ID: 1143707724

View in Genome Browser
Species Human (GRCh38)
Location 17:8711014-8711036
Sequence GTGGGGCTAGCTGTCAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143707724_1143707730 -1 Left 1143707724 17:8711014-8711036 CCCCAGCTGACAGCTAGCCCCAC No data
Right 1143707730 17:8711036-8711058 CAGCCCGAGTCAACTGAGTAAGG No data
1143707724_1143707735 28 Left 1143707724 17:8711014-8711036 CCCCAGCTGACAGCTAGCCCCAC No data
Right 1143707735 17:8711065-8711087 TGATCCTCCAGCTCCAACCAGGG No data
1143707724_1143707734 27 Left 1143707724 17:8711014-8711036 CCCCAGCTGACAGCTAGCCCCAC No data
Right 1143707734 17:8711064-8711086 TTGATCCTCCAGCTCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143707724 Original CRISPR GTGGGGCTAGCTGTCAGCTG GGG (reversed) Intergenic
No off target data available for this crispr