ID: 1143693444

View in Genome Browser
Species Human (GRCh38)
Location 17:8590702-8590724
Sequence CTGTGTAAGTAAATGAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 392}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143693444 Original CRISPR CTGTGTAAGTAAATGAATAA AGG (reversed) Intronic
901945427 1:12699215-12699237 CAGAGTTAGTAAATGAATACAGG - Intergenic
902262733 1:15238905-15238927 CTCTTAAAGTAAATGAATGAAGG - Intergenic
902345313 1:15812466-15812488 GTCTGTAAATAAATAAATAAAGG - Intergenic
903081147 1:20814404-20814426 CTGTATAATTGAATGAGTAAAGG - Intronic
904705329 1:32386017-32386039 CAGTTTAAGTAAAAAAATAAGGG + Intronic
904766234 1:32849976-32849998 CTGTTTAAATAAATAAATAAAGG - Intronic
905357636 1:37395827-37395849 CATTGTTAGTAAATGAATGATGG - Intergenic
905477406 1:38238807-38238829 ATGATTAAGTAAATGAATGACGG + Intergenic
906769255 1:48470112-48470134 CTGTGTAATTCACTGTATAACGG - Intronic
907685267 1:56604971-56604993 ATGTGGTAGAAAATGAATAATGG - Intronic
907859309 1:58335795-58335817 CTGAGTAACTGAATGAATTATGG + Intronic
908965239 1:69753648-69753670 CTGTATAAGCAAATGAATACGGG - Intronic
910454803 1:87386029-87386051 GTGAGTAAGTGACTGAATAAAGG + Intergenic
910977289 1:92920235-92920257 CAGTGGAGATAAATGAATAATGG + Intronic
911519826 1:98915763-98915785 CTGATTTAGTAAATGAAGAATGG + Intronic
911772932 1:101770298-101770320 CTGTGCAACTCAATGTATAAGGG - Intergenic
911806428 1:102214240-102214262 CTATATAAAAAAATGAATAAGGG + Intergenic
911995315 1:104758305-104758327 CTGGGTAGGAAATTGAATAAAGG + Intergenic
912829174 1:112935630-112935652 CTGTCTGGGTAAATGACTAAGGG + Intronic
913426910 1:118742070-118742092 GTGTGTATGTATATGCATAACGG + Intergenic
913628024 1:120679740-120679762 TTGTTTAATTAAATGAATGAAGG - Intergenic
914338190 1:146736187-146736209 CTCTGTCAGTAATTCAATAATGG - Intergenic
914562077 1:148830094-148830116 TTGTTTAATTAAATGAATGAAGG + Intronic
914610753 1:149300127-149300149 TTGTTTAATTAAATGAATGAAGG - Intergenic
915501262 1:156319705-156319727 CTATTTAAATAAATAAATAAGGG + Intronic
915795595 1:158730631-158730653 CTATCAAAGTAAATGATTAAAGG + Intergenic
916606806 1:166351026-166351048 CTGTGTCAGTAAAAGCTTAAAGG - Intergenic
917544821 1:175952910-175952932 CTGTCTCAATAAATAAATAAGGG + Intronic
917861766 1:179152574-179152596 GTGTGTAAGTAAATAAAATAAGG + Intronic
918201446 1:182271023-182271045 CTGAATAAATAAATAAATAAGGG + Intergenic
918295643 1:183153706-183153728 ATATGTAAGTAAATGAATAAGGG - Intergenic
919087105 1:192933461-192933483 GTGCGTAAGTAAATGAAGAGTGG - Intergenic
919092286 1:192990506-192990528 CAGTGTAAGTATATGAAAATAGG - Intergenic
919293990 1:195670592-195670614 CTGGGTAAGTAAAGAAATTAAGG + Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919351224 1:196456305-196456327 TTTTGTCAGTAAATCAATAATGG - Intronic
919432658 1:197515893-197515915 TTGTGGAAGAAAATGAACAAGGG - Intronic
919664028 1:200275050-200275072 CTGTAAAAGAAAATAAATAAGGG + Intergenic
920698010 1:208196414-208196436 CTGTGTAAGTGCATGCTTAAAGG - Intronic
921441058 1:215186617-215186639 CTGTGTATGTGACTGAATATAGG + Intronic
921576512 1:216841462-216841484 CTGTGGAAGTACATGAACACTGG + Intronic
923291027 1:232546353-232546375 CTGTGAAAGTAGATGAAAAATGG - Intronic
923979455 1:239304676-239304698 CTGTGAAAGTAGATAAAAAATGG + Intergenic
924075927 1:240336690-240336712 CTGTGTTAGTAACAGAAGAATGG + Intronic
1062865547 10:849499-849521 TTGAATAAGTAAATAAATAAAGG + Intronic
1063222091 10:3978657-3978679 ATATGTTAGTAAATGAATGAAGG + Intergenic
1063762290 10:9093544-9093566 CTGTGTAAATAAATAAATAATGG - Intergenic
1063783558 10:9354098-9354120 CTTTGCAAGTAGATCAATAAGGG + Intergenic
1065585178 10:27210764-27210786 ATAAGTAAGTAAATCAATAAAGG + Intronic
1067131223 10:43567249-43567271 ATGTGTAAGAAAAGAAATAATGG + Intronic
1068319017 10:55385609-55385631 CTGTGTAGGTTAATAACTAAAGG + Intronic
1069115015 10:64494214-64494236 ATGCGTAAATAAATGGATAAAGG - Intergenic
1069259061 10:66371285-66371307 CTGTATATGTAAAAGTATAAAGG - Intronic
1070027444 10:72645596-72645618 ATATGTAAATAAATAAATAAAGG + Intergenic
1070640300 10:78163830-78163852 CTTTTTAAGAAGATGAATAATGG + Intergenic
1071258041 10:83891847-83891869 CAGTGTTAGTATATGAACAACGG - Intergenic
1071836141 10:89419313-89419335 ATGTGGAAAAAAATGAATAATGG + Exonic
1072667721 10:97406483-97406505 ATGTATAAATAAATAAATAAAGG - Intronic
1072724639 10:97804838-97804860 CTGTCTCAATAAATAAATAAAGG - Intergenic
1073488473 10:103837155-103837177 CTGAGTAGGTAAAAGAATAGAGG - Intronic
1074148881 10:110740710-110740732 CTGAGTAAGGGGATGAATAAAGG - Intronic
1074417606 10:113280938-113280960 ATGAGTAAGTGAAGGAATAAAGG - Intergenic
1075685915 10:124365087-124365109 GTGGGTAATTAAATAAATAATGG - Intergenic
1076143947 10:128102009-128102031 CCCTGTAAATGAATGAATAACGG - Intronic
1076445876 10:130513420-130513442 CTGTGTAGCTGAATGAATGACGG + Intergenic
1076617966 10:131769414-131769436 CTCTCTAAGTAAATGGATATTGG + Intergenic
1079339653 11:19601521-19601543 ATGGATAAATAAATGAATAAAGG - Intronic
1079641143 11:22806981-22807003 ATGGGTAAGTACATGAATCATGG + Intronic
1079885599 11:25984439-25984461 TAGTGTAAGTGAATGAAGAAAGG - Intergenic
1080117295 11:28635254-28635276 CTGAATGAATAAATGAATAAAGG - Intergenic
1084404269 11:68961965-68961987 CTGTGGAAGTGATTGAGTAAAGG + Intergenic
1084501230 11:69536613-69536635 CTGAGTCAGTGAATGAATGAAGG + Intergenic
1085752329 11:79172366-79172388 ATGGATAAGTGAATGAATAACGG - Intronic
1087047628 11:93856399-93856421 CTAGGTAAGTAATTGAATTAGGG - Intergenic
1087195110 11:95297309-95297331 CTAAGTGAGTAAATGAATGAAGG + Intergenic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1090944359 11:131416358-131416380 ATGTGTAAGTGAAATAATAATGG - Intronic
1092971604 12:13700846-13700868 CTGTGTAACTAAATGATAACTGG + Intronic
1093040621 12:14375409-14375431 CTACGTATGTAAATTAATAAGGG + Intronic
1093125953 12:15328637-15328659 TTCTGTAAGAAAATGAATATAGG + Intronic
1093661278 12:21760161-21760183 CTATGAAGGAAAATGAATAATGG + Intergenic
1093789113 12:23226473-23226495 ATGTGTGAGTAAATGAATAAAGG - Intergenic
1094195758 12:27748310-27748332 ATGAATAAGTAAATGAATAATGG + Intronic
1094461983 12:30705921-30705943 CTTTGAAATAAAATGAATAAAGG + Intergenic
1095364101 12:41381845-41381867 CTGTTAAAGTAAATGTCTAAGGG - Intronic
1095749256 12:45693380-45693402 AGGTGGAAGTAATTGAATAATGG - Intergenic
1097668135 12:62504869-62504891 AAGTGTTAGGAAATGAATAACGG + Intronic
1098745256 12:74229403-74229425 ATGTGTAGGTAAACAAATAATGG + Intergenic
1098955368 12:76684093-76684115 CTGGGCTAGTAAAAGAATAAGGG + Intergenic
1099661108 12:85563398-85563420 CTATGTAAGTAAATACATTATGG - Intergenic
1099788565 12:87299814-87299836 ATATATGAGTAAATGAATAAAGG - Intergenic
1100682222 12:96938494-96938516 CTATAAAACTAAATGAATAATGG - Intronic
1100790245 12:98122299-98122321 CTGTATAGGCAAAGGAATAAGGG + Intergenic
1100906211 12:99302655-99302677 CTGAGAAAGTCAGTGAATAAAGG - Intronic
1102424929 12:112836218-112836240 TTGTGTATGTATTTGAATAATGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106065170 13:26340841-26340863 CTCTGTAAGTAAGTGTAGAAGGG + Intronic
1106887891 13:34209621-34209643 CTGTTTATGTAAATGTATTAGGG + Intergenic
1107331840 13:39309854-39309876 CTGTGGAACTAAATGAAGAAAGG + Intergenic
1107675009 13:42786577-42786599 CTGTTTAAGCAAATGAAGAGAGG + Intronic
1107708919 13:43133483-43133505 GTGTTCTAGTAAATGAATAATGG - Intergenic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1109249393 13:60000806-60000828 CTATGTTAGTTACTGAATAAAGG - Intronic
1109427242 13:62180944-62180966 ATGTAAAAATAAATGAATAAGGG + Intergenic
1109669697 13:65588072-65588094 CTGGGTAAATAAAGAAATAAAGG + Intergenic
1109691423 13:65895816-65895838 ATGTATAAGTAAATGGAAAAAGG - Intergenic
1109983272 13:69939534-69939556 CTGTGGAAGTGAATGTACAAAGG + Intronic
1111357257 13:87124586-87124608 CTGGGTAGCAAAATGAATAAGGG + Intergenic
1111754177 13:92371751-92371773 AAGTGTAAGTAATTGAATCATGG - Intronic
1111782546 13:92746796-92746818 CTGTATATGTTAATGAATCAAGG - Intronic
1112404012 13:99102079-99102101 CTGTGGAGGTAATTGAATCATGG - Intergenic
1112998958 13:105609865-105609887 CTCTGTATGTATTTGAATAAGGG - Intergenic
1113186334 13:107689748-107689770 ATGTGTAAGTGAATGAGTTATGG + Intronic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1115072954 14:29348204-29348226 CTTTGTAAGTCAATAAACAAAGG + Intergenic
1115260993 14:31453782-31453804 ATTTGTAAGTAAATGGATTAGGG - Intronic
1115405415 14:33009975-33009997 CTGTGGAAGTAACTGAATCGTGG - Intronic
1115810502 14:37101825-37101847 CTGTGTAATTAAGTGAATTATGG + Intronic
1117160803 14:52987531-52987553 TTCTGTAAATGAATGAATAAAGG + Intergenic
1119261738 14:73241766-73241788 CAGAATGAGTAAATGAATAAAGG + Intronic
1120085738 14:80270619-80270641 TTATGTAAATAAATGTATAATGG + Intronic
1120583996 14:86287875-86287897 TTGAGCAAGTAAGTGAATAAGGG + Intergenic
1121177093 14:91898756-91898778 GTGAGCAAGTGAATGAATAAAGG - Intronic
1121677546 14:95766361-95766383 TTCTGTAACTAAATGAGTAAAGG - Intergenic
1123871236 15:24575890-24575912 CTGTAGAAGTGAATGCATAATGG - Intergenic
1125020926 15:34986564-34986586 CTGTCACAGTAAGTGAATAAAGG - Intronic
1125101815 15:35922451-35922473 CTGTGTAAATAAATGAGTAAGGG + Intergenic
1126741806 15:51784792-51784814 CTTTGTATGTAAATGAATAAAGG + Intronic
1126884041 15:53130573-53130595 CTGTGTAACTATATGACAAACGG + Intergenic
1127892025 15:63261001-63261023 TTGTGTAAGTAAATCAGTAGAGG - Intronic
1129052450 15:72793799-72793821 CTGTGTAAGAAAAAAAAAAATGG - Intergenic
1129546924 15:76405848-76405870 CTGTGTTGGTAAATGAATAGTGG - Intronic
1129853845 15:78810886-78810908 CAGTGTCAGTAACTGAATCAGGG + Intronic
1130002261 15:80058047-80058069 CTGTGTAAGTCAATGAGAGAAGG + Intergenic
1130082903 15:80750190-80750212 CTTTGTAAATAGAAGAATAAAGG + Intronic
1130351597 15:83097234-83097256 CTGTTTACGTTGATGAATAAAGG + Intergenic
1130768353 15:86897453-86897475 ATGTGAAAGTAAAACAATAAAGG - Intronic
1130913357 15:88285889-88285911 GTGTGTGAGTGAATGAATATAGG - Intergenic
1132149638 15:99450537-99450559 CTGTGTGAGAACGTGAATAAAGG + Intergenic
1133053584 16:3133328-3133350 ATGTTCAAGCAAATGAATAAAGG + Intronic
1133302425 16:4790810-4790832 ATAAGTAAGTAAATAAATAAAGG + Intronic
1133425264 16:5682997-5683019 TTCTGTAAGTGAATGAACAAAGG - Intergenic
1133729048 16:8563781-8563803 CTGAGTGAGTAAATGAGTGAGGG + Intergenic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1135775230 16:25252347-25252369 AAGTATAAGTAAAGGAATAAGGG + Intronic
1137054790 16:35739425-35739447 CTGTGTAAGAATAAGAAGAAAGG + Intergenic
1137661918 16:50214661-50214683 ATAAGTAAGTAAATAAATAAAGG + Intronic
1138242345 16:55437250-55437272 CTGTGTGAGTAAATGGATTTAGG + Intronic
1138830213 16:60366430-60366452 TTGTGTAAGGAACTGAAAAATGG - Intergenic
1138883990 16:61053163-61053185 CTAAATAAGTAAATAAATAAAGG - Intergenic
1139026693 16:62826627-62826649 ATAAGTAAGTAAATAAATAAAGG - Intergenic
1139901803 16:70333961-70333983 CTGTGGAAGTAATGGAATAGTGG + Exonic
1139996090 16:70981154-70981176 CTCTGTCAGTAATTCAATAATGG + Intronic
1141751205 16:85959546-85959568 CTGAGTGAGTGAATGAATGAGGG - Intergenic
1143404469 17:6667985-6668007 CTGGGAAATAAAATGAATAATGG - Intergenic
1143693444 17:8590702-8590724 CTGTGTAAGTAAATGAATAAAGG - Intronic
1146269864 17:31477647-31477669 TTGTTTGAGTAAATGAATGACGG + Intronic
1146538563 17:33674464-33674486 CTGTGCAAATCAATGAATAATGG + Intronic
1146637301 17:34515968-34515990 ATTAGTAAATAAATGAATAAAGG - Intergenic
1149020200 17:51954825-51954847 CTCTGTAAGGAAATGAAAAGAGG + Intronic
1150165288 17:62935606-62935628 CTGTGTGGGAAAAAGAATAAAGG + Intergenic
1151017450 17:70573051-70573073 CTGAATCAGTAAATGAATGAAGG - Intergenic
1152259915 17:79261305-79261327 ATGTGTGAGTAAATGAAGGAGGG + Intronic
1153682393 18:7512923-7512945 TGGTGTAAAGAAATGAATAAGGG - Intergenic
1153739168 18:8105108-8105130 ATGTGTACCTCAATGAATAAAGG - Intronic
1154063475 18:11085023-11085045 CTAAGTAAATAAGTGAATAACGG + Intronic
1155349065 18:24888346-24888368 CCATGAAAGTAAATGATTAAGGG - Intergenic
1155860663 18:30894070-30894092 CTAAGTAAGTAAATAAATATTGG + Intergenic
1155861515 18:30906985-30907007 CTGTGTGAGGAAATGAACCACGG + Intergenic
1155978213 18:32154482-32154504 GTGGGTTAGAAAATGAATAAAGG + Intronic
1157158912 18:45295006-45295028 CGATGTATGTAAATGAGTAAAGG - Intronic
1158187942 18:54792479-54792501 CAGTTTATGCAAATGAATAAAGG - Intronic
1159667341 18:71177860-71177882 ATCTTTGAGTAAATGAATAAAGG - Intergenic
1162060009 19:8089205-8089227 ATTGGTAAGTGAATGAATAAGGG + Intronic
1162848267 19:13410981-13411003 CTATTTAAGGAACTGAATAAGGG - Intronic
1163452337 19:17385860-17385882 CAGTGGAAATAAATGCATAATGG + Intergenic
1166576498 19:43844293-43844315 CAGTGTCAGTAAATAAATATGGG - Intronic
1168476349 19:56678237-56678259 CTGATTAAGTAAATGAAGCATGG - Intergenic
925121708 2:1423243-1423265 CTGGGGAAGTAAATTAACAATGG - Intronic
926533812 2:14084993-14085015 CTGGGTAAATAAATAAATTAAGG + Intergenic
927169646 2:20358093-20358115 CTGGGGAAATAAAGGAATAAAGG - Intergenic
927395269 2:22643121-22643143 CTGTCTGAGAAAATGAATACAGG + Intergenic
927816794 2:26224273-26224295 CTATCAAAGTAAGTGAATAAAGG + Intronic
928728604 2:34205160-34205182 CAGTGGAAGTGAATGAGTAAAGG - Intergenic
928817461 2:35316582-35316604 CTCGATAAGTAAATGAATATAGG + Intergenic
928847772 2:35699344-35699366 CTGTGTAACTACTTGAAGAAAGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929051950 2:37845151-37845173 ATGTGTATGTAAATAATTAAGGG - Intergenic
929384155 2:41384414-41384436 CTGTGTAAGCACAGGAAGAAAGG - Intergenic
930153245 2:48079344-48079366 TTGAGTGAGTAAATGAACAAAGG + Intergenic
930508205 2:52311302-52311324 TTGTGTATGTCCATGAATAAGGG - Intergenic
930788204 2:55293763-55293785 CTCTGGAAGTAAATGGATCAGGG + Intronic
930855145 2:56007762-56007784 ATATGTAAGTGAATGAATAATGG - Intergenic
931914015 2:66933320-66933342 CTTTATAAATAAATGAGTAATGG + Intergenic
932281495 2:70496718-70496740 TTGAGTGAGTAAATGAATGAAGG - Intronic
932735912 2:74254536-74254558 CTGGATAAGTTAATGAATGAAGG + Intronic
932878241 2:75475189-75475211 TTTGGTAAGTAAATGACTAAAGG - Intronic
933213124 2:79594418-79594440 CTGTGAAAGGAAAATAATAATGG + Intronic
933866685 2:86524946-86524968 TTGTGTAAATAAATGATAAATGG - Intronic
935005425 2:99070961-99070983 GTTTAAAAGTAAATGAATAATGG - Intronic
935286991 2:101573727-101573749 CTCTATAAATAAATAAATAAAGG + Intergenic
935895757 2:107735759-107735781 ATGAATAAGTAAATAAATAAAGG + Intergenic
938071410 2:128310347-128310369 CTGTGTGAGTCAAGGAATCAAGG + Intronic
939568151 2:143809101-143809123 CTGGGTAAGGAAATGATAAAAGG + Intergenic
940051876 2:149473591-149473613 GTTTGTAAATCAATGAATAAAGG + Exonic
940061527 2:149575597-149575619 CTTTGGCAGAAAATGAATAAAGG + Intronic
940424318 2:153513621-153513643 GTATGAAAGTAAAGGAATAATGG - Intergenic
940633356 2:156266080-156266102 TTGAGTGAGTAAATGAATGAAGG + Intergenic
941327417 2:164134065-164134087 CTGTCTAGGTAAAAGAAGAATGG - Intergenic
941914918 2:170805472-170805494 CTGTCTCAATAAATAAATAAAGG - Intergenic
942253615 2:174069379-174069401 CTGTACAAGAAAATGAATAATGG + Intergenic
942403538 2:175628950-175628972 CTTTATAAGTAAAAGGATAAAGG - Intergenic
942496203 2:176542223-176542245 ATGTGTATGCAAATGAACAAAGG - Intergenic
942729795 2:179051726-179051748 TTGGGTAAGTAAAGGAAAAAGGG + Intergenic
943214926 2:185019978-185020000 CTGAGAAAGAAAATGAGTAAGGG + Intergenic
943299618 2:186181303-186181325 TGGTTTAAGTAAATGAACAAAGG + Intergenic
944251729 2:197585662-197585684 CTGTGTAAGCACAGGAAGAAAGG - Intronic
946756166 2:222949964-222949986 CTGTGTCAGTACATATATAATGG + Intergenic
946789948 2:223290846-223290868 CTGGGTAAGTAAAGAAATTAAGG - Intergenic
946886970 2:224230828-224230850 TTGGGTAGGTAAAGGAATAAGGG - Intergenic
947062638 2:226183559-226183581 CTGAATGAATAAATGAATAACGG + Intergenic
948100039 2:235366059-235366081 CTGTGTAGGTACATAGATAATGG - Intergenic
948326013 2:237121586-237121608 CTGTGTAAGCACAGGAACAAGGG + Intergenic
1168804615 20:665113-665135 ATGTGTAAGGAAATGAACAAAGG + Intronic
1168983843 20:2030497-2030519 GTATTTAACTAAATGAATAATGG - Intergenic
1169726689 20:8741390-8741412 ATGAGTAAGTAGATGAATGATGG + Intronic
1170227164 20:14003829-14003851 CTGTGTAATGAAAAGAATACAGG + Intronic
1170248910 20:14257735-14257757 CTATTTAAATAAATAAATAAAGG - Intronic
1170325820 20:15153291-15153313 TTGGGTAGGTAAATGAAAAAGGG + Intronic
1170420211 20:16185048-16185070 CTCTGTAAGAAGATCAATAAAGG - Intergenic
1170974349 20:21148467-21148489 CTGACTAAGTAAATTAATAGTGG - Intronic
1171044878 20:21800542-21800564 ATGTATAAGTAAGTAAATAAGGG + Intergenic
1171538010 20:25915010-25915032 ATGAGGAAGTAAATGAAGAAAGG + Intergenic
1172304097 20:33869446-33869468 CTGTGGAAGGAAGAGAATAAAGG - Intergenic
1172504601 20:35452323-35452345 CTGGGTAAATGAATAAATAAGGG + Intronic
1173422022 20:42909782-42909804 GTGTGAAAGCAAGTGAATAATGG - Intronic
1173714056 20:45186626-45186648 TTGAGTAAGTAAATAAATGAGGG - Intergenic
1174017462 20:47500455-47500477 CTCTGAAAATAAATGAAGAAAGG + Intergenic
1174114552 20:48218066-48218088 CTCTGTTAGTAAGTGAAGAATGG - Intergenic
1174323697 20:49762313-49762335 CTAAGAAAGTAAAGGAATAAAGG + Intergenic
1174724031 20:52842622-52842644 CTGTGTATGGAAATTAGTAAGGG + Intergenic
1175920584 20:62448888-62448910 CTGTGTGGATAAATGAATAGAGG - Intergenic
1177485162 21:21746848-21746870 CAGGGTAAGTAATTGAATCATGG + Intergenic
1177555923 21:22688556-22688578 CTATGGAAGTAATTGGATAATGG - Intergenic
1181116410 22:20634876-20634898 GTGTGTGAGTGAATGAATGAAGG - Intergenic
1182915128 22:34022370-34022392 ATGTGCAAGTAAATAAATAAAGG - Intergenic
1183253285 22:36744917-36744939 CTTTGTGAGCAAATGAATAAAGG + Intergenic
1183763806 22:39851412-39851434 CTGTGTATTTACATAAATAAAGG - Intronic
949171533 3:1004770-1004792 CTGTGTAAGTAAATTATGGATGG + Intergenic
949997309 3:9628406-9628428 CTGTGTAACTAATAGAATACAGG - Intergenic
950918789 3:16671466-16671488 CTAGGTAAGTAAATGAATTGGGG + Intergenic
952200582 3:31123038-31123060 ATGAGTAAATACATGAATAAAGG - Intergenic
953204275 3:40808487-40808509 CTGTTGAAATAAATGTATAAAGG - Intergenic
955863102 3:63353340-63353362 CTGTGGAAGAAGATAAATAAGGG - Intronic
955964675 3:64376630-64376652 ATGAGTAAGTATATGAAAAAAGG + Intronic
956073980 3:65485031-65485053 CAGAATGAGTAAATGAATAAAGG + Intronic
956367537 3:68521152-68521174 CTGTGTAAGTAGGTGACTTAAGG + Intronic
957379645 3:79410103-79410125 CTGTGTCTGTAAATTATTAACGG + Intronic
957549311 3:81683294-81683316 CAGTAGAAGTGAATGAATAAAGG - Intronic
957859533 3:85927232-85927254 TTGAGTAAATAAATGAATAATGG - Intronic
962441965 3:135428496-135428518 TTATGTCAGTAAATGAAAAAAGG + Intergenic
963565753 3:146928206-146928228 CTGAATGAATAAATGAATAAAGG - Intergenic
965404657 3:168254240-168254262 GTAAGTAAGTAAATAAATAAGGG - Intergenic
965773190 3:172202279-172202301 CTGTGTTTTTCAATGAATAAAGG - Intronic
966177057 3:177149880-177149902 CTGTTTATGTAAAGGATTAAGGG - Intronic
966496130 3:180583405-180583427 TTTTGTGAATAAATGAATAAAGG - Intergenic
966714985 3:183005803-183005825 CTGTGTAATTAATTGAGGAAGGG + Intergenic
969145203 4:5116813-5116835 CTGTGTAAGTCATTGATGAAAGG - Intronic
969748748 4:9094589-9094611 TTGTGTAGGTAAAGGAAAAAGGG - Intergenic
970029525 4:11658998-11659020 TTGTGTAGGTAAAGGAAAAAGGG + Intergenic
970332300 4:14999818-14999840 CAGTGGGAGTAAATGAATAAGGG + Intergenic
972924968 4:43992830-43992852 CTCTGGAAGTAAAGAAATAAAGG + Intergenic
973742225 4:53929032-53929054 CTGTTTCAATAAATAAATAAAGG + Intronic
974911554 4:68127954-68127976 GTTTATAAGTAAATGAATGAGGG - Intronic
975627916 4:76368317-76368339 CTGAGGAAAAAAATGAATAATGG + Intronic
976031510 4:80760273-80760295 CTGTGAAAATAATGGAATAATGG + Intronic
976718220 4:88145928-88145950 CTGTCTCAATAAATAAATAAAGG + Intronic
976877596 4:89873672-89873694 CTGTGTAAATAAAATAATCAGGG + Intergenic
977022977 4:91778558-91778580 CTGTGGGAGTAAAGCAATAAAGG + Intergenic
977070500 4:92378950-92378972 ATGTGTAAATAAATATATAAAGG - Intronic
977407447 4:96617967-96617989 TTGTGTAAGTAGAGGAACAATGG + Intergenic
977632697 4:99261038-99261060 CTGGGTAAATAAATAAATTAAGG - Intergenic
977726799 4:100305473-100305495 GTGAGTAAGAAAATGAAAAATGG - Intergenic
978941579 4:114442683-114442705 CTGTGAAAAGAAATGAAGAAGGG + Intergenic
979160957 4:117460583-117460605 CTGGGTAAGTAATTTAAGAATGG + Intergenic
979194330 4:117901839-117901861 TTTTGTGAATAAATGAATAAAGG + Intergenic
979353802 4:119678106-119678128 CAGTTTAAATAAATAAATAAAGG + Intergenic
979891009 4:126095298-126095320 ATTTGAAAGTAAATAAATAAAGG - Intergenic
980125452 4:128769958-128769980 CTGTGTCAGTAAATCTTTAATGG + Intergenic
980192414 4:129541901-129541923 CTGTGTAAAGCAATAAATAATGG + Intergenic
980263146 4:130480460-130480482 CTGTGTAAAAAAATAAATATGGG + Intergenic
980762289 4:137251531-137251553 CTGGTTAAGTAAAAGATTAAAGG + Intergenic
981218379 4:142200096-142200118 CTGAATAAGTAAATGAATGGAGG - Intronic
982498511 4:156123249-156123271 CATTGAAAGTAAATGAGTAAAGG + Intergenic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
983395455 4:167188297-167188319 TTTTGTGAGTAAATGTATAAAGG - Intronic
984032470 4:174621025-174621047 CTGGGTAAGTAAAGAAATGAAGG + Intergenic
984368416 4:178828812-178828834 TTGTGTAATTAACTGAATAGTGG + Intergenic
986365995 5:7032312-7032334 CTAGGTAAGTAACTGAATTAGGG - Intergenic
986594155 5:9403211-9403233 CTTTGTAAGTGAAATAATAAGGG - Intronic
986611753 5:9575327-9575349 CTGAATGAGTAAATGAATAATGG - Intergenic
987461327 5:18214740-18214762 CAGTGGAGGTAAATGAATCATGG - Intergenic
987938261 5:24498059-24498081 CTGTGTCATTAAATAAATACTGG - Intronic
988184826 5:27846768-27846790 CGTTGGAAGTAAATGAATCATGG + Intergenic
988341487 5:29978058-29978080 CTGTATAATTAAATGTGTAAAGG - Intergenic
988508827 5:31848372-31848394 CTGAATAATTAAATGTATAAAGG + Intronic
989064919 5:37450567-37450589 CTGAATAAGTAAATGGATAGTGG - Intronic
990327838 5:54695785-54695807 GTATGTAAATAAATGAATACAGG - Intergenic
990854299 5:60246116-60246138 CTATATAAGAAAATGAAAAAAGG - Intronic
993073515 5:83196881-83196903 ATGTGAAAGTATATGAAAAATGG + Intronic
993335477 5:86653023-86653045 CTGATTTAGTAAATGAATGATGG + Intergenic
993438042 5:87922219-87922241 CTGGGTAAATAAAGAAATAAAGG - Intergenic
994688990 5:102993039-102993061 GTGTTTAAGTCAAAGAATAAGGG - Intronic
995555369 5:113322869-113322891 CTGTACAAGGAAATGAATACTGG - Intronic
997600175 5:135133775-135133797 GTGTGTGAGTGAATGAATGAAGG + Intronic
999325309 5:150640088-150640110 CTGTGGAAGTAAGTGAAGTAAGG + Intronic
1000576687 5:162983361-162983383 CTGTGTAAGTTAACTAGTAAGGG - Intergenic
1000578435 5:163006039-163006061 GTTTGTGAGTAAAAGAATAAAGG - Intergenic
1001006406 5:168054636-168054658 CTGTTTCTGTAAATGAATTATGG + Intronic
1001420491 5:171582687-171582709 CTGTCTTAATAAATGAACAAAGG + Intergenic
1001864069 5:175087787-175087809 ATGTCTAAATAAATGAAGAAAGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1006460898 6:34157334-34157356 GTCTGTAAATAAATAAATAAAGG + Intergenic
1007043652 6:38749557-38749579 ATGTCTAATTAAATGACTAAAGG + Intronic
1008292473 6:49734128-49734150 ATGTGTAAATAAATGAATCCAGG - Intronic
1008376291 6:50795618-50795640 CTGTGTAAGTAAATAGCAAATGG + Intergenic
1008419667 6:51283325-51283347 CTGTTAAAATAAATGAGTAAAGG + Intergenic
1009775601 6:68201910-68201932 ATGAGTAAATAAATAAATAAAGG + Intergenic
1010071211 6:71748498-71748520 TTGGGTAAGTAAAGGAAAAAGGG + Intergenic
1013499598 6:110735016-110735038 ATGTGTGATTTAATGAATAAGGG - Intronic
1013714615 6:112944362-112944384 CAGTGTAGGAAACTGAATAACGG + Intergenic
1013961136 6:115901850-115901872 CTCTGTAAGTGAAAGAACAAAGG + Intergenic
1014293235 6:119585739-119585761 CTTTGTAAGGAGATTAATAAAGG - Intergenic
1015727839 6:136317708-136317730 CTGTGTAAGTATGTGAAAGAAGG - Intergenic
1016166372 6:140949725-140949747 GTGTGAGAGTAGATGAATAAAGG + Intergenic
1017153821 6:151305064-151305086 CTGTGTAAGAAAAGGATAAACGG - Intronic
1018141326 6:160840216-160840238 ATGTAGCAGTAAATGAATAAAGG + Intergenic
1018495926 6:164345689-164345711 CAGTGTAAGTGAATAAAAAATGG - Intergenic
1019793153 7:3030430-3030452 CAATGTAAGTAGATGAAAAATGG - Intronic
1020187416 7:5969891-5969913 CTGTCTCAATAAATAAATAATGG - Intronic
1020295500 7:6754879-6754901 CTGTCTCAATAAATAAATAATGG + Intronic
1020511991 7:9068104-9068126 CTGGGTAAATAACTGAATTAAGG - Intergenic
1020529593 7:9315822-9315844 GTTTGTATTTAAATGAATAACGG + Intergenic
1020603692 7:10308119-10308141 CTGTGTGAGTAAAAGCAGAAAGG - Intergenic
1020945262 7:14597216-14597238 CTGTGTAATTAAATTATTCATGG - Intronic
1021760706 7:23900792-23900814 CTGTGTCTCTAAATAAATAAAGG - Intergenic
1022184931 7:27958081-27958103 ATGTATGAGTAAATTAATAAAGG - Intronic
1023431575 7:40097695-40097717 CTGTGTCAGTAAATACAAAAGGG - Intergenic
1024344455 7:48298947-48298969 CTGTGAACGCAAATGAGTAATGG + Intronic
1028698122 7:93741363-93741385 CTGAATAAGTAAATGAATGGAGG - Intronic
1028872596 7:95785513-95785535 CTGAGTGAATGAATGAATAAAGG - Intronic
1030486644 7:110177008-110177030 CTGGGGAAGGAAATAAATAAAGG + Intergenic
1030653000 7:112135892-112135914 ATGTGGAAGGAAATCAATAAGGG - Intronic
1031064051 7:117085077-117085099 CTGTACAAGAAAAAGAATAAAGG + Intronic
1031736552 7:125369985-125370007 CTTTTTAATTCAATGAATAAAGG + Intergenic
1032899332 7:136289214-136289236 CTATGTAAGAAAGTGAATAAGGG + Intergenic
1033824548 7:145173484-145173506 TTGATTAAATAAATGAATAAAGG - Intergenic
1035053628 7:156019098-156019120 ATGTTTAAGTAAATGAAGGAAGG + Intergenic
1036291351 8:7494568-7494590 GTGTGTTATTAAATGAAGAATGG - Intergenic
1036330138 8:7816968-7816990 GTGTGTTATTAAATGAAGAATGG + Intergenic
1037693497 8:21204056-21204078 GTAAGTAAGTAAATAAATAAAGG + Intergenic
1038308423 8:26425582-26425604 CTGTGGAGATAAATGACTAATGG + Intronic
1039735452 8:40327231-40327253 CTTTATAGGTAATTGAATAAAGG + Intergenic
1042016566 8:64319962-64319984 CTGGGTAAGTAAAGAAATGAAGG - Intergenic
1042304660 8:67318464-67318486 CAGTGTAAATAAGTAAATAAAGG + Intronic
1043085901 8:75832601-75832623 ATTTTTAAGTAAAAGAATAAAGG + Intergenic
1043261749 8:78209154-78209176 CTGTTTAAGCAAATGCAAAATGG + Intergenic
1043686245 8:83090257-83090279 GGGTGTCAGTAATTGAATAAGGG - Intergenic
1043695372 8:83209658-83209680 GTGTGTGAGTGAATGAACAAGGG - Intergenic
1043717383 8:83504841-83504863 TTGGGTAGGTAAATGAAAAAAGG + Intergenic
1044112713 8:88296245-88296267 ATCTGTAATAAAATGAATAATGG + Intronic
1044500402 8:92948038-92948060 GTGTGTGAGAAAAAGAATAAGGG - Intronic
1044532484 8:93323303-93323325 TTGAGTAAATAAATCAATAAAGG + Intergenic
1044722702 8:95166369-95166391 CTGTGATAGAAAATGAAGAAGGG + Intergenic
1046005664 8:108480218-108480240 ATTTGAAAGAAAATGAATAAAGG - Intronic
1046457589 8:114487148-114487170 ATGTGAAAGTAATTGAATGATGG + Intergenic
1048163281 8:132039912-132039934 CTGTGGAGGAAAATGAATCAGGG - Intronic
1048605437 8:135963581-135963603 ATGAGTTAGTCAATGAATAAAGG + Intergenic
1048668105 8:136687163-136687185 CTGGGTAGGTAAAGGAAAAAGGG - Intergenic
1048728716 8:137413622-137413644 CTGGGTAGGTAAAGGAAAAAGGG + Intergenic
1049456121 8:142690404-142690426 CTGGGTAAGTAACTGAATTGGGG - Intergenic
1050434685 9:5596944-5596966 CTGTGTAAGACAATAAAAAATGG - Intergenic
1052114485 9:24633550-24633572 TTGGGTAAGAAAAGGAATAAAGG - Intergenic
1052206588 9:25848438-25848460 CTAGGTAAGTAAATGAATTGGGG + Intergenic
1052331135 9:27269737-27269759 CTATGTAGGTTAAAGAATAATGG - Intergenic
1052614644 9:30822016-30822038 CTGTGGAAGTAATTGAATCTTGG + Intergenic
1052668287 9:31522198-31522220 CTTTCTAAGAAAATGAAAAATGG - Intergenic
1055550373 9:77427518-77427540 GCGTGAAAGTAAATCAATAAAGG - Intronic
1055709397 9:79043435-79043457 CTGTGTCAGTAAATAAAAAGAGG - Intergenic
1056111351 9:83397959-83397981 CTATGAAGGTAAATGAATCAAGG - Intronic
1057474802 9:95389361-95389383 TTGTGTAATTAAAATAATAAAGG - Intergenic
1058825356 9:108771314-108771336 TTGTGCATGTATATGAATAAAGG + Intergenic
1058922822 9:109633591-109633613 CTCAATAAGTAAATAAATAATGG - Intergenic
1058944739 9:109845849-109845871 CTCAATAAGTAAATGAATGATGG - Intronic
1059780920 9:117526319-117526341 ATCTGTAAGTAAAAGAAGAATGG + Intergenic
1062018337 9:134303643-134303665 CTCTTTAAGAAAATGAATACTGG - Intergenic
1186576230 X:10768884-10768906 CTGTTTGAGCAAATGAGTAATGG + Intronic
1187377617 X:18769960-18769982 CTGTTTAAGTTAATTAATTATGG + Intronic
1187482922 X:19674358-19674380 ATTTGTATGTAAATGAACAAAGG - Intronic
1189525786 X:41819798-41819820 CAATGTAAGTAACAGAATAAAGG + Intronic
1189948046 X:46200319-46200341 CTGAGAAATGAAATGAATAATGG + Intergenic
1190002662 X:46704565-46704587 CTGTCTTTGTAAATGCATAAAGG - Intronic
1191139186 X:57097524-57097546 CTGGGTAAGTAAATAAATGAAGG + Intergenic
1191829124 X:65396421-65396443 CTGGGTAAATAAAGAAATAAAGG - Intronic
1193475571 X:81960805-81960827 CTTTGTAAGTTTATGAATCAAGG - Intergenic
1193864590 X:86715557-86715579 TTGAGTAAGTGAAGGAATAAAGG - Intronic
1194120220 X:89952385-89952407 CTAGGTAAGTAACTGAATTAGGG + Intergenic
1194733474 X:97483663-97483685 CTAGGTACGTAAATGAAGAAAGG - Intronic
1194818932 X:98481699-98481721 TGATGTAAGTAAATGGATAAAGG + Intergenic
1196513241 X:116539069-116539091 CTGAGTGAGCAAATGAATGATGG - Intergenic
1196598747 X:117576189-117576211 CTGAGAAATTAAATGAAAAAAGG - Intergenic
1197136260 X:123063462-123063484 CTGTGTAAATAAATATATATGGG - Intergenic
1197516318 X:127434450-127434472 CTGGGTAAGTAATGAAATAAAGG - Intergenic
1197827918 X:130610606-130610628 TTGAGTGAGTAAATGAATGAAGG + Intergenic
1199195514 X:145025055-145025077 CTGTAAAAGTAAATGAAAGAAGG + Intergenic
1200473082 Y:3609915-3609937 CTAGGTAAGTAACTGAATTAGGG + Intergenic
1201540478 Y:15100491-15100513 CTGTGTAAGTGCAGGAAGAAAGG + Intergenic
1201961684 Y:19687885-19687907 CTGTGTAAGTAACAAAATGAAGG - Intergenic