ID: 1143700966

View in Genome Browser
Species Human (GRCh38)
Location 17:8659809-8659831
Sequence ACCAGCTATCCCTCTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143700962_1143700966 -8 Left 1143700962 17:8659794-8659816 CCAGCCACACCTGAAACCAGCTA No data
Right 1143700966 17:8659809-8659831 ACCAGCTATCCCTCTGTTGTGGG No data
1143700961_1143700966 21 Left 1143700961 17:8659765-8659787 CCTTGATGATATTGCTTGACTCT No data
Right 1143700966 17:8659809-8659831 ACCAGCTATCCCTCTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143700966 Original CRISPR ACCAGCTATCCCTCTGTTGT GGG Intergenic
No off target data available for this crispr