ID: 1143707730

View in Genome Browser
Species Human (GRCh38)
Location 17:8711036-8711058
Sequence CAGCCCGAGTCAACTGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143707725_1143707730 -2 Left 1143707725 17:8711015-8711037 CCCAGCTGACAGCTAGCCCCACA No data
Right 1143707730 17:8711036-8711058 CAGCCCGAGTCAACTGAGTAAGG No data
1143707724_1143707730 -1 Left 1143707724 17:8711014-8711036 CCCCAGCTGACAGCTAGCCCCAC No data
Right 1143707730 17:8711036-8711058 CAGCCCGAGTCAACTGAGTAAGG No data
1143707726_1143707730 -3 Left 1143707726 17:8711016-8711038 CCAGCTGACAGCTAGCCCCACAG No data
Right 1143707730 17:8711036-8711058 CAGCCCGAGTCAACTGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143707730 Original CRISPR CAGCCCGAGTCAACTGAGTA AGG Intergenic
No off target data available for this crispr