ID: 1143707734

View in Genome Browser
Species Human (GRCh38)
Location 17:8711064-8711086
Sequence TTGATCCTCCAGCTCCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143707727_1143707734 10 Left 1143707727 17:8711031-8711053 CCCCACAGCCCGAGTCAACTGAG No data
Right 1143707734 17:8711064-8711086 TTGATCCTCCAGCTCCAACCAGG No data
1143707725_1143707734 26 Left 1143707725 17:8711015-8711037 CCCAGCTGACAGCTAGCCCCACA No data
Right 1143707734 17:8711064-8711086 TTGATCCTCCAGCTCCAACCAGG No data
1143707728_1143707734 9 Left 1143707728 17:8711032-8711054 CCCACAGCCCGAGTCAACTGAGT No data
Right 1143707734 17:8711064-8711086 TTGATCCTCCAGCTCCAACCAGG No data
1143707724_1143707734 27 Left 1143707724 17:8711014-8711036 CCCCAGCTGACAGCTAGCCCCAC No data
Right 1143707734 17:8711064-8711086 TTGATCCTCCAGCTCCAACCAGG No data
1143707726_1143707734 25 Left 1143707726 17:8711016-8711038 CCAGCTGACAGCTAGCCCCACAG No data
Right 1143707734 17:8711064-8711086 TTGATCCTCCAGCTCCAACCAGG No data
1143707731_1143707734 2 Left 1143707731 17:8711039-8711061 CCCGAGTCAACTGAGTAAGGCCA No data
Right 1143707734 17:8711064-8711086 TTGATCCTCCAGCTCCAACCAGG No data
1143707729_1143707734 8 Left 1143707729 17:8711033-8711055 CCACAGCCCGAGTCAACTGAGTA No data
Right 1143707734 17:8711064-8711086 TTGATCCTCCAGCTCCAACCAGG No data
1143707732_1143707734 1 Left 1143707732 17:8711040-8711062 CCGAGTCAACTGAGTAAGGCCAT No data
Right 1143707734 17:8711064-8711086 TTGATCCTCCAGCTCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143707734 Original CRISPR TTGATCCTCCAGCTCCAACC AGG Intergenic
No off target data available for this crispr