ID: 1143705634

View in Genome Browser
Species Human (GRCh38)
Location 17:8696125-8696147
Sequence CCCCAACCTGGGGCATTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143705634_1143705641 -7 Left 1143705634 17:8696125-8696147 CCGGAGAATGCCCCAGGTTGGGG No data
Right 1143705641 17:8696141-8696163 GTTGGGGAATCAGGAGCTGGTGG No data
1143705634_1143705643 28 Left 1143705634 17:8696125-8696147 CCGGAGAATGCCCCAGGTTGGGG No data
Right 1143705643 17:8696176-8696198 CAATCCAGAAAGAGTCAGTCTGG No data
1143705634_1143705640 -10 Left 1143705634 17:8696125-8696147 CCGGAGAATGCCCCAGGTTGGGG No data
Right 1143705640 17:8696138-8696160 CAGGTTGGGGAATCAGGAGCTGG No data
1143705634_1143705642 0 Left 1143705634 17:8696125-8696147 CCGGAGAATGCCCCAGGTTGGGG No data
Right 1143705642 17:8696148-8696170 AATCAGGAGCTGGTGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143705634 Original CRISPR CCCCAACCTGGGGCATTCTC CGG (reversed) Intergenic
No off target data available for this crispr