ID: 1143703068

View in Genome Browser
Species Human (GRCh38)
Location 17:8675823-8675845
Sequence CCTTTGCCACAAAGAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143703061_1143703068 6 Left 1143703061 17:8675794-8675816 CCAGACTTCTGTCACCTTCACCT No data
Right 1143703068 17:8675823-8675845 CCTTTGCCACAAAGAAAGCCAGG No data
1143703060_1143703068 17 Left 1143703060 17:8675783-8675805 CCTTGAGCTCTCCAGACTTCTGT No data
Right 1143703068 17:8675823-8675845 CCTTTGCCACAAAGAAAGCCAGG No data
1143703059_1143703068 26 Left 1143703059 17:8675774-8675796 CCATGATTTCCTTGAGCTCTCCA No data
Right 1143703068 17:8675823-8675845 CCTTTGCCACAAAGAAAGCCAGG No data
1143703063_1143703068 -8 Left 1143703063 17:8675808-8675830 CCTTCACCTGGCTCCCCTTTGCC No data
Right 1143703068 17:8675823-8675845 CCTTTGCCACAAAGAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143703068 Original CRISPR CCTTTGCCACAAAGAAAGCC AGG Intergenic
No off target data available for this crispr