ID: 1143721173

View in Genome Browser
Species Human (GRCh38)
Location 17:8810949-8810971
Sequence CCCCATGCAGAGTCCCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2867
Summary {0: 1, 1: 13, 2: 109, 3: 847, 4: 1897}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143721173_1143721182 19 Left 1143721173 17:8810949-8810971 CCCAGCAGGGACTCTGCATGGGG 0: 1
1: 13
2: 109
3: 847
4: 1897
Right 1143721182 17:8810991-8811013 CTTCTGCACTGCCCTAGCAGAGG 0: 681
1: 1039
2: 1345
3: 1338
4: 1162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143721173 Original CRISPR CCCCATGCAGAGTCCCTGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr