ID: 1143694260

View in Genome Browser
Species Human (GRCh38)
Location 17:8599644-8599666
Sequence GGCTGTAAAAGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 388}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143694251_1143694260 26 Left 1143694251 17:8599595-8599617 CCAGCAACCATATCTGCCTACCC 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 388
1143694255_1143694260 5 Left 1143694255 17:8599616-8599638 CCATCTGCAACACTGTTTTGAAA 0: 1
1: 0
2: 2
3: 40
4: 295
Right 1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 388
1143694252_1143694260 19 Left 1143694252 17:8599602-8599624 CCATATCTGCCTACCCATCTGCA 0: 1
1: 0
2: 1
3: 16
4: 231
Right 1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 388
1143694253_1143694260 10 Left 1143694253 17:8599611-8599633 CCTACCCATCTGCAACACTGTTT 0: 1
1: 0
2: 1
3: 16
4: 180
Right 1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 388
1143694250_1143694260 30 Left 1143694250 17:8599591-8599613 CCTGCCAGCAACCATATCTGCCT 0: 1
1: 0
2: 0
3: 19
4: 225
Right 1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 388
1143694254_1143694260 6 Left 1143694254 17:8599615-8599637 CCCATCTGCAACACTGTTTTGAA 0: 1
1: 0
2: 3
3: 19
4: 208
Right 1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143694260 Original CRISPR GGCTGTAAAAGGAAGGTGGA AGG Intronic
900686096 1:3948594-3948616 TTCTGTAAAGGGAAGGTAGATGG + Intergenic
900841349 1:5051009-5051031 GGCTGTTAAAGGAAGTTCGGAGG - Intergenic
901745581 1:11371126-11371148 GGCTGAAAAAGCTAGGTGGACGG + Intergenic
903805060 1:25999383-25999405 GGCTGCAAGAGTAGGGTGGAGGG - Intergenic
904372583 1:30059274-30059296 GGCAGGAAAAGGAAAGTGGAAGG + Intergenic
907123105 1:52024961-52024983 GGCTAAAAAAGAAAGGTGGAAGG - Intronic
907140802 1:52183090-52183112 GGCTGTGAAAAGAAGGCGAAAGG + Intronic
907572057 1:55492479-55492501 TGCTGGGGAAGGAAGGTGGAAGG + Intergenic
907592339 1:55686967-55686989 GGCTGTAGCATGAAGATGGAAGG - Intergenic
908179739 1:61591980-61592002 GGCTGAAAAAGGAGGGTGGGTGG - Intergenic
909241448 1:73219305-73219327 GACAGTAAAAGCTAGGTGGAAGG + Intergenic
910803863 1:91171155-91171177 GGCTGTAGAAGGAAGTTCAATGG + Intergenic
911759431 1:101599227-101599249 GGCTGTTAAAGGAAGTTTGGAGG + Intergenic
911885679 1:103296202-103296224 TGATGTCAAAGGCAGGTGGAAGG - Intergenic
912562814 1:110562434-110562456 GGCTGGAAAATGAAGCTGAAAGG - Intergenic
912632114 1:111254947-111254969 GGCTCTAGATGGAAGGTGTAGGG - Intergenic
912898453 1:113620409-113620431 GGCTGGAAAAGGGATGGGGAGGG - Intronic
912996765 1:114538372-114538394 GGGGGAAAATGGAAGGTGGAGGG - Intergenic
913382651 1:118228217-118228239 AGCTGCTCAAGGAAGGTGGAGGG - Intergenic
915600859 1:156922458-156922480 GGCTGATATAGGAAGGTGTAGGG + Intronic
915738187 1:158097914-158097936 GCCTGTAAAATGAAGGGGGAGGG + Intronic
916247514 1:162704025-162704047 GGCTTTAAAAGGGAGGCTGAAGG - Intronic
918096224 1:181336451-181336473 AGCTGTTAAAGGAAGGAGCAAGG + Intergenic
919034503 1:192289280-192289302 GGCTGGGAAGGGAAGGGGGAGGG + Intergenic
920397565 1:205658310-205658332 GGGTGTTGAAGGAAGGTAGAGGG - Exonic
920399210 1:205666729-205666751 GTCTCCAAAAGGAAGGTGGAAGG + Intronic
920399391 1:205667865-205667887 GGCTGTAGGAGGATGGTGGGGGG - Intronic
920537661 1:206749843-206749865 GGCTGTAAATGAAAGGTGTGAGG - Intergenic
921450353 1:215298122-215298144 GGTAGTAAATGGAAGGTGGATGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921520557 1:216150573-216150595 GGCTGTTAAAGGAAGTTCGGAGG - Intronic
922157944 1:223054478-223054500 GGCTGTGAAAAGATGGTAGAAGG - Intergenic
922809008 1:228405848-228405870 GGCTAAGAGAGGAAGGTGGAAGG - Intronic
923130475 1:231070513-231070535 GGCTGGGAAGGGTAGGTGGAAGG + Intergenic
923330934 1:232923977-232923999 GGCTGTAAAGGGAGGGAAGATGG + Intergenic
924307994 1:242711435-242711457 TGCTCTGAAAGGAAGGTGGCTGG - Intergenic
924592536 1:245417328-245417350 GGCAGTTAAAGGAAGGAGGTAGG + Intronic
924740965 1:246794057-246794079 GGCAGGGAAAGGAAGGGGGAGGG + Intergenic
1063246086 10:4220274-4220296 GGCAGAAAAAGGAAGGGGGCAGG - Intergenic
1063397181 10:5700088-5700110 GGCTGGAAAGGGTAGGAGGAAGG - Intronic
1064530622 10:16305706-16305728 GGGTGAAAAAGGAACGTAGATGG - Intergenic
1064745877 10:18477672-18477694 GGCTGCAGAGGGAAGATGGAGGG + Intronic
1065610766 10:27468865-27468887 GGCTGTTAAAGGAAGTTCGGAGG - Intergenic
1065668956 10:28092874-28092896 GTCTGTGATAGGAAGGTGGCTGG - Intronic
1066651856 10:37664019-37664041 GTGTGTAGAAGGAAGGTGCAAGG - Intergenic
1068206147 10:53856941-53856963 GGCTCCAAAAGGAGGGAGGATGG + Intronic
1069123694 10:64602981-64603003 AGCTGAAAAAGAAACGTGGATGG - Intergenic
1070451094 10:76557838-76557860 CGATGCTAAAGGAAGGTGGAGGG - Intronic
1070943366 10:80367034-80367056 GGCTGTAAAAGGCAAGTTCAGGG + Exonic
1071172452 10:82882501-82882523 TGCTCAAAAAGGATGGTGGAGGG + Intronic
1071458636 10:85870636-85870658 TGCTGTGGAAGGAAGGTGGAGGG + Intronic
1071719802 10:88131766-88131788 GGCTGTAACTGGAAGGAGGTGGG + Intergenic
1072341108 10:94451008-94451030 GGCTGGAAAGGGTAGGAGGAAGG + Intronic
1072641386 10:97213689-97213711 GGGTGGGAAAGTAAGGTGGAAGG - Intronic
1075746822 10:124733829-124733851 GGCAGTAAAGGGAAGGGCGAAGG - Intronic
1075832918 10:125426849-125426871 GGATGGCAAAGGAAGGAGGAAGG - Intergenic
1076649638 10:131979024-131979046 GGAGGCAACAGGAAGGTGGAGGG - Intronic
1076880059 10:133235709-133235731 GGCTCTAGAGGGAGGGTGGAGGG + Intergenic
1077846466 11:6030478-6030500 GGAAGGAAAAGGAAGGAGGAAGG + Intergenic
1078101360 11:8332174-8332196 GGCTGGAAAAGGAAGGGTGGGGG + Intergenic
1079485851 11:20935357-20935379 GGCTGCCAGTGGAAGGTGGATGG + Intronic
1080122093 11:28690047-28690069 GGCTGCAAAAGGAACTTTGAAGG + Intergenic
1080337814 11:31219242-31219264 ACCTGTAAAAAGAAGCTGGAGGG + Intronic
1080446919 11:32345962-32345984 GCCTGAAGAAGGCAGGTGGAAGG - Intergenic
1081733737 11:45389365-45389387 GGGTGTAAACAGGAGGTGGAGGG + Intergenic
1082849582 11:57753312-57753334 GGCTGCAAGAGGCAGGGGGATGG + Intronic
1084215335 11:67644454-67644476 GGCTGTAAAAGGCAGAGGGAGGG - Intronic
1084354794 11:68630757-68630779 GGCTGTTAAAGGAAGTTTGGAGG - Intergenic
1084923926 11:72496275-72496297 GGCTGGGAAGGGAAGGGGGAAGG + Intergenic
1085713352 11:78850677-78850699 GGCAGCAAGAGAAAGGTGGAAGG + Intronic
1086005361 11:82029743-82029765 GGCTGTTAAAGGAAGTTGGGAGG - Intergenic
1087197486 11:95315697-95315719 GGCTGTTAAAGGAAGTTCGGAGG - Intergenic
1087745020 11:101933977-101933999 GGATGTGAGAGGGAGGTGGAAGG + Intronic
1087931869 11:103987275-103987297 GGGTGGGAAAGGAAGGAGGATGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088119149 11:106347630-106347652 GGCTGGAGGAGGCAGGTGGATGG - Intergenic
1088342394 11:108783440-108783462 GGCTGTAAAAGGCAGGAAGGTGG + Intronic
1088727177 11:112649613-112649635 GGCTCAAAAGTGAAGGTGGAGGG - Intergenic
1088823100 11:113473513-113473535 GGCTGTGCAGGGAAGGTAGAAGG + Intronic
1089078362 11:115757073-115757095 GGCTGTGATGGGAATGTGGATGG + Intergenic
1089157001 11:116410182-116410204 GGCTGGAGGAGGAAGGTGAAAGG + Intergenic
1089733742 11:120535421-120535443 GCCTGTAAAAGGAGGGGGTAGGG + Intronic
1090157286 11:124453545-124453567 GGCTGGGAAAGGTAGGAGGAAGG + Intergenic
1091742206 12:2967641-2967663 GGCTGAAAAACGAAGGAAGAGGG + Intronic
1091903203 12:4162062-4162084 TGCTGTAGAACAAAGGTGGAAGG + Intergenic
1092038891 12:5365991-5366013 GGGTTTGAAAGGAAGGTGGAAGG + Intergenic
1092592410 12:9964258-9964280 GGCTGTTAAAGGAAGTTTGGAGG + Intronic
1092700976 12:11230528-11230550 GGCTGGGAAGGGAAGGGGGAAGG - Intergenic
1093024680 12:14234997-14235019 GGCTATTAAAGGAAGGTTGGAGG - Intergenic
1093359061 12:18201588-18201610 GGCTGTTAAAGGAAGTTTGGAGG - Intronic
1093919132 12:24839668-24839690 GGCTGGTGCAGGAAGGTGGATGG - Intronic
1093951426 12:25167666-25167688 GGCTGTTAAAGGAAGTTCGGAGG - Intronic
1095494160 12:42767516-42767538 GCCTTTAAAGGGAAGGTGGCAGG + Intergenic
1095600281 12:44005385-44005407 TGATGTCAAAGGAAGTTGGAAGG - Intronic
1095726996 12:45464804-45464826 GTAAGTAAAAGGAGGGTGGATGG - Intergenic
1096040751 12:48514267-48514289 GGCTGTAAAAGGTAGTTGGGGGG - Intronic
1096258272 12:50075633-50075655 GGCTGTTCTAGGAAGGGGGAAGG + Intronic
1096749850 12:53751762-53751784 CACTGAAAAAGGCAGGTGGATGG - Intergenic
1099007686 12:77253824-77253846 GGCTGGTAAAGGTAGGGGGAAGG + Intergenic
1100397120 12:94195072-94195094 GGCTGTAGAAGGAAGGAAGTGGG + Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102714082 12:114954729-114954751 GGCTTTAAAAGGATGGTGTCTGG + Intergenic
1103254283 12:119527433-119527455 TGCTGGAAAAGTAGGGTGGAAGG + Intronic
1104380677 12:128305064-128305086 CGCTTTTAAAGAAAGGTGGATGG - Intronic
1104510244 12:129370867-129370889 GGCTGGAAAGGGAAGATGGGAGG + Intronic
1105528140 13:21194836-21194858 GGCTGAAAAAGGAGGATGGGTGG - Intergenic
1105894449 13:24706449-24706471 GGCTGTCAGAGGCAGGTGGGTGG + Exonic
1105896236 13:24719061-24719083 TGCTGAAAAGCGAAGGTGGAGGG - Intergenic
1106072787 13:26429029-26429051 GGTTGTAAAAGGAAAGTTTATGG + Intergenic
1106692976 13:32138887-32138909 GGATGTAAAAGGTAGGAGCAGGG + Intronic
1106922692 13:34580612-34580634 GACTTTGAAAGGTAGGTGGAAGG - Intergenic
1109203861 13:59460209-59460231 GACTTTAAATGGAAGGTAGATGG + Intergenic
1110390771 13:74971142-74971164 CACTGTAAAATGAAGGTTGATGG - Intergenic
1110565118 13:76949982-76950004 GGCTTTGATAGAAAGGTGGAGGG - Intronic
1112387883 13:98957104-98957126 GGCTGCAGAGGGAAGGAGGAGGG - Intronic
1112497547 13:99916593-99916615 AGATGTAGAAGGAAGGTAGAAGG - Intergenic
1112976858 13:105330417-105330439 GGCTGAGAAAGGAATGAGGAGGG + Intergenic
1113100012 13:106707115-106707137 TGCTGGAAAATGAAGGTGTAAGG + Intergenic
1116348807 14:43832625-43832647 GGCTGGAAAAGGTAGTGGGAGGG - Intergenic
1116713921 14:48404781-48404803 GGCTGGGAAAGGTAGGGGGAGGG - Intergenic
1116833491 14:49746047-49746069 GGCTGGAGAAGGAAGGGAGATGG + Intronic
1118748294 14:68789708-68789730 GGCCGGAAGAGGAAGGTGGTCGG + Exonic
1119501713 14:75134120-75134142 GGCTGTAAAAGGGCAGTGCAAGG + Exonic
1119600603 14:75973837-75973859 TGCTGTAAAAAGAAGGGAGATGG + Intronic
1120013860 14:79448168-79448190 GGCTTTAAAAGGAAGTTAAAGGG - Intronic
1121281815 14:92704513-92704535 GGCTGTAGAGGAAAGCTGGAGGG + Intronic
1122041492 14:98990827-98990849 GGCTGTTAAAGGAAGTTCGGAGG - Intergenic
1122811666 14:104292305-104292327 AGCTGAGAGAGGAAGGTGGAGGG + Intergenic
1123012815 14:105357496-105357518 GGCTGCCAGTGGAAGGTGGAAGG - Intronic
1124023969 15:25947665-25947687 GCCTTGACAAGGAAGGTGGAAGG + Intergenic
1124644968 15:31432167-31432189 TGCTGAAAAAGGAAGGTTGCTGG + Intronic
1124650412 15:31469702-31469724 GGCTGCAGAAGGGAGGTGGCTGG - Intergenic
1125509384 15:40284530-40284552 GGCTGCAAAAGAAAGAAGGAAGG + Intronic
1126330492 15:47525932-47525954 GGCAGCAGAAGGAAGGGGGAAGG + Intronic
1126440772 15:48685343-48685365 GGCCTTAAAAAGAAGGTGGTGGG + Intergenic
1126633147 15:50757479-50757501 GCCTGTAAAAGGAAGATTGGGGG - Intronic
1127440409 15:59000960-59000982 AGCTGGAAAAGGAAGATAGAGGG + Intronic
1127838391 15:62809092-62809114 AGCTGTAGAAGGAAGGGGTAGGG + Intronic
1127976458 15:64000803-64000825 GAGTGTAAAATGAAGGTGGTGGG + Intronic
1128783357 15:70377414-70377436 GGTTGGAGGAGGAAGGTGGAGGG - Intergenic
1128982844 15:72199100-72199122 GGGGGAAAATGGAAGGTGGAGGG + Exonic
1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG + Intronic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1129475013 15:75779252-75779274 TGCTGTGAAAGGAGGTTGGAGGG - Intergenic
1129838791 15:78730846-78730868 TGCTGTGAAAGGAGGTTGGAGGG - Intergenic
1132088237 15:98925182-98925204 GACTTTAAAAGGACAGTGGAGGG - Intronic
1134113758 16:11532740-11532762 GGTTGGAAAAGTCAGGTGGATGG + Intergenic
1134324207 16:13192215-13192237 GACTGCAAAAGGGAGGTGGATGG + Intronic
1135146042 16:19963587-19963609 GGCTGGAAAAGGGAGGAGGCTGG + Intergenic
1135165661 16:20136973-20136995 GGCTGTTAATGGAGGCTGGAAGG + Intergenic
1135253841 16:20924372-20924394 GCCTGTAGAAGGAAAGCGGAAGG + Exonic
1135852551 16:25977713-25977735 GCCTATAAAAGGAAAGTGGAAGG + Intronic
1137316621 16:47331304-47331326 GACTCCAAAAGGAAGGAGGAAGG + Intronic
1139412665 16:66776844-66776866 GGCTGAAAAATGAAGGTAGAAGG + Intronic
1140543487 16:75783170-75783192 GGCTGTGGGAGGAGGGTGGATGG - Intergenic
1141939856 16:87268130-87268152 GGCAGAGAAAGGAAGGTGGGGGG - Intronic
1142336643 16:89493596-89493618 GGCTGTAAAAGAAGGGTCCAGGG + Intronic
1142385967 16:89764962-89764984 GTCTGCAGAAGGAAGGTGCAAGG + Exonic
1143119633 17:4598893-4598915 GGCTGGGAAAGGAATGAGGAAGG - Intronic
1143694260 17:8599644-8599666 GGCTGTAAAAGGAAGGTGGAAGG + Intronic
1144248867 17:13395721-13395743 GGATGGGAAAGGAAGGAGGAAGG - Intergenic
1144337568 17:14285424-14285446 GACTGGATATGGAAGGTGGAGGG + Intergenic
1146585275 17:34076862-34076884 GGCTGGAAAAGCAAGAAGGAAGG + Intronic
1146621602 17:34402667-34402689 AGCTGTAAAAGGATGGTGGGGGG + Intergenic
1146795237 17:35775747-35775769 GGGTGGAAAAGGAAGGAAGAGGG - Intronic
1149071142 17:52544763-52544785 GTGTGTGAAAGGAAGGAGGATGG - Intergenic
1151371413 17:73648448-73648470 GCCTGGGAAAAGAAGGTGGAAGG + Intergenic
1151691996 17:75692253-75692275 GGCTCCAAAAGGAAGGTGCCAGG - Intronic
1152333041 17:79684725-79684747 GACTGGACAAGGAAGGGGGAAGG - Intergenic
1152393596 17:80017727-80017749 GGCTGTACAAAACAGGTGGAAGG + Intronic
1153500258 18:5741897-5741919 GTCTGTGAAAGGAAGGTGCTCGG - Intergenic
1155623038 18:27802975-27802997 GGCTGTGAATGGAAGGGGAAAGG + Intergenic
1156526077 18:37768558-37768580 GGGTGTGAAAGGTAGGTGGTTGG - Intergenic
1156810644 18:41245928-41245950 GGCTGGGAAAGGAAGGAGGTGGG - Intergenic
1157234697 18:45953515-45953537 GGCAGTGAAGGGAAGCTGGAGGG - Intronic
1158182253 18:54729486-54729508 GAGTTTAAAAGCAAGGTGGATGG + Intronic
1158394154 18:57066710-57066732 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
1158434853 18:57428421-57428443 GGGAGCAAAAGGAAGGAGGAGGG + Intergenic
1159851162 18:73528628-73528650 GGCTGAAAAAGGAGCGGGGATGG + Intergenic
1160123643 18:76151546-76151568 GGGTCTTAAAGGCAGGTGGAGGG - Intergenic
1160319920 18:77880652-77880674 GGCTGTAAATGCAATGAGGATGG - Intergenic
1160521039 18:79508203-79508225 GGCTGGAGAAAAAAGGTGGAGGG + Intronic
1161483295 19:4521551-4521573 GGCTGGAGGAGGAAGCTGGAAGG + Intergenic
1162067615 19:8135899-8135921 GGCTGTAAAAGGCAGCTAGTGGG + Intronic
1163036052 19:14569617-14569639 GGCAGTGGGAGGAAGGTGGACGG + Intronic
1163167813 19:15509569-15509591 GCCTGTAAAATGAGGGTGGTAGG - Intronic
1163448358 19:17360831-17360853 GACTGTGAAAGAAAGATGGAGGG + Exonic
1163458806 19:17424276-17424298 GGCTGTGACAAGAAGGGGGAGGG + Intronic
1163899574 19:20089751-20089773 GGCTGTTAAAGGAAGTTCGGAGG + Intronic
1164143105 19:22492152-22492174 AGCTGTAGTGGGAAGGTGGAGGG - Intronic
1164441692 19:28284449-28284471 GGGAGGAAAAGGAGGGTGGAGGG + Intergenic
1166397039 19:42449004-42449026 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
1167084247 19:47298297-47298319 GGCTGAGAAGGGAAGGTGGGAGG - Intronic
1168306969 19:55441053-55441075 GGCTGCAAAAGGAACGGGAATGG - Intronic
1168593339 19:57654453-57654475 GGCTGACAAAGGAATGTAGAAGG - Intergenic
924989181 2:296666-296688 GACTGGAATAGGGAGGTGGATGG - Intergenic
925107262 2:1302368-1302390 GGAGGGAAAAGGAAGGTGAAGGG + Intronic
926063333 2:9818578-9818600 GGCTGAAAAAGGAATGAGGAAGG + Intergenic
926148190 2:10409654-10409676 GGGTGGAACAGGAAGGTGGAAGG - Intronic
926773951 2:16403862-16403884 GGGTGGAAAGAGAAGGTGGATGG - Intergenic
927184134 2:20470029-20470051 TCCTGGAAAAGGCAGGTGGAGGG - Intergenic
927974685 2:27329281-27329303 GGCTGTAAAAAGACGGGAGAAGG + Exonic
929052381 2:37849052-37849074 GCCTGTAAAAAGAAGTTGTAAGG + Intergenic
929605823 2:43233533-43233555 GGCTGTAAAAAGCAGGTGGTAGG + Intronic
929668504 2:43851973-43851995 GGGTTTGAAAGGAGGGTGGAGGG - Intronic
929744743 2:44645142-44645164 GGCTGGGAAAGGTAGATGGAAGG + Intronic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
930958739 2:57233404-57233426 GGCTGTTAAAGGAAGTTCGGAGG - Intergenic
931261478 2:60623413-60623435 TGTTGTAAAATGAAGATGGAAGG - Intergenic
931441662 2:62294386-62294408 GTCTGAAAAAGAAAGGTCGAGGG + Intergenic
932084239 2:68744034-68744056 GGCTGAAAAATGAATTTGGAAGG - Intronic
932612286 2:73208676-73208698 GGCCCTAAAAGGAGGGTGGGAGG + Intronic
933769003 2:85730984-85731006 GGCACTAAAAAGAAGGTGAAAGG - Intergenic
935022775 2:99247596-99247618 GACTGTAAAAGGAAGGAGGGAGG - Intronic
936528693 2:113259871-113259893 GGCTGCAGAAGGAAGGTCCAGGG + Intronic
936894004 2:117406129-117406151 GTCTGCAAAAACAAGGTGGAAGG + Intergenic
937207565 2:120246276-120246298 GGCTGGAGGAGGAAGGGGGATGG + Intronic
937883515 2:126885571-126885593 GGCTGAAAAGGGAAGGTGTGAGG + Intergenic
937921576 2:127135288-127135310 GGATGGAACGGGAAGGTGGAGGG + Intergenic
939875264 2:147570676-147570698 GGCTGGAAAAGAATGATGGAAGG + Intergenic
940530616 2:154872498-154872520 GGCTGTTAAAGGAAGTTCGGAGG - Intergenic
941179466 2:162240806-162240828 GGCAGGAAAGGGAAGGAGGAAGG - Intronic
941455568 2:165709644-165709666 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
943213047 2:184992858-184992880 ATCTGAAAAAGGAAGGTGGTAGG + Intergenic
943412365 2:187560002-187560024 GGCTGTTAAAGGAAGTTCGGAGG + Intronic
943444336 2:187965375-187965397 GGCTGAAAAGGGTAGGGGGAAGG + Intergenic
944251740 2:197585734-197585756 GGCTGTTAAAGGAAGTTCGGAGG - Intronic
944863809 2:203840984-203841006 GGCTGCCACAGGAAGGGGGATGG - Intergenic
946093443 2:217250697-217250719 GGGTTTAAAATGAAGGTGGGGGG + Intergenic
946776717 2:223150083-223150105 GGCTTCAAAAGGGAGGTGGGTGG + Intronic
946936283 2:224724392-224724414 GGCTGAAAAGGGAAGGTGAAAGG - Intergenic
947080344 2:226388933-226388955 GGGTTTTAGAGGAAGGTGGAAGG + Intergenic
947352944 2:229265395-229265417 GACTGCAAAAGGAAGGTGTCAGG - Intronic
947530812 2:230907647-230907669 GGCTGTAAGAGGAAGGTCCTTGG - Exonic
947708529 2:232295408-232295430 GGCTGCAAGAGGAAGGAAGATGG - Intronic
948726556 2:239937829-239937851 GGCTGTAATAAAAAGGTAGATGG - Intronic
1168739646 20:176763-176785 GGCTGTTAAAGGAAGTTTGGAGG - Intergenic
1169855588 20:10098822-10098844 GGCTGGTAAGGGAAGGGGGAAGG + Intergenic
1170255655 20:14340163-14340185 GGCTGTAATAGGAAGGGAGGAGG + Intronic
1171062555 20:21980515-21980537 GGATGTATTAGGAAGGAGGAAGG - Intergenic
1172788491 20:37486247-37486269 GGCTGAGAAAGGAGGGAGGAGGG + Intergenic
1174297293 20:49557878-49557900 GGCTGTAAGAGAAAGAGGGAAGG - Intronic
1175231724 20:57477700-57477722 GGCTGTAAAAGGAAAAGAGAAGG - Intergenic
1175311337 20:58013681-58013703 AGCTGAAGGAGGAAGGTGGAGGG + Intergenic
1177270597 21:18844376-18844398 GTCTTTAAAAGTGAGGTGGAAGG + Intergenic
1178282713 21:31297284-31297306 GGCAGAAATAGAAAGGTGGATGG + Intronic
1178610893 21:34078736-34078758 GGGTTTAACATGAAGGTGGAAGG + Intronic
1179047616 21:37860598-37860620 GGCTGGGAAATGAGGGTGGAGGG - Intronic
1181527879 22:23500487-23500509 GGGAGGAGAAGGAAGGTGGAGGG + Intergenic
1182569277 22:31224299-31224321 GGCTGAGAAAGGAGGGTGAAGGG - Intronic
1184017016 22:41793968-41793990 GGCTGGAGCAGGAGGGTGGAAGG - Intronic
1184638378 22:45854394-45854416 GGGGGGAAAAGGGAGGTGGAGGG + Intergenic
951398301 3:22199202-22199224 GGATGGAAAAGCAGGGTGGAGGG - Intronic
951762198 3:26159680-26159702 GGCTGTTAAAGGAAGTTTGGAGG + Intergenic
952102585 3:30032056-30032078 GGCTGGAAAGGGAAGGGAGAAGG - Intergenic
952428251 3:33197201-33197223 GACAGGAAAAGGAAGGTGCATGG + Intronic
952505720 3:34005319-34005341 GGAAGGAAAAGGAATGTGGATGG + Intergenic
952754038 3:36850362-36850384 GGCTTTAAAAGGAAGGAAAATGG + Intronic
952866675 3:37860128-37860150 TGCTGTAAAAGGTAGTTGGTAGG - Intergenic
953544533 3:43854657-43854679 TGCTTGAAAGGGAAGGTGGAAGG + Intergenic
953703706 3:45215624-45215646 AGCTGTAAGAGGAATGTGGATGG - Intergenic
953805233 3:46062523-46062545 ACCTATAAAAGGAAGGGGGAAGG - Intergenic
954326669 3:49867846-49867868 GGCAGGAAAGGGGAGGTGGACGG + Intronic
955554391 3:60120097-60120119 GACTGGAAAAGGTTGGTGGAAGG - Intronic
955726146 3:61935002-61935024 AGCTGTGAAAGGAAGGTGGAAGG - Intronic
958526050 3:95261148-95261170 AGCTGTAAAAGAAAGTTAGATGG - Intergenic
958612094 3:96438826-96438848 GGCTGTCATAGCAAAGTGGATGG + Intergenic
958774718 3:98468162-98468184 GGGAGGAAAAGGAATGTGGACGG - Intergenic
959574461 3:107919402-107919424 GCCTGGAAGAGGAAGGAGGAAGG + Intergenic
961367677 3:126410983-126411005 GGCTGGAAAAGGCAGGAAGATGG - Intronic
962117122 3:132522438-132522460 GGCTATAAAAGAGAGTTGGAAGG + Intronic
962378633 3:134879010-134879032 GGATGGAAAAGGAAGTTGAAAGG + Intronic
962415661 3:135179382-135179404 GGCTGTAAGAGGGAAGAGGATGG - Intronic
962795245 3:138844335-138844357 GGCTGGGAAAAAAAGGTGGAAGG + Intergenic
962816054 3:139001845-139001867 GGCTGGAGGAGGAGGGTGGATGG - Intergenic
962998528 3:140654495-140654517 GGCCTTAAAAAGAAGGTAGAGGG + Intergenic
963058999 3:141209683-141209705 GGCTGTTAAAGGAAGTTCGGAGG - Intergenic
964762001 3:160143030-160143052 GGCTGGAGAAGGAAGAGGGATGG + Intergenic
964911321 3:161784642-161784664 GGATGTAAAAGGAAGGCAGGCGG - Intergenic
965286319 3:166824625-166824647 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
965399170 3:168197597-168197619 GTCAGTAAAAGGAGGGTGTATGG - Intergenic
966223378 3:177572298-177572320 GACTGAAAAAGAAATGTGGATGG + Intergenic
966279730 3:178212806-178212828 GGCTGTTAAAGGAAGTTTGGAGG - Intergenic
967654879 3:192035093-192035115 GTCTTTAAAAGAAAGGTGGTAGG + Intergenic
968000849 3:195205506-195205528 GGCTGTAAAAGGCAGCACGAAGG + Intronic
968581327 4:1396680-1396702 GTCTGCAGAAGGAAGGAGGAGGG + Intergenic
969101873 4:4775504-4775526 GTCTGTAAAAGGATGGGGAAGGG + Intergenic
970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG + Intergenic
970365268 4:15351848-15351870 GGCTGTGAAAGGAAGGAGTTAGG + Intronic
972629785 4:40833182-40833204 GGCTGCACATGGAAGTTGGAAGG - Intronic
975093174 4:70426572-70426594 GGCTGTACAAGAAACGTGGTTGG - Intergenic
976340240 4:83939180-83939202 GGCTGGGAAGGGAAGGAGGAAGG - Intergenic
977257166 4:94754199-94754221 GGGTGGAAAAGGAAAGTGGTAGG + Intergenic
977294993 4:95200332-95200354 GGCTTTGCAAGGAAGGAGGAAGG - Intronic
977910843 4:102534298-102534320 GGCTACCAAAGGAAGGAGGAAGG - Intronic
978394215 4:108261047-108261069 GGAAGTAAAAGAAAGGTGAAAGG - Intergenic
978941384 4:114440042-114440064 GGATTTAAAAGCAAGGTGCAGGG - Intergenic
979219764 4:118209750-118209772 GGCTTTAAAGGAAAGTTGGAAGG - Intronic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
981079694 4:140627010-140627032 GGCTGTAAAAAATAGGTGGTGGG + Intronic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981545142 4:145885943-145885965 GGCAGCAAAGGGAAGGAGGAGGG - Exonic
984595118 4:181657978-181658000 GACTCTAAAAGGAGGGAGGAAGG + Intergenic
985684411 5:1274239-1274261 GGCAGTAACAGGAAGGTACATGG + Intronic
986752122 5:10796664-10796686 GGATGGAAGAGGTAGGTGGAGGG - Intergenic
988715214 5:33819821-33819843 GGCAGTAAAAGGAAAGAGGCAGG + Intronic
990122459 5:52471784-52471806 AGCTGAAAAAGGCAGGTGCAGGG - Intergenic
992203925 5:74411464-74411486 AGAGGTAAAAGGCAGGTGGAGGG - Intergenic
992501282 5:77346659-77346681 GCCTGTAAAGGAGAGGTGGAAGG + Intronic
994702908 5:103159921-103159943 GGCTGGAAAAGGAAGGGGTTGGG - Intronic
996358135 5:122618964-122618986 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
996597555 5:125222845-125222867 GGCTGGACAGGGAAGATGGAAGG - Intergenic
997789143 5:136741176-136741198 AGGTGTAAAAGGCATGTGGATGG - Intergenic
997915967 5:137925465-137925487 AGCTGTAAGAGAAAGCTGGAGGG + Intronic
998420050 5:141976732-141976754 GCATGTAAATGGAAGGGGGACGG - Intronic
999589998 5:153134341-153134363 TTCAGTAAAAGGAAGTTGGAAGG + Intergenic
1002426575 5:179180306-179180328 GGCTGCAAGAGGAAGTGGGACGG + Intronic
1003364536 6:5459784-5459806 GGAAGAAATAGGAAGGTGGAGGG - Intronic
1003422979 6:5974536-5974558 GGGGGAAAATGGAAGGTGGAGGG - Intergenic
1004482611 6:16035329-16035351 GGCAGGCAAAGGTAGGTGGATGG + Intergenic
1005257586 6:24020374-24020396 GACTGGAAAAGGAACCTGGAAGG + Intergenic
1005410567 6:25541023-25541045 GGCAGAAAAAGGACTGTGGATGG + Intronic
1006325328 6:33349384-33349406 GGCTGTTAAAGGAAGTTTGGAGG - Intergenic
1006443759 6:34067625-34067647 GGCAGTGGAAGGAAGGAGGAAGG - Intronic
1006479777 6:34282675-34282697 GGCAGGAAAGGGAGGGTGGAAGG + Exonic
1007265878 6:40595534-40595556 AGCTGTGAAAGGAGGGTGGAAGG + Intergenic
1007300365 6:40863421-40863443 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
1007631740 6:43276690-43276712 AGCTGGGAAAGGAAGGGGGAGGG - Intronic
1007648470 6:43400968-43400990 GGCAGGAAAAGGAAGAGGGATGG - Intergenic
1007848800 6:44783397-44783419 GGAGGTAAATGGAAGCTGGAAGG + Intergenic
1008937645 6:57009122-57009144 GGCTGGAAAGGGCAGGGGGAAGG + Intronic
1009750675 6:67875250-67875272 GCCTGTCAGAGGAAGGTGGAGGG + Intergenic
1009896567 6:69758453-69758475 GGCTGCAGTAGGAAGGGGGAAGG - Intronic
1010586119 6:77660070-77660092 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
1010628402 6:78167639-78167661 GGCTGTACAAGAAATGTGGCTGG + Intergenic
1010656641 6:78519037-78519059 AGATGTAAAAGGCAGGTGAATGG - Intergenic
1012518715 6:100093782-100093804 GGCTTTCTCAGGAAGGTGGAAGG - Intergenic
1013006867 6:106081908-106081930 GGCTTAAAAATGAAGGTGAAAGG - Intergenic
1014518324 6:122406358-122406380 GGCTGTTCAAGGAAGCAGGAAGG + Intronic
1014914837 6:127134118-127134140 GGATGAAGCAGGAAGGTGGAAGG + Intronic
1016541240 6:145168070-145168092 GGCTGTACAAGCAAAGGGGATGG + Intergenic
1019319403 7:408799-408821 GGCTGGAACAGGAAGGGCGAGGG + Intergenic
1019747890 7:2710697-2710719 GGCAGTCAAGGGAAGGTGAAGGG + Intronic
1019866957 7:3721130-3721152 GGCTTAAAAAGGGAGCTGGAGGG + Intronic
1019892011 7:3954526-3954548 GGTTGTAAAGGGGAGGTGGGAGG - Intronic
1019897080 7:3990942-3990964 CGCTGTAACAGGTAGGTGGCTGG - Intronic
1020648100 7:10840737-10840759 GGCTGTAAAAGGAAAGCTCACGG + Intergenic
1020809385 7:12833080-12833102 GGCTGTAAAAGAAGCATGGATGG + Intergenic
1021547987 7:21837565-21837587 GGAGGTAAAAGGAGGGAGGATGG + Intronic
1022373359 7:29790452-29790474 GGCTGTTAAAGGAAGTTCGGAGG - Intergenic
1022662260 7:32378162-32378184 GGAGGTAGAAGGAAGGTGGGGGG - Intergenic
1023270319 7:38455638-38455660 GGTTGTAAAAAGATGGTGGTGGG - Intronic
1024257511 7:47549687-47549709 GACTGTAAGACCAAGGTGGATGG - Intronic
1029088060 7:98026716-98026738 ATCTTTAAAAGGAAGGGGGAAGG - Intergenic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1031247897 7:119340494-119340516 AATTGTATAAGGAAGGTGGAAGG - Intergenic
1032277481 7:130472080-130472102 GGCTGGGAAGGGCAGGTGGAAGG + Intergenic
1033158896 7:138980172-138980194 GGCGGAAAAGGAAAGGTGGAAGG - Intronic
1035562090 8:613537-613559 GGCTTTGAAAGGAAGGTAGATGG - Intergenic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1037147285 8:15587722-15587744 GGCTGTGAAATGTAGGGGGAAGG - Intronic
1037838535 8:22228536-22228558 GGCTGGAGAAGGATGATGGAGGG + Intronic
1039480150 8:37867133-37867155 CACAGTAAAAGGAAGATGGATGG + Intronic
1039587515 8:38719580-38719602 GACTGTAAAGGGAGGGAGGAGGG - Intergenic
1039635763 8:39162916-39162938 GCTTGAACAAGGAAGGTGGAGGG + Intronic
1041827839 8:62117864-62117886 TGCTGTAAATGGAAGCTGGTGGG + Intergenic
1041991872 8:64002499-64002521 GCATGAAAAATGAAGGTGGAGGG + Intergenic
1042335737 8:67628528-67628550 GGCTACAAAGGGAAGATGGAAGG - Intronic
1043548043 8:81337256-81337278 GGCGGAAGAAGGAAGGAGGAAGG + Intergenic
1044115545 8:88328848-88328870 GGCTGAAAGAGGAAGGGGGAAGG + Intergenic
1044430893 8:92104496-92104518 GGGTTTAAAAGGATGGGGGAAGG - Intergenic
1048639773 8:136342348-136342370 GGCTGGAAAAGGAAGTTGGTGGG - Intergenic
1050599632 9:7237373-7237395 GCCTGTAACATGAAGCTGGAGGG - Intergenic
1051692428 9:19729707-19729729 GGCTGGATAGGGAAGGAGGAAGG + Intronic
1052382481 9:27786314-27786336 GGCTGGGAAAGGTAGTTGGAAGG + Intergenic
1052991052 9:34519701-34519723 GGCTGTAAAGGGGATGGGGAGGG - Intronic
1053104004 9:35395014-35395036 TGCTTGAAAAGGAAGGAGGAGGG + Intronic
1053382139 9:37657894-37657916 GGATGGAATAGGAAGGTGGTGGG - Intronic
1053592216 9:39525976-39525998 GGGTGTAAAGGGAATGTGGCAGG - Intergenic
1053850069 9:42281317-42281339 GGGTGTAAAGGGAATGTGGCAGG - Intergenic
1054574087 9:66839309-66839331 GGGTGTAAAGGGAATGTGGCAGG + Intergenic
1054877167 9:70109023-70109045 GACTGGATAAGGAAGGAGGATGG + Intronic
1055217287 9:73881078-73881100 TGCGGAAAAAGGGAGGTGGAAGG + Intergenic
1055347376 9:75352974-75352996 GGCTGTTAAAGGAAGTTTGGAGG + Intergenic
1055420923 9:76141271-76141293 GGCTGTAAAAAGAATGTAGAGGG - Intronic
1055454447 9:76459489-76459511 GGACGGAAAATGAAGGTGGAAGG - Intronic
1055505817 9:76948047-76948069 GGCTGGGGAAGGAGGGTGGATGG - Intergenic
1056324462 9:85464831-85464853 GGCTGTTAAAGGAAGTTCGGAGG - Intergenic
1056870473 9:90272788-90272810 GGATGTGAGAGGAAAGTGGAGGG + Intergenic
1057298783 9:93864709-93864731 GGGTAGAAAAGGAAGGAGGAGGG - Intergenic
1058226719 9:102372803-102372825 AGCTACAAAAGGAAGGTGGGAGG + Intergenic
1058818312 9:108705817-108705839 GGCTGCTAAAGGAAGGTGCCTGG - Intergenic
1058902806 9:109456880-109456902 GGAAGGAAAAGGAAGGAGGATGG - Intronic
1059114251 9:111586621-111586643 GGCTGAAAAAGGAAGACGAAGGG - Intronic
1059219842 9:112604627-112604649 GGCTATAACAGGTAGGTAGAAGG + Intronic
1059533244 9:115057424-115057446 GGCTGTAAAAGGAAGGGGTAGGG + Exonic
1059982909 9:119792797-119792819 GGCTGTAAAAACAATGTGGTGGG + Intergenic
1060466742 9:123913431-123913453 GGATTTAACAGGAAGGTGGGAGG + Intronic
1061245050 9:129397315-129397337 GGCTGAAATGGGAAGGTCGACGG + Intergenic
1062187545 9:135226819-135226841 GGCTGCACAAGGATGGTAGAGGG - Intergenic
1062334483 9:136059023-136059045 GGCTGTAGAGGGAAGGTGCTGGG + Intronic
1062593604 9:137287200-137287222 GGCTGGAAAGGGAACGGGGATGG + Intergenic
1186825877 X:13339804-13339826 GGCTGTAAAAGCTAGATCGAGGG + Intergenic
1188200336 X:27288290-27288312 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
1188535900 X:31196408-31196430 GGGTGTAAAAGGAATGTCTATGG + Intronic
1188844109 X:35052712-35052734 GGCTGTAATTGGAAGGAGGATGG - Intergenic
1189329912 X:40137910-40137932 GGCTATAAAAGGGAAGTGGACGG + Intronic
1190272596 X:48877755-48877777 TGCTGTTAAAGAAAGGTGAAAGG + Intergenic
1191761909 X:64655525-64655547 GGCTGTTAAAGGAAGTTTGGAGG - Intergenic
1191898051 X:66014331-66014353 AGGTGTGAAAAGAAGGTGGATGG - Intergenic
1192749325 X:73971929-73971951 GACTGGAAAAGTGAGGTGGACGG - Intergenic
1192852056 X:74967271-74967293 GACTGGAAAAGGAATGGGGAAGG + Intergenic
1193797049 X:85890037-85890059 GACTCTAAAAGGAGGGAGGAAGG + Intronic
1194379196 X:93174440-93174462 GGCTGTAGCAGGGAGGTGCAGGG + Intergenic
1195596087 X:106691522-106691544 GGCTGGGAAGGGAAGGAGGAGGG - Intergenic
1195632586 X:107073959-107073981 GGCTGTGAAGGGTAGGAGGAAGG + Intronic
1196226867 X:113177978-113178000 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
1196525128 X:116722143-116722165 GGCTGTTAAAGGAAGTTCGGAGG + Intergenic
1197094294 X:122574819-122574841 GGCTCTAAAATCTAGGTGGAGGG + Intergenic
1197682360 X:129400038-129400060 GGCTGTGACAGTATGGTGGAGGG + Intergenic
1198086407 X:133286748-133286770 GCCTGAAGAAGGGAGGTGGATGG + Intergenic
1198525077 X:137492650-137492672 GGCTGTGGAAGGAAGGGGGAAGG + Intergenic
1200963859 Y:9018945-9018967 GGGTGTCAGAGGAAGGTGGCTGG + Intergenic
1201632610 Y:16085772-16085794 GGCTTTAAAATCATGGTGGAAGG + Intergenic
1201937704 Y:19425596-19425618 GGCTGTTAAAGGAAGTTGGGAGG - Intergenic