ID: 1143705280

View in Genome Browser
Species Human (GRCh38)
Location 17:8693449-8693471
Sequence CCACTGGCGGAGCGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143705280_1143705287 -3 Left 1143705280 17:8693449-8693471 CCCTCCATCCGCTCCGCCAGTGG No data
Right 1143705287 17:8693469-8693491 TGGTGCAGCACGTGAGCGCTCGG No data
1143705280_1143705289 10 Left 1143705280 17:8693449-8693471 CCCTCCATCCGCTCCGCCAGTGG No data
Right 1143705289 17:8693482-8693504 GAGCGCTCGGTTGGAACATCAGG No data
1143705280_1143705288 1 Left 1143705280 17:8693449-8693471 CCCTCCATCCGCTCCGCCAGTGG No data
Right 1143705288 17:8693473-8693495 GCAGCACGTGAGCGCTCGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143705280 Original CRISPR CCACTGGCGGAGCGGATGGA GGG (reversed) Intergenic
No off target data available for this crispr