ID: 1143690582

View in Genome Browser
Species Human (GRCh38)
Location 17:8561036-8561058
Sequence TACAGGATATTGTGAGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143690582_1143690585 6 Left 1143690582 17:8561036-8561058 CCACTTGCTCACAATATCCTGTA 0: 1
1: 0
2: 1
3: 21
4: 146
Right 1143690585 17:8561065-8561087 GTGGTCTCACTGCAGTTCTTTGG 0: 1
1: 1
2: 1
3: 10
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143690582 Original CRISPR TACAGGATATTGTGAGCAAG TGG (reversed) Intronic
906390930 1:45415416-45415438 TATGGGATATTGCGAGCAAATGG - Intronic
908991307 1:70093872-70093894 CACAGGATGTTGTTAGAAAGAGG + Intronic
909221984 1:72976409-72976431 TCCAGGACATTGGAAGCAAGCGG + Intergenic
911637199 1:100248621-100248643 AACAGGATATTGGGATGAAGTGG + Intronic
912637945 1:111316168-111316190 TACAGATAAGTGTGAGCAAGTGG + Intronic
917069812 1:171138201-171138223 TACAGGCAATCATGAGCAAGAGG + Exonic
917721147 1:177787714-177787736 TACAGGAGATTTTGATCAATTGG + Intergenic
919523245 1:198615274-198615296 TACCATATATTGTGACCAAGTGG + Intergenic
919856405 1:201709247-201709269 CACAGGAGATGGTGAGAAAGGGG + Intronic
920693957 1:208167599-208167621 GACAGGATATTGGGAGGAGGTGG - Intronic
923647266 1:235836561-235836583 TACGGGATATTGAGTGCAAGAGG + Intronic
923907296 1:238399564-238399586 CATAGGATATTGTGAAGAAGAGG + Intergenic
1069297485 10:66864346-66864368 TACAAGAGAAGGTGAGCAAGAGG - Intronic
1071165181 10:82798126-82798148 TACAAGGTACTGTGAGTAAGAGG - Intronic
1072465521 10:95658657-95658679 TACAGGATCATATGAGGAAGAGG + Intergenic
1074441725 10:113483182-113483204 TATAGGATGCTGTGAGCAAATGG - Intergenic
1077831133 11:5871791-5871813 TACATGATATTATTATCAAGTGG - Intronic
1081479067 11:43466946-43466968 TATAGGATATTGTGAGCGAATGG - Intronic
1081541099 11:44035142-44035164 GGTAGGATATTGAGAGCAAGAGG - Intergenic
1083863623 11:65441158-65441180 TGCAGGTACTTGTGAGCAAGGGG + Intergenic
1086466929 11:87063786-87063808 TACAGTCTATTGTGAGAAACAGG - Intronic
1087632505 11:100667034-100667056 GATAGGATACTGTGAGCAAACGG - Intergenic
1089137320 11:116260090-116260112 TACAGGATATTGTGGAGCAGAGG + Intergenic
1089850547 11:121492438-121492460 TACAGGAGATTGGGAGTAATGGG - Intronic
1089854719 11:121533040-121533062 AAAGGGAGATTGTGAGCAAGAGG + Intronic
1090149826 11:124372171-124372193 CACAGCTTATTGTGAACAAGAGG - Intergenic
1092402729 12:8190575-8190597 TAGTGGCTATTTTGAGCAAGCGG - Intergenic
1094478636 12:30862256-30862278 TATAGGATACTGTGAGCAAATGG - Intergenic
1097171765 12:57118711-57118733 GCCAGGATAATGTGAGCCAGGGG + Intronic
1099249335 12:80233992-80234014 TACAGGATGTTGTGAGGATTGGG - Intronic
1101679545 12:106951984-106952006 AACAGGATATTGTCAGGAAGTGG + Intergenic
1104625811 12:130353493-130353515 TACAGGATATGGTAGGAAAGAGG + Intronic
1105412092 13:20178889-20178911 TATAGGATATTATGAACAAATGG + Intergenic
1106009868 13:25809663-25809685 CACAGGGTGTTGTGAGCTAGAGG - Intronic
1107450732 13:40506846-40506868 TACAGGATATAGGGAGTGAGGGG + Intergenic
1107947950 13:45436708-45436730 TCTAGGATACTGTGAGCAAATGG - Intergenic
1110886434 13:80642890-80642912 TACAGGAAATGGTGAGCCTGGGG + Intergenic
1111502109 13:89135002-89135024 TACATGATATTTTCAGGAAGCGG + Intergenic
1111544291 13:89710269-89710291 CACAGCATATTGGGAGAAAGAGG - Intergenic
1111560329 13:89936474-89936496 TACAGCATGTTGTGAGCACTTGG - Intergenic
1116993275 14:51297660-51297682 TCCAGGTGATTGTGAGAAAGGGG + Intergenic
1117158442 14:52963928-52963950 GACTGGATACAGTGAGCAAGAGG - Intergenic
1117648008 14:57872754-57872776 TGCACGATCTTGTGGGCAAGAGG - Intronic
1118879029 14:69810618-69810640 TACAGGATATTGTGGGCTTGGGG - Intergenic
1120459857 14:84780862-84780884 GACAAGACATTGTGAGAAAGTGG - Intergenic
1124230878 15:27945250-27945272 CACAGGAAATTCTGAGCAGGTGG - Intronic
1128638621 15:69319233-69319255 AACAGGATATTTTGAGAGAGTGG - Intronic
1130769078 15:86906292-86906314 TACAGCATATTGTGAGCAGGGGG - Intronic
1137487470 16:48903505-48903527 TACTGGATATATTGAGCAATTGG - Intergenic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1139180137 16:64737352-64737374 TATAGGATATTTTGAGCAAATGG - Intergenic
1141137455 16:81475618-81475640 TCTAGGATACTGTGAGCAAATGG + Intronic
1143555538 17:7657450-7657472 TACAGAATATTCAGAGCAGGAGG - Exonic
1143582497 17:7835145-7835167 CACAGGAAATTGTGGGCAGGAGG + Intergenic
1143690582 17:8561036-8561058 TACAGGATATTGTGAGCAAGTGG - Intronic
1144333552 17:14248219-14248241 TACAGAAAAGGGTGAGCAAGGGG + Intergenic
1144467394 17:15507423-15507445 GACAGGATAGTGTGAGCAAATGG - Intronic
1145296539 17:21597576-21597598 CCCAGGATCTTGTCAGCAAGAGG - Intergenic
1145367242 17:22274496-22274518 CCCAGGATCTTGTCAGCAAGAGG + Intergenic
1146080408 17:29774934-29774956 TATAGGATACTGCGAGCAAATGG - Intronic
1147430644 17:40368512-40368534 TCTAGGATACTGTGAGCAAATGG - Intergenic
1149457179 17:56797420-56797442 TGCAGGATATTGAGGGGAAGAGG - Intronic
1153483498 18:5571928-5571950 TGCAGGAAATTGTGAGGAACAGG - Intronic
1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG + Intergenic
1162058448 19:8080091-8080113 CACAGGTGATTGTAAGCAAGCGG + Intronic
1163924496 19:20326794-20326816 TTCAGGAAATTGTGAGCAGCAGG - Intergenic
1164655960 19:29922041-29922063 TATAGGATACTGTGAGCAAATGG - Intergenic
1164879675 19:31721401-31721423 TAGACGATATTCTGAGCCAGTGG - Intergenic
1167014382 19:46830808-46830830 TACAGGATGTAGTGGGGAAGAGG + Intergenic
925793594 2:7519057-7519079 TCCAGGAGCTTGTGAGAAAGAGG + Intergenic
926269223 2:11352556-11352578 TATAGGATACTGTGAGCAAATGG - Intergenic
926945957 2:18187649-18187671 TAGAGGAGATGGTGACCAAGAGG - Intronic
927474108 2:23399186-23399208 TCTAGGATACTGTGAGCAAATGG - Intronic
929040033 2:37735709-37735731 CACAGGATATTCTGAGTCAGAGG - Intronic
933880175 2:86661682-86661704 TCCAGAATATTGTTAGGAAGTGG + Intronic
936887442 2:117329825-117329847 CAGAGGAGATTGTGTGCAAGGGG - Intergenic
936952901 2:117995984-117996006 TATAGGATGTTCTGGGCAAGTGG + Intronic
940717079 2:157238195-157238217 TACAGGATAATTTCAGCTAGGGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
943436575 2:187871098-187871120 TACAGAATATTTTGAGCAGAAGG - Intergenic
945681982 2:212925175-212925197 TTAAGGATATTGTGATGAAGAGG - Intergenic
1169562778 20:6819806-6819828 TACAGTATATTGGGCACAAGGGG - Intergenic
1170291195 20:14770704-14770726 TATAGGATATTGTGAGAATTAGG - Intronic
1172079211 20:32326007-32326029 TATAGGGTACTGTGAGAAAGAGG - Intronic
1177279353 21:18960091-18960113 CACAGGTAATTGTGATCAAGAGG + Intergenic
1177418761 21:20828033-20828055 GATGGGATACTGTGAGCAAGTGG + Intergenic
1177600488 21:23304394-23304416 TCCAGGAAAGTGTGATCAAGAGG - Intergenic
1178871678 21:36382481-36382503 TACAGGAGATTGAGAACAACGGG - Intronic
1181676823 22:24460107-24460129 TACACTATACTGGGAGCAAGGGG + Intergenic
1183865364 22:40700130-40700152 TTCAGGATATTGTCAGGAATGGG - Intergenic
950106450 3:10391979-10392001 TGGAGGAGGTTGTGAGCAAGAGG - Intronic
951053221 3:18118470-18118492 TTCAGGATATTCTGTGCCAGAGG - Intronic
951097666 3:18650645-18650667 AACATGATATTGTGAGTATGAGG + Intergenic
952103632 3:30043965-30043987 AACATGATATTGTGGGAAAGGGG - Intergenic
952602382 3:35100848-35100870 TATAAGACATTGTGAGCAATGGG + Intergenic
953802236 3:46033421-46033443 TAAAGGATATTTTCAACAAGTGG - Intergenic
954932536 3:54296572-54296594 TAGAGGATAATGTGAGCAATTGG - Intronic
958658402 3:97033105-97033127 TACAGGGAATCCTGAGCAAGCGG + Intronic
959634981 3:108555758-108555780 GACAGGATATTGTGAAGCAGGGG - Intronic
962703324 3:138019995-138020017 TACTTGATATTCTGATCAAGAGG - Intronic
962774186 3:138643423-138643445 TATAGGATACTGTGAGCAAATGG + Intergenic
963828797 3:149984869-149984891 TATAGGATACTGTGAGCAAATGG - Intronic
964949208 3:162267002-162267024 TTCAGAATTTTGTGAACAAGTGG + Intergenic
965306173 3:167066404-167066426 TCCAGGATACTGCGAGCAAATGG - Intergenic
969027972 4:4189687-4189709 TACAGGAGAAGATGAGCAAGAGG - Intronic
969908649 4:10422168-10422190 TACAAAATATAGTGAGCAAAAGG - Intergenic
971737144 4:30468463-30468485 TCGAGGTTATTGTGATCAAGTGG + Intergenic
973000545 4:44943508-44943530 TACAGGGTATGGTGAGCATGTGG + Intergenic
976986622 4:91308454-91308476 TTAAGGACATTGTCAGCAAGCGG + Intronic
983229856 4:165118318-165118340 TTAAGGATATTGTAAGCAATTGG + Intronic
984397423 4:179219674-179219696 TACAGGGTAATGTAAGGAAGGGG - Intergenic
985169385 4:187132309-187132331 TACAGAATCTGCTGAGCAAGAGG + Intergenic
985900969 5:2791683-2791705 TAAAATATATTGTGACCAAGTGG - Intergenic
987248269 5:16072419-16072441 TAGATGAGATTGTGAGCATGGGG + Intronic
987451153 5:18085523-18085545 AACAAGAAATTCTGAGCAAGAGG + Intergenic
988125690 5:27031428-27031450 TACAGGAAAATGTGAGTAAAAGG - Intronic
988399552 5:30744682-30744704 TACAGGATACTGTAGGCAACTGG + Intergenic
989404173 5:41042063-41042085 AAGAGGAAATTGAGAGCAAGGGG + Intronic
990050352 5:51492475-51492497 TAAAGGATACTGTGAGCACAAGG + Intergenic
990276927 5:54207122-54207144 TATAGGATATTGTCATCATGTGG - Intronic
990355013 5:54958373-54958395 AACAGGATTTGGTGAGCAATTGG - Intergenic
993628815 5:90258882-90258904 TGCAGGATAGTGTGAGACAGTGG - Intergenic
994285906 5:97966831-97966853 TACAAGTTATTGTGAACAACTGG + Intergenic
994817304 5:104600353-104600375 CACAGAATATTGTAAGAAAGGGG - Intergenic
997039662 5:130236590-130236612 TAAAGGATATTGAGAGGAAGTGG + Intergenic
998671163 5:144355831-144355853 AAAAGGACATTCTGAGCAAGGGG - Intronic
1003146422 6:3514207-3514229 TACACATTATTATGAGCAAGGGG + Intergenic
1004174387 6:13326847-13326869 TTCAGTATATTATGAGAAAGTGG - Exonic
1005354185 6:24966981-24967003 TCCAGGATATTGAAAGAAAGTGG - Intronic
1009346512 6:62618371-62618393 TATAGGATTTTGTGAGCCAAGGG - Intergenic
1009507254 6:64500146-64500168 TACAGGATATTCTGGGGCAGGGG - Intronic
1011672471 6:89696157-89696179 TTAAGCATATTGTGATCAAGAGG - Intronic
1012334831 6:98042402-98042424 TATAGGATATGGTGGGGAAGAGG + Intergenic
1012696961 6:102397053-102397075 TTGAGGCTATTGCGAGCAAGTGG + Intergenic
1021036133 7:15801424-15801446 TATAGGATATGGTGCACAAGAGG - Intergenic
1022144783 7:27526275-27526297 TACAGGATGATGTGTGCAAAGGG - Exonic
1022296758 7:29062896-29062918 AACAGGATATAGGGAGGAAGTGG + Intronic
1022655657 7:32317501-32317523 TTCAGGAAATTGTGGGCCAGGGG - Intergenic
1024034514 7:45495850-45495872 TTCAGGACATGGTGAGAAAGGGG - Intergenic
1026850520 7:73720422-73720444 TACTGGATGATGGGAGCAAGGGG - Intergenic
1027000584 7:74650807-74650829 TACAAGTTATTTTGAGAAAGAGG + Intergenic
1030743501 7:113137767-113137789 TACAGGAAATTGTAAGCAGGAGG + Intergenic
1032526519 7:132581938-132581960 TAGAGGATATTGTGAGGTAAGGG + Intronic
1034950501 7:155293555-155293577 TACTGCATACTGTGGGCAAGTGG + Intergenic
1035836912 8:2764628-2764650 TAAAGAATAATGTCAGCAAGAGG - Intergenic
1037186021 8:16064640-16064662 TGGAGAATATTGTGAGAAAGAGG + Intergenic
1037484325 8:19333182-19333204 CACCTGATACTGTGAGCAAGAGG - Intronic
1039175203 8:34796223-34796245 TACAGTATTTTGAGAGAAAGAGG + Intergenic
1039593700 8:38771422-38771444 TTCAGGATATTGTGGACAAAAGG + Intronic
1041497631 8:58504124-58504146 TATAGGATAACGTGAGCAAATGG - Intergenic
1042677830 8:71342188-71342210 CACTGAATATTTTGAGCAAGGGG - Intronic
1042736386 8:71993987-71994009 CACAGGATATTGAGATCACGTGG + Intronic
1044052669 8:87527717-87527739 TACGGGATTTTAAGAGCAAGGGG - Intronic
1044874210 8:96648287-96648309 TTCATAATATTGTGAGCAATGGG - Intronic
1047089811 8:121561375-121561397 TTCAGGATATTTTAAGAAAGAGG + Intergenic
1050221664 9:3398011-3398033 TCCAGCATATTGTGAGTATGTGG + Intronic
1050634655 9:7598446-7598468 TCTAGGATATTGAGAGCAAATGG - Intergenic
1050698542 9:8308321-8308343 CAAAGGATGATGTGAGCAAGTGG - Intergenic
1050916551 9:11142528-11142550 TACTGGATATTGTGAAAAAGAGG - Intergenic
1055464309 9:76549188-76549210 TATAGGATACTATGAGCAAATGG + Intergenic
1059290838 9:113222099-113222121 TTCAGGACATAGTGAGCTAGTGG + Intronic
1186557867 X:10579644-10579666 TTCAGGGTATTGTGAGCAAAAGG - Intronic
1189005693 X:36992095-36992117 TACAGGGTTTTATGAGCAACTGG + Intergenic
1189043292 X:37565550-37565572 TACAGGGTTTTATGAGCAACTGG - Intronic
1193131895 X:77929075-77929097 TACAGGAAATGGTAAGGAAGTGG + Intronic
1195634192 X:107094769-107094791 CAGAGGATAATGTGAGGAAGGGG + Intronic
1196999756 X:121426232-121426254 TAAAGCATACTGTGAGCAGGTGG + Intergenic
1199333734 X:146593725-146593747 TACAGGATATTGAAAACAAATGG - Intergenic
1199751144 X:150819316-150819338 TATAGGATATTGAGAGCAAATGG - Intronic