ID: 1143704785

View in Genome Browser
Species Human (GRCh38)
Location 17:8689158-8689180
Sequence AAAAATGCACAAAACCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143704785_1143704787 0 Left 1143704785 17:8689158-8689180 CCCAGCTGGTTTTGTGCATTTTT No data
Right 1143704787 17:8689181-8689203 TTAAACCTAAATTTATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143704785 Original CRISPR AAAAATGCACAAAACCAGCT GGG (reversed) Intergenic
No off target data available for this crispr