ID: 1143705280 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:8693449-8693471 |
| Sequence | CCACTGGCGGAGCGGATGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143705280_1143705287 | -3 | Left | 1143705280 | 17:8693449-8693471 | CCCTCCATCCGCTCCGCCAGTGG | No data | ||
| Right | 1143705287 | 17:8693469-8693491 | TGGTGCAGCACGTGAGCGCTCGG | No data | ||||
| 1143705280_1143705289 | 10 | Left | 1143705280 | 17:8693449-8693471 | CCCTCCATCCGCTCCGCCAGTGG | No data | ||
| Right | 1143705289 | 17:8693482-8693504 | GAGCGCTCGGTTGGAACATCAGG | No data | ||||
| 1143705280_1143705288 | 1 | Left | 1143705280 | 17:8693449-8693471 | CCCTCCATCCGCTCCGCCAGTGG | No data | ||
| Right | 1143705288 | 17:8693473-8693495 | GCAGCACGTGAGCGCTCGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143705280 | Original CRISPR | CCACTGGCGGAGCGGATGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||