ID: 1143713287

View in Genome Browser
Species Human (GRCh38)
Location 17:8748851-8748873
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143713278_1143713287 13 Left 1143713278 17:8748815-8748837 CCTAATACTTTTGAGTGGATTGG No data
Right 1143713287 17:8748851-8748873 GGATGCAGCAAGGGACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143713287 Original CRISPR GGATGCAGCAAGGGACAGGA AGG Intergenic
No off target data available for this crispr