ID: 1143695089

View in Genome Browser
Species Human (GRCh38)
Location 17:8608726-8608748
Sequence CTATGCTGCTTTATGCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143695089 Original CRISPR CTATGCTGCTTTATGCCTCC AGG Intronic
900662384 1:3791247-3791269 CGCTGCTGCTTTAAGCCTCGTGG + Intronic
900779532 1:4608823-4608845 CTCTGGGGCTTCATGCCTCCTGG - Intergenic
901120025 1:6883600-6883622 CTCAGCTCCTTCATGCCTCCTGG - Intronic
903308450 1:22432050-22432072 TTATGCTGCTTTGTGACTCTGGG + Intergenic
907926968 1:58964406-58964428 CTATGCATCTTTATTCTTCCAGG + Intergenic
908412934 1:63884881-63884903 CTATGCTATTTTATGTCTCCAGG - Intronic
915120936 1:153629189-153629211 CCAGGCTGCTTTAGGGCTCCAGG + Intronic
915640834 1:157224798-157224820 CTATGGTCTTTTATGTCTCCTGG + Intergenic
916665065 1:166959068-166959090 ATATCCTGTTTCATGCCTCCAGG + Intronic
917123434 1:171664543-171664565 CTATGCTGCTGCAGGACTCCTGG + Intergenic
918897381 1:190365988-190366010 CCATGATTCTTTATGCCTCAGGG - Intronic
922521413 1:226255541-226255563 CTATGTTTTTTTTTGCCTCCTGG - Intronic
1064256990 10:13750761-13750783 CTGTCCTGCTGTCTGCCTCCTGG - Intronic
1072141485 10:92592673-92592695 CTATTCTGGTCTCTGCCTCCGGG + Intergenic
1073010644 10:100356648-100356670 CTGTGGTGCTTAATGCCACCTGG + Exonic
1075216185 10:120538212-120538234 GCTTGCTTCTTTATGCCTCCCGG + Intronic
1077523678 11:3051145-3051167 CTCTGCTGCTTTGAGCCCCCAGG + Intronic
1078020972 11:7655644-7655666 CTGGGCTGCTTTCTGCCTCGTGG - Intronic
1080039868 11:27748177-27748199 CCATCCTGCTATAAGCCTCCTGG + Intergenic
1080389226 11:31828416-31828438 CAGAGATGCTTTATGCCTCCTGG - Intronic
1081395487 11:42581859-42581881 TTATGCTGTTTTAAGCCACCAGG - Intergenic
1083119500 11:60497382-60497404 CCAAGCAGCTTTATGGCTCCTGG + Exonic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1088787417 11:113194772-113194794 CTAGGCTGCTTTACGCCTCAGGG + Intronic
1089392211 11:118109937-118109959 TTATGCTGCTTCAAGCCTTCAGG - Intronic
1090101358 11:123800410-123800432 CCATGCTTCTTTATGCCACTGGG - Intergenic
1091907828 12:4203126-4203148 CTAGGCTGCTTCCTGCCTCAGGG + Intergenic
1093892035 12:24533563-24533585 TTATGCTGTTTTATGCCTGTTGG - Intergenic
1098108495 12:67096247-67096269 CTAAGCTGGTTGATGCCACCAGG - Intergenic
1098920086 12:76294812-76294834 CTATGCTGCTGCAAGCCTTCAGG + Intergenic
1099530383 12:83772408-83772430 CTCAGCTGGTTTATTCCTCCTGG - Intergenic
1099972741 12:89516663-89516685 TTCTGTTGTTTTATGCCTCCAGG - Intronic
1100254349 12:92867265-92867287 GTATACTGCTTTTTCCCTCCAGG + Intronic
1104439727 12:128785063-128785085 CTGTGCTGTTTTAGGCCACCAGG - Intergenic
1105387283 13:19942978-19943000 CTGTGCTGTTTTAAGCCACCCGG - Intergenic
1108669166 13:52665519-52665541 CTTTGCTGTTTTCTTCCTCCAGG + Intronic
1108903380 13:55440707-55440729 CTGTGCAGCTTTCTCCCTCCTGG - Intergenic
1109225014 13:59683085-59683107 CCATGCTGCTTTATGTTTCAGGG + Intronic
1110575830 13:77053966-77053988 CTATTCTGCATTATGACTACTGG - Intronic
1112776598 13:102850378-102850400 CTAAGCTCCTTCCTGCCTCCAGG - Intronic
1114402163 14:22420053-22420075 CTATACTTCTTTCTGCCTCAAGG + Intergenic
1114453901 14:22843450-22843472 CTCTGCTGCTTGTTCCCTCCTGG + Intronic
1114714691 14:24812954-24812976 CTTTGCTGGTGTATGCATCCAGG + Intronic
1115530161 14:34319678-34319700 CTATGCTGCTAAATGGCTCCTGG - Intronic
1118079018 14:62336754-62336776 CAAGGCTGCTTTAGCCCTCCAGG - Intergenic
1119175673 14:72566186-72566208 CTTTGCTACTTTATGGCCCCTGG - Intronic
1119219687 14:72896020-72896042 TTATGCTGGTTTCTGCATCCAGG - Intergenic
1120146008 14:80979116-80979138 CTATGCTGTTTTGAGCATCCGGG - Intronic
1120447059 14:84612343-84612365 CTATGCTCCTTTATGCTCCTAGG + Intergenic
1120613503 14:86673335-86673357 CTTTTCTGCTTTATGCCTAGTGG - Intergenic
1120956554 14:90088434-90088456 CTATTCTGCCTTCTGCCTTCGGG - Intronic
1124036952 15:26062688-26062710 CTATGTTGCAATTTGCCTCCTGG + Intergenic
1126209617 15:46085983-46086005 CTATGATGCTTTGTGCCTGGGGG + Intergenic
1128948819 15:71852886-71852908 CCAGGCTGCTTTCTGTCTCCTGG - Intronic
1129671455 15:77610148-77610170 CTGTGCTGCTTTCAGTCTCCTGG + Intergenic
1130872809 15:87984554-87984576 CTATGCTGCTTTAAACTTTCAGG + Intronic
1131561655 15:93448645-93448667 ACATCCTTCTTTATGCCTCCTGG - Intergenic
1131893983 15:97005934-97005956 CCATGCTGCTTTTTTCCTCTTGG + Intergenic
1134045690 16:11099169-11099191 CCAGGCTGCTTCATGCCACCCGG + Intronic
1134227592 16:12403590-12403612 CTGTGGTGCTTTTTGCCTCTTGG + Intronic
1137526005 16:49236925-49236947 CTATGTTGCTTTAAGCCACTAGG + Intergenic
1138206574 16:55130020-55130042 TTATGTTGCTTTATGCCACCTGG + Intergenic
1138365631 16:56474426-56474448 CTCTCCTGCCTTAAGCCTCCCGG + Intronic
1138995808 16:62451775-62451797 TTTTTCTGCTTTATGCCTCTTGG - Intergenic
1143695089 17:8608726-8608748 CTATGCTGCTTTATGCCTCCAGG + Intronic
1150427635 17:65089198-65089220 CTAAGCTTCTTTTTGCCTCGAGG - Intergenic
1150512079 17:65764792-65764814 CTATGCTGTTTATTGTCTCCTGG + Intronic
1150512192 17:65766497-65766519 CTATGCTGTTTATTGTCTCCTGG - Intronic
1150922435 17:69497412-69497434 CCTTGATGTTTTATGCCTCCAGG - Intronic
1151937829 17:77274147-77274169 CTATGCTGATCCTTGCCTCCCGG - Intergenic
1152137179 17:78511412-78511434 ATCTGCTGTTTTAAGCCTCCTGG + Intronic
1154476888 18:14769176-14769198 CTAGGCTGCTTTCAGACTCCTGG + Intronic
1158856635 18:61549564-61549586 CAGTGCTGCTTTGCGCCTCCAGG - Intronic
1159392578 18:67812504-67812526 CTCTGCTGCATTTTGCCTTCTGG - Intergenic
1160278507 18:77463234-77463256 TCATGCTGCTTCATGCCTACTGG - Intergenic
1167114457 19:47480508-47480530 CCCTGCTGCTTGATTCCTCCTGG + Intronic
926240040 2:11078480-11078502 CTATTCTACTTTCTGCCTCTAGG - Intergenic
926429840 2:12774510-12774532 CTATGCTGCCTCATTCCTGCAGG + Intergenic
927128532 2:20036276-20036298 CTATGCTGCTTCTTGCCTCAAGG + Intronic
933041416 2:77471819-77471841 CAATGATGCTTTTTGCCACCAGG + Intronic
933188254 2:79303054-79303076 CTATGCTGATTTTTGACTGCAGG + Intronic
934777944 2:96950768-96950790 CTGTGCTGTTTTTTCCCTCCTGG - Intronic
936264938 2:110996860-110996882 CTTGGCTGCTTTCTGCTTCCAGG - Intronic
939820326 2:146949151-146949173 CTGAGCTGCTTTAAGCCTCAAGG + Intergenic
947321498 2:228924564-228924586 CTATTCTGCTTGATGCCTCAAGG + Intronic
948367281 2:237465196-237465218 TTCTCCTGCTTTATCCCTCCAGG + Intergenic
948650822 2:239442570-239442592 CTGTGCTGCCTTCTGTCTCCTGG - Intergenic
1173998727 20:47358919-47358941 CCATGCAGCTTTCTACCTCCAGG - Intergenic
1174331184 20:49819731-49819753 CTATTCTGCTTTCTGTCTCTAGG + Intronic
1174990513 20:55504211-55504233 CCATGCTGGTTAATGCCTCAGGG + Intergenic
1175343611 20:58252392-58252414 TTATGCTGCTTTTTGCCTGAGGG + Intergenic
1177953948 21:27573717-27573739 CTATACTGTTTTATGATTCCAGG - Intergenic
1179897540 21:44371027-44371049 TTCTGCTGCTTTAAGCCACCAGG - Intronic
1183564823 22:38606541-38606563 CCATGCTCCTTTCTGCCTCCTGG + Intronic
1183977722 22:41523024-41523046 CCATGCTGAGTAATGCCTCCAGG + Intronic
1184940133 22:47758444-47758466 CTGTCCCACTTTATGCCTCCTGG - Intergenic
1184955066 22:47880353-47880375 CAATGGTGCCTGATGCCTCCAGG - Intergenic
950156898 3:10728160-10728182 CTTTGCTCCCCTATGCCTCCAGG + Intergenic
950856376 3:16109499-16109521 TCATGCTGCTTGATGGCTCCAGG + Intergenic
951806883 3:26654669-26654691 TGCTGCTCCTTTATGCCTCCAGG - Intronic
953557749 3:43960208-43960230 CTGTGCTGCTATGTGCCACCTGG - Intergenic
960647191 3:119899193-119899215 CTGTCCTGCTTCATTCCTCCTGG - Intronic
961025638 3:123553593-123553615 CAATGCTGCCTTATCCTTCCAGG - Intronic
961678038 3:128579947-128579969 CAATGCTGCTTCTTTCCTCCTGG - Intergenic
962103049 3:132362769-132362791 CTATGCTGCCTTTGGCCTCTTGG - Intronic
968500797 4:949004-949026 CTGTGCTGCTTGCTGCCTGCTGG - Intronic
973621423 4:52730006-52730028 GTATGTTGCTTTAAGCCACCAGG + Intronic
974445771 4:61979474-61979496 CTATCATGCTTTGTGCATCCAGG + Intronic
977260193 4:94788263-94788285 CAATGCTTCTTTATGCCTGCTGG - Intronic
978837559 4:113170975-113170997 CTTTGCTGCTTTATGTCCCTAGG - Intronic
981416147 4:144495921-144495943 CTGTGCTTATTTATACCTCCTGG - Intergenic
982566634 4:156995398-156995420 CCATGCTCCTTTTTGCCTTCAGG - Intergenic
985884838 5:2669902-2669924 CTATGCTGCTTCATCCATCCAGG + Intergenic
987316325 5:16728135-16728157 CCATTCTGGTTTCTGCCTCCTGG + Intronic
987759924 5:22148599-22148621 CTCTGCTGCTTTCTGACTTCTGG - Intronic
989286418 5:39705175-39705197 TTTTGCTTCTTTATGCCTCGGGG - Intergenic
991894653 5:71382030-71382052 CTCTGCTGCTTTCTGACTTCTGG - Intergenic
993377068 5:87160969-87160991 CTATCCTGCCTTTTTCCTCCCGG - Intergenic
994986143 5:106936133-106936155 CTACATTGCTTTAGGCCTCCTGG + Intergenic
998753019 5:145345244-145345266 CTATTCCCCTTTATGTCTCCAGG - Intergenic
999861784 5:155655745-155655767 CTGTGCTGCTGTATCTCTCCAGG + Intergenic
1003448066 6:6203317-6203339 CTATGTTGCTTTATGTGTCAAGG + Intronic
1006118516 6:31789506-31789528 CTTTGCTGATTGATACCTCCAGG - Intronic
1007175342 6:39892576-39892598 CTCTCCTGCTTATTGCCTCCTGG - Intronic
1007549999 6:42721964-42721986 CTCTGCTGCTTTCTGCTTCGGGG - Exonic
1007968613 6:46027997-46028019 ATATTCTGCTTTATTCATCCTGG - Intronic
1009934825 6:70221634-70221656 CTAAGGTGCTTTTTGCCTCTTGG - Intronic
1010971901 6:82271938-82271960 ATGTGCTGCTTTCTGCCCCCAGG + Intergenic
1011998642 6:93624719-93624741 CTATGCTGCTTTCTACCCCCGGG - Intergenic
1018826075 6:167408658-167408680 CTAAGCTGCTGTTTGTCTCCAGG - Intergenic
1022789160 7:33669677-33669699 CTCTCCTGATTTCTGCCTCCAGG - Intergenic
1023164594 7:37331007-37331029 TTATCCTGCTTTGTCCCTCCAGG - Intronic
1024163372 7:46703554-46703576 CTTTGCTGCTTCATGCCACTGGG - Intronic
1024235380 7:47393703-47393725 CTCTGCTGCTTTATGAAGCCTGG + Intronic
1030114755 7:106054753-106054775 CCATGCGGGTGTATGCCTCCCGG + Intergenic
1032648907 7:133856729-133856751 CTAGGCTTCTTGATGCCTCTTGG + Intronic
1035899803 8:3447648-3447670 CTTTGCTGCTTTATTTCTCCTGG + Intronic
1036163239 8:6407578-6407600 CTATGAGGTTTTATGACTCCAGG - Intronic
1037143730 8:15548541-15548563 CTATGCTGTTTTTTGCCCTCAGG - Intronic
1037524164 8:19708495-19708517 CTATGCTGCTTTATTTCACTTGG - Intronic
1039552957 8:38456427-38456449 CCATGCCCCTTTATGCTTCCTGG + Intronic
1039830049 8:41206221-41206243 TTCTGTTGCTTTAAGCCTCCTGG - Intergenic
1041125799 8:54637041-54637063 CTATGCTACACCATGCCTCCTGG - Intergenic
1041145368 8:54870562-54870584 CTCTGCTGCTCTCTGCCTGCAGG - Intergenic
1045667807 8:104509433-104509455 CTGTGCTGCTCTGTCCCTCCCGG + Intronic
1048565878 8:135596517-135596539 CTATGTTGCTATATTTCTCCAGG - Intronic
1051393536 9:16592780-16592802 ATGTGCTGCATTATGTCTCCTGG - Intronic
1052795985 9:32924013-32924035 CTTTTCTGCTTTATGCCCCTCGG - Intergenic
1053616189 9:39769110-39769132 CTTTGATGCTTTATGAATCCAGG - Intergenic
1054237328 9:62573280-62573302 CTTTGATGCTTTATGAATCCAGG + Intergenic
1054551463 9:66607791-66607813 CTTTGATGCTTTATGAATCCAGG + Intergenic
1060018568 9:120108760-120108782 CTTTGCAGGTTCATGCCTCCAGG - Intergenic
1061113374 9:128591575-128591597 CTATGCTGCCTTGCTCCTCCAGG - Exonic
1062667388 9:137682594-137682616 CTAAGCTGGTTTCTGCCACCTGG - Intronic
1187859105 X:23664793-23664815 ATACTCTGCTTTCTGCCTCCCGG - Intronic
1189252176 X:39609801-39609823 CCCTGCTGTTTTATGCCTCTGGG - Intergenic
1191738027 X:64407629-64407651 GGATGCTGCTTTCTGCATCCTGG - Intergenic
1194522438 X:94935697-94935719 TTTTTCTGTTTTATGCCTCCAGG - Intergenic
1195311404 X:103634862-103634884 CTATGCTGCTTCACCACTCCTGG - Intergenic
1196253255 X:113486338-113486360 CTATGGTGCTCTCTGTCTCCAGG - Intergenic
1196488716 X:116244374-116244396 CTATCCTGACTTTTGCCTCCTGG + Intergenic
1196981320 X:121216833-121216855 CTATGCTTCTTTCTACCTCTAGG + Intergenic