25 Left 1143689117 17:8545868-8545890 CCTGGATTCAGCTCAGTTAAGCT 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143689125 Original CRISPR CAGCACAAGGACAAGGCGGC AGG Intronic
901948425 1:12722081-12722103 CAGCACGAGGCCAAGGTGGGTGG + Intronic
902637605 1:17744844-17744866 CAGCACATGCTCAAGGAGGCAGG - Intergenic
903190465 1:21652993-21653015 GGGCACAAGGACAGGGCAGCAGG + Intronic
903283461 1:22263184-22263206 CAGCGCCAGGTCAAGGCAGCTGG + Intergenic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG + Exonic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
906646579 1:47479393-47479415 GAGGAGAAGGACAAGGCAGCGGG - Intergenic
911534961 1:99089248-99089270 CAGCACAAGGACCCTGGGGCTGG - Intergenic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
913231275 1:116742506-116742528 CAGCACAAGCAGAAGGCGCTCGG - Intergenic
913451575 1:118996394-118996416 CAGCAAAAGGATAATGGGGCAGG + Intergenic
914007226 1:143742950-143742972 CAGCACAGAGACAAAGAGGCTGG - Intergenic
914646043 1:149653444-149653466 CAGCACAGAGACAAAGAGGCTGG - Intergenic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
919927690 1:202200825-202200847 CAGCAAAAGGACATGGTGGGGGG + Intronic
920114046 1:203607339-203607361 CAGCACAAGGACACCGGGGCGGG + Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922751927 1:228074056-228074078 CAGCACAAGAACAAGGGAGGAGG - Exonic
922902813 1:229150616-229150638 CAACACAAGGGAAAGGCTGCGGG - Intergenic
1064961006 10:20964934-20964956 CAACACATGGACACGGGGGCTGG - Intronic
1071571679 10:86700648-86700670 CAGGACTAGGACAAGGCCACAGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1076304643 10:129456356-129456378 CAGCACAAAGACAAGAGAGCAGG - Intergenic
1076350441 10:129811546-129811568 CAGCACCGGGAGAAGGGGGCAGG - Intergenic
1076633200 10:131865366-131865388 CTCCACAAGGCCAAGGGGGCTGG + Intergenic
1078948493 11:16099994-16100016 GAGAACAAGGACAAGGCAGGAGG + Intronic
1079250221 11:18781561-18781583 CAGCACCAGGCCGAGGCGGGTGG - Intronic
1080737453 11:35030740-35030762 GAGCACAAGGACAGGCCTGCTGG - Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081907190 11:46677552-46677574 CTCCCCAAGGACAAGGCTGCAGG + Exonic
1083825433 11:65200637-65200659 CAAAAAAAGAACAAGGCGGCCGG - Intronic
1087571628 11:99934639-99934661 CAGCACAAGGCCATGGTGGGTGG + Intronic
1087820285 11:102704042-102704064 CATCTCAAGGAAAAGGGGGCAGG - Intronic
1088178767 11:107084876-107084898 CAGGACAAGGACAAGGCTCAGGG - Intergenic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092757655 12:11778572-11778594 CTCCACAAGGAAAAGGCAGCAGG - Intronic
1094360038 12:29620796-29620818 CAGCACAGGAAAAAGGTGGCAGG + Intronic
1095096492 12:38152142-38152164 CAGCACAGGGAAAAAGCGGTGGG + Intergenic
1102283365 12:111635703-111635725 CAGCACAATGACTGGGCGGTAGG + Intergenic
1102630838 12:114278078-114278100 CAGCCCAATGACATGGCAGCTGG + Intergenic
1103747715 12:123137279-123137301 CAGCTCCAGGAAAAGGTGGCAGG - Intronic
1103949467 12:124543113-124543135 CAGACCAAGGCCAAGGGGGCTGG + Intronic
1104907284 12:132220095-132220117 CAGCAAAATGACAAGGCAGCTGG + Intronic
1106987209 13:35369324-35369346 CAGAAAAAGGACAAAGCTGCAGG - Intronic
1112543639 13:100342649-100342671 CACCACAAGCAAAAGGAGGCAGG - Intronic
1113453863 13:110433282-110433304 CAGAAATAGGACCAGGCGGCCGG + Intronic
1115968247 14:38916010-38916032 CAGCACAGGGACCATGGGGCTGG + Intergenic
1118774684 14:68966454-68966476 CAGCACTAGGACAAGACCTCGGG + Intronic
1119798548 14:77422010-77422032 CAGCACATGTCCAAGGAGGCAGG - Intronic
1120779293 14:88471827-88471849 CAACACAAGGTCAAGGCTGTAGG + Intronic
1121137944 14:91515206-91515228 AAGGACAGGGACAAGGCTGCTGG + Intergenic
1122671969 14:103379487-103379509 CAGGACAAGGACAAGGACCCTGG + Intergenic
1124365870 15:29071407-29071429 CATCACTCGGAGAAGGCGGCAGG - Intronic
1125433978 15:39626394-39626416 CAGCACCAGTACAAGGTGGAGGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1128376864 15:67083015-67083037 CTCCACCAGGACAAGACGGCAGG - Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1130878173 15:88032227-88032249 CAGCAGAAGGACAAGGAGAGGGG + Intronic
1131463694 15:92637873-92637895 CAGCTCAAGGACAAAGCACCTGG + Intronic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1137476244 16:48811788-48811810 CAGCATTAGAACAAGGCGGCAGG - Intergenic
1138474713 16:57263931-57263953 CAGCCCAAGGACAAGTCAGTGGG + Intronic
1141935102 16:87233219-87233241 CAGCACTATGCCAAGGAGGCAGG + Intronic
1143203269 17:5126794-5126816 CGGCACAAGCACAGGGCTGCAGG + Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1143953992 17:10654807-10654829 AAGCACAAGGACCAGGTGGAGGG + Intronic
1144745599 17:17612124-17612146 AAGCACCAGGACAGGGCAGCAGG - Intergenic
1144874435 17:18390119-18390141 CGGCACAAGCACAGGGCTGCAGG + Intergenic
1145157790 17:20554301-20554323 CGGCACAAGCACAGGGCTGCAGG - Intergenic
1145810363 17:27760610-27760632 CAGCACAAGGGTAAGGCTGGAGG - Exonic
1147422817 17:40331079-40331101 CAGCTCCAGGACAGGGCGGGTGG + Exonic
1147788081 17:42994622-42994644 CTGCCAAAGGACAAGGCTGCAGG + Intergenic
1147937788 17:44023536-44023558 CAGAGCAAGGTCAAGGCAGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149848723 17:60022356-60022378 CGGCACAAGCACAGGGCTGCAGG - Intergenic
1149861446 17:60124168-60124190 CGGCACAAGCACAGGGCTGCAGG + Intergenic
1150614002 17:66754969-66754991 CAGCACACGGATTTGGCGGCGGG + Intronic
1151223094 17:72628024-72628046 CAGCACAAGGACCAGAAGACAGG + Intergenic
1151730293 17:75907080-75907102 AAACAAAAGGACAAGGTGGCCGG - Intronic
1152673627 17:81624830-81624852 AAGCACAAAGACCAGGAGGCAGG + Intronic
1153983996 18:10336832-10336854 CAGCACAAGGGAATGGCGGGCGG - Intergenic
1156527292 18:37778751-37778773 CAGGACTAGGAAAAGGCGTCGGG + Intergenic
1158849590 18:61482093-61482115 CAGCACCAGGACAGGGAAGCTGG + Intronic
1160908984 19:1466192-1466214 CAGGTCAAGGTCAAGCCGGCTGG - Exonic
1163006188 19:14397945-14397967 CCCCACAGGGACGAGGCGGCGGG + Intronic
1163061556 19:14765492-14765514 CCCCACAGGGACGAGGCGGCGGG - Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1166279116 19:41778765-41778787 TAAAACAAGGACAAAGCGGCCGG - Intergenic
1166821201 19:45581377-45581399 CAACACCAGGACAAGGCGTAAGG - Intronic
1167750404 19:51375992-51376014 GAGCACAAAGGCAAGGCAGCTGG + Intergenic
1168352468 19:55684557-55684579 GAGCAAAAGGACAGGGCGGAGGG - Intronic
925083765 2:1091492-1091514 CATCATAAGGTCATGGCGGCCGG + Intronic
925721967 2:6838280-6838302 CATCACATGTACAAGGAGGCAGG + Intergenic
926309762 2:11667038-11667060 CAGGACAAGAACATGGCTGCTGG - Intronic
927173869 2:20392012-20392034 CAGCAGAGGTACAAGGGGGCTGG - Intergenic
928859466 2:35839455-35839477 CATTGCAAGGACAAGGCTGCAGG - Intergenic
928952336 2:36824181-36824203 CAGCACAAAAACAAGGAGCCAGG - Intergenic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932685668 2:73867299-73867321 CAGCAGGAGGCCAAGGCGGGTGG + Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
935627081 2:105180349-105180371 AAGCACAAGACCAATGCGGCCGG + Intergenic
937217088 2:120319601-120319623 CAGCACAAGGTGAAGCTGGCTGG + Intergenic
937346676 2:121130366-121130388 CATCACCAGGTCAAGGCTGCTGG + Intergenic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
944817882 2:203397825-203397847 GAGCAAGAGGACAAGGCGGGAGG + Intronic
945182675 2:207107712-207107734 CAGCACAAAGAAGAGCCGGCTGG - Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946578709 2:221103940-221103962 GAGCACAACGCCAAGGAGGCAGG - Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1171069977 20:22059124-22059146 GAGCACAAGGACAAGAAGGGTGG - Intergenic
1172379204 20:34474758-34474780 CACCTCCAGGACAGGGCGGCTGG + Intronic
1173780992 20:45757311-45757333 CAGCACAAGGCCAAGGCAGGTGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1176377562 21:6094050-6094072 CAGCACATGGAGAACGCGGCAGG - Intergenic
1177588995 21:23137071-23137093 CAGCACAATCACAAGGGGGGGGG + Intergenic
1178893360 21:36538905-36538927 CAGCACCAGGTCAAGGCTGCAGG + Intronic
1179519548 21:41933069-41933091 CAAGACAGGGACAAGGCCGCCGG - Intronic
1179745913 21:43444194-43444216 CAGCATATGGAGAACGCGGCAGG + Intergenic
1183300936 22:37058910-37058932 CAGCCCCAGGACAAGGTTGCAGG - Intronic
1183511960 22:38241161-38241183 CAGCACAGGGAGAAGGCACCAGG + Intronic
1184051540 22:42009157-42009179 CAGCACAAGGCCAAGGTGGGTGG - Intronic
1184589361 22:45471220-45471242 AAGCACAAGGAAAAAGCAGCTGG - Intergenic
1184677647 22:46052495-46052517 CACCACAAGGACAACGAGTCTGG + Intronic
950344719 3:12282630-12282652 CAGCACTAGGCCAAGGTGGCCGG - Intergenic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
952807732 3:37372976-37372998 CAGGACAAGGACAGAGCTGCAGG - Intergenic
954372099 3:50174358-50174380 CAGCACAGGGCCAGGGTGGCTGG - Intronic
954444853 3:50541086-50541108 CAGGGCAAGGACTAGGCTGCTGG + Intergenic
955362791 3:58289830-58289852 CACCACCCGGACAGGGCGGCTGG + Intronic
956678480 3:71755707-71755729 CAGCACAAGGACCCTGCAGCCGG - Exonic
959619771 3:108387220-108387242 AACCACCAGGACAAGGAGGCAGG - Intronic
960034915 3:113092780-113092802 CAGCCCAAGGGTAAGGCGGTAGG - Intergenic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
963770216 3:149380418-149380440 CACCTCCCGGACAAGGCGGCTGG - Intergenic
963770266 3:149380545-149380567 CACCTCCCGGACAAGGCGGCTGG - Intergenic
963770316 3:149380672-149380694 CACCTCCCGGACAAGGCGGCTGG - Intergenic
967852541 3:194093260-194093282 CAGGACAAGGACTAGCCGGCAGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968435687 4:587687-587709 CAGCTCCAGGGCAAGGCAGCAGG - Intergenic
968917512 4:3503041-3503063 CAGCACGAGGACAGGGCGTGGGG - Intergenic
969173060 4:5379321-5379343 CAGCACAGAGACAAGGCTGCTGG - Intronic
976336596 4:83894956-83894978 CAGCACAATGCCAAAGCAGCTGG - Intergenic
978224303 4:106315953-106315975 AAGCACAAAGACAAGGGGGATGG + Intronic
979622441 4:122812164-122812186 CACCTCCTGGACAAGGCGGCTGG - Intergenic
979622488 4:122812291-122812313 CACCTCCTGGACAAGGCGGCTGG - Intergenic
981702955 4:147627141-147627163 CAGGACAAGGACAAGGCCCAAGG + Intronic
987110747 5:14684294-14684316 CAACACAAGGACAAGTCCTCTGG - Intronic
987142486 5:14960204-14960226 CAGCCCAGAGACAAGGCCGCCGG - Intergenic
987425056 5:17763575-17763597 CAGCACAAGCACAAAGAGGTGGG - Intergenic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
998869149 5:146535276-146535298 AAACACAAGGCCAAGGTGGCTGG - Intergenic
999248475 5:150167692-150167714 CAGCCCTAGGCAAAGGCGGCAGG + Intronic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003897026 6:10617293-10617315 CAGCACTCGGAGAAGCCGGCCGG - Intronic
1004008523 6:11658749-11658771 CATCCAAAGGACAAGGCAGCTGG - Intergenic
1004375802 6:15089832-15089854 AAGCAGAAGGACAGGGTGGCAGG + Intergenic
1006167948 6:32076392-32076414 CAGCAAAAGGACGAAGCAGCTGG - Intronic
1008294776 6:49762075-49762097 CAGCAAGAGAACAAGGCGGTAGG + Intergenic
1008960448 6:57260844-57260866 CAGCAGAAGGAAAAGTCAGCAGG + Intergenic
1010198737 6:73264434-73264456 CAGTACAGGAACAAGGAGGCAGG + Intronic
1017611459 6:156190789-156190811 CAGCACAAGGTGAAGAAGGCCGG - Intergenic
1018939588 6:168300219-168300241 CAGCACCAGGACAAGGGCGATGG + Intronic
1019181135 6:170187841-170187863 CAGCTCAGGGACAAGGGGCCCGG - Intergenic
1019310781 7:359672-359694 CTGCACAGGTACAAGGTGGCGGG + Intergenic
1019602367 7:1891116-1891138 CAGCACAAGGACGAGGGGTGCGG + Intronic
1020239504 7:6382236-6382258 CAGCAAGAGGCCAAGGCGGGTGG - Intronic
1025071580 7:55904216-55904238 CAGCACCAGGCCGAGGCGGGTGG + Intronic
1029334431 7:99888080-99888102 CACCTCCCGGACAAGGCGGCTGG + Intronic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1033652545 7:143353759-143353781 CAACACAAGGACAAGAAGGAAGG + Exonic
1034413857 7:150955036-150955058 CAGGACCAGGAGAAGCCGGCAGG - Intronic
1034614186 7:152400813-152400835 CAGCACAAAAACAAGGCAACAGG + Intronic
1035068495 7:156124555-156124577 CAGCACAAGGAGGTGGGGGCGGG - Intergenic
1035396330 7:158537434-158537456 CAGCCCAAGGACAGGCCAGCGGG + Intronic
1035608702 8:946917-946939 CGGCAGCAGGACAGGGCGGCCGG - Intergenic
1036064904 8:5369022-5369044 AATCACAAAGACAAGGGGGCAGG - Intergenic
1044337788 8:91008037-91008059 CAGCAAAAGGAAAAGGCAGATGG - Intronic
1045352344 8:101353200-101353222 CAACACAGGGACCAGGTGGCAGG + Intergenic
1047615451 8:126558622-126558644 CAGCACCAGCCCCAGGCGGCGGG - Intergenic
1048976099 8:139673954-139673976 TAGCACAAGGCCAGGGCGGTGGG - Intronic
1049204476 8:141357324-141357346 CAGCGCAAAGACACGGCAGCAGG + Exonic
1049266714 8:141671513-141671535 CACCCCAAGTACAAGGCAGCTGG - Intergenic
1051016467 9:12481648-12481670 CAGAACAAAGACAGGTCGGCAGG + Intergenic
1052414268 9:28157401-28157423 CAGCACAAGGACACTGGGCCTGG + Intronic
1055964391 9:81851301-81851323 CATCAAAAGGATAAGGCGACAGG - Intergenic
1056476971 9:86962319-86962341 CAGCACCAGGACACGGCAGATGG - Intergenic
1056760143 9:89408740-89408762 CAGCACATGGACCAGGCCACTGG - Intronic
1057682729 9:97205347-97205369 AAGCACAAGCACAAGGGGTCAGG + Intergenic
1059277727 9:113109786-113109808 GAGCACAAAGACAATGCTGCAGG + Intergenic
1059278524 9:113114765-113114787 GAGCACAAAGACAATGCTGCAGG - Intergenic
1061483393 9:130908432-130908454 AAAGATAAGGACAAGGCGGCAGG - Intronic
1061862371 9:133474686-133474708 CAACACGAGGCCAAGGCGGGAGG - Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062547884 9:137071789-137071811 CAGCACGAGGCCGAGGCGGGAGG + Intergenic
1185790921 X:2928214-2928236 CGGCACAAGGCCAAGGCGCCGGG + Intronic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1191637449 X:63393425-63393447 CACCTCCCGGACAAGGCGGCTGG - Intergenic
1199609884 X:149604266-149604288 CAGCAGAGGGGCAAGGCAGCAGG - Intronic
1201335832 Y:12878952-12878974 CACCTCCAGGACAGGGCGGCTGG - Intergenic
1201764771 Y:17566544-17566566 CAGCACAGGGAAAAAGCGGTGGG - Intergenic
1201836782 Y:18339446-18339468 CAGCACAGGGAAAAAGCGGTGGG + Intergenic