ID: 1143698719

View in Genome Browser
Species Human (GRCh38)
Location 17:8640865-8640887
Sequence TATCTATTTTCAACAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143698719_1143698723 16 Left 1143698719 17:8640865-8640887 CCTGGGTTTGTTGAAAATAGATA No data
Right 1143698723 17:8640904-8640926 AAAGTATGTGGGCATCTCATTGG No data
1143698719_1143698721 4 Left 1143698719 17:8640865-8640887 CCTGGGTTTGTTGAAAATAGATA No data
Right 1143698721 17:8640892-8640914 TCTTCAGGCAAAAAAGTATGTGG No data
1143698719_1143698722 5 Left 1143698719 17:8640865-8640887 CCTGGGTTTGTTGAAAATAGATA No data
Right 1143698722 17:8640893-8640915 CTTCAGGCAAAAAAGTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143698719 Original CRISPR TATCTATTTTCAACAAACCC AGG (reversed) Intergenic
No off target data available for this crispr