ID: 1143707724 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:8711014-8711036 |
| Sequence | GTGGGGCTAGCTGTCAGCTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143707724_1143707730 | -1 | Left | 1143707724 | 17:8711014-8711036 | CCCCAGCTGACAGCTAGCCCCAC | No data | ||
| Right | 1143707730 | 17:8711036-8711058 | CAGCCCGAGTCAACTGAGTAAGG | No data | ||||
| 1143707724_1143707735 | 28 | Left | 1143707724 | 17:8711014-8711036 | CCCCAGCTGACAGCTAGCCCCAC | No data | ||
| Right | 1143707735 | 17:8711065-8711087 | TGATCCTCCAGCTCCAACCAGGG | No data | ||||
| 1143707724_1143707734 | 27 | Left | 1143707724 | 17:8711014-8711036 | CCCCAGCTGACAGCTAGCCCCAC | No data | ||
| Right | 1143707734 | 17:8711064-8711086 | TTGATCCTCCAGCTCCAACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143707724 | Original CRISPR | GTGGGGCTAGCTGTCAGCTG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||