ID: 1143722997

View in Genome Browser
Species Human (GRCh38)
Location 17:8826914-8826936
Sequence TCTGGTCCAAAGTACGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143722991_1143722997 25 Left 1143722991 17:8826866-8826888 CCCTACACACTTACGAAGGAATA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1143722997 17:8826914-8826936 TCTGGTCCAAAGTACGAGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 60
1143722992_1143722997 24 Left 1143722992 17:8826867-8826889 CCTACACACTTACGAAGGAATAT 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1143722997 17:8826914-8826936 TCTGGTCCAAAGTACGAGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143722997 Original CRISPR TCTGGTCCAAAGTACGAGCC TGG Intronic
901415103 1:9111119-9111141 TCTGGTGCACAGTAAGTGCCTGG + Intronic
902652947 1:17848558-17848580 GCTTGTCCAAGGTACCAGCCTGG + Intergenic
919474557 1:198018098-198018120 TCAGACCCAAAGTAAGAGCCTGG - Intergenic
919983150 1:202655004-202655026 TTTGGCCCATAGTACAAGCCAGG - Intronic
921250243 1:213290715-213290737 GTTGCTCCAAAGTAAGAGCCTGG + Intergenic
1064473076 10:15656930-15656952 TCTGGACCAAAGTAGGTGCCAGG + Intronic
1073183823 10:101603166-101603188 TCTGGTCCAGTGTCCCAGCCTGG + Intronic
1073980976 10:109153450-109153472 ACTGGTCCAAAGTAAGAGGAAGG + Intergenic
1092204895 12:6608640-6608662 TCTGGGCCAAAGTAGTATCCTGG + Intergenic
1095526101 12:43127464-43127486 TATGGTCCAAAGAATTAGCCAGG - Intergenic
1103908879 12:124340953-124340975 TCTGCTCCCAAGCCCGAGCCGGG + Intronic
1107904248 13:45047571-45047593 TCTGCTACAAGGTACCAGCCGGG - Intergenic
1117326448 14:54673348-54673370 TTTGGTGCAAGGTAGGAGCCAGG - Intronic
1127656384 15:61060255-61060277 GCTGGGCCAAAGTGCGTGCCTGG + Intronic
1133928318 16:10211596-10211618 TCTGCACCAAAGTGCCAGCCTGG - Intergenic
1136509748 16:30729493-30729515 TACGGTGCAAAGGACGAGCCCGG - Exonic
1143722997 17:8826914-8826936 TCTGGTCCAAAGTACGAGCCTGG + Intronic
1143860030 17:9882564-9882586 TCTGGTGGAAAGTAAAAGCCAGG + Intronic
1149592026 17:57837212-57837234 TCTGGTCCAGAGTCCCAGTCTGG + Exonic
1158578917 18:58664380-58664402 TCTGTTTCAATGTAGGAGCCAGG + Intergenic
1159444356 18:68522382-68522404 TCTGGTCAAAAGTAAAAGCAGGG + Intergenic
1161727908 19:5941041-5941063 CCTGCTCCACAGTCCGAGCCTGG + Intronic
1165758087 19:38305555-38305577 TCTGGGCCAGAGTGAGAGCCCGG + Intronic
1167067041 19:47194200-47194222 TCTGGCACAAAGTAAGTGCCAGG + Intronic
1168001923 19:53453659-53453681 TGAGGTCAAAAGTACGAGGCTGG + Intronic
928119004 2:28568296-28568318 TCTTGTCCATAATACGAGCATGG - Intronic
929913484 2:46114089-46114111 TCGGGTCCAAAGGCCCAGCCTGG - Intronic
934912213 2:98269559-98269581 TCTTCTCCAAAGGAGGAGCCAGG + Intronic
934992770 2:98933125-98933147 TCTGGGCCAATGGAAGAGCCAGG + Intronic
947144009 2:227047492-227047514 CCTGGTCCAAAGGGTGAGCCAGG - Exonic
948456561 2:238107197-238107219 TGTGGTCCACAGCACCAGCCAGG - Intronic
1177887120 21:26760790-26760812 TCTGGTCCAAAGGCCCAGCTAGG + Intergenic
1181378795 22:22482635-22482657 TGTGGTCAAGAGTTCGAGCCTGG - Intergenic
955066479 3:55537545-55537567 TCTGCTCTAAAGTGCGAGTCGGG - Intronic
960419555 3:117427127-117427149 TCTGGCTCTAAGTAGGAGCCAGG + Intergenic
961637958 3:128345039-128345061 ACTGGTCCAATGTGCAAGCCTGG + Intronic
963193176 3:142496349-142496371 TCTGGTCCAAGGTAATGGCCAGG - Exonic
972084070 4:35191259-35191281 TCTGGTGAAAAGTAAGAGTCAGG + Intergenic
974893599 4:67911400-67911422 TGTGGTCAAAAGGACAAGCCTGG - Exonic
977135152 4:93294853-93294875 CCTGTTCCAAAGTACGAACTGGG - Intronic
986895736 5:12365012-12365034 TCTGGTTTAATGTAAGAGCCAGG + Intergenic
988109972 5:26807557-26807579 TTTGCTCCAAAATAAGAGCCAGG - Intergenic
989793462 5:45436737-45436759 TCTGGCCCAAAGTACGGGTGTGG - Intronic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1008301987 6:49852381-49852403 CATGGTCCAAAGTATGAACCTGG - Intronic
1015526456 6:134178531-134178553 TCTGGACCAAAGAAAGAGGCTGG - Intronic
1017803333 6:157920158-157920180 TCTGGTAGAAAGTAAAAGCCAGG - Intronic
1019220480 6:170469148-170469170 TCTGGTCCAGTGTTCTAGCCAGG + Intergenic
1022463632 7:30635799-30635821 TCTGATCCAAAGTATTAGGCTGG - Intergenic
1028999538 7:97138917-97138939 TCTGGGCCAGAGTGCAAGCCAGG - Intronic
1039223578 8:35362986-35363008 TCTGGTCCAGAGTCCAATCCCGG + Intronic
1043342511 8:79257271-79257293 TCTGGTCCAGGGTCTGAGCCTGG + Intergenic
1055021243 9:71672390-71672412 TCTGGTCCACAGTACGATTTGGG - Intergenic
1055102950 9:72483983-72484005 TCTAGTCCAAAGTACTAATCTGG + Intergenic
1062311634 9:135941108-135941130 TCAGGTCAAAAGTCCCAGCCGGG + Intronic
1202801365 9_KI270720v1_random:2579-2601 TCTGTTCCAGAGTGCAAGCCTGG - Intergenic
1186435824 X:9542573-9542595 TCTCTTCCAAAGTGCGAGGCGGG - Intronic
1186465953 X:9785345-9785367 TCTGGTCTAAAGTACCTGCATGG - Intronic
1189550293 X:42085650-42085672 TGTGGGCCAGAGTAGGAGCCAGG + Intergenic
1194803186 X:98296252-98296274 CCTGGTCCAGAGTACCAACCAGG - Intergenic
1195278630 X:103308951-103308973 TCTGGTCCATACAACAAGCCTGG + Intergenic
1199449189 X:147960464-147960486 TCTGGTTCAAAGTCCAATCCAGG - Intergenic