ID: 1143724360

View in Genome Browser
Species Human (GRCh38)
Location 17:8835308-8835330
Sequence CCTGCAGGCGGCTCTGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 506}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143724360_1143724372 5 Left 1143724360 17:8835308-8835330 CCTCCCCCAGAGCCGCCTGCAGG 0: 1
1: 0
2: 8
3: 47
4: 506
Right 1143724372 17:8835336-8835358 GGAGACCACGTGGCGCATGCAGG 0: 1
1: 0
2: 0
3: 6
4: 69
1143724360_1143724376 29 Left 1143724360 17:8835308-8835330 CCTCCCCCAGAGCCGCCTGCAGG 0: 1
1: 0
2: 8
3: 47
4: 506
Right 1143724376 17:8835360-8835382 CTCTGGTGTCTGCTGCGCCTGGG 0: 1
1: 0
2: 0
3: 28
4: 170
1143724360_1143724374 12 Left 1143724360 17:8835308-8835330 CCTCCCCCAGAGCCGCCTGCAGG 0: 1
1: 0
2: 8
3: 47
4: 506
Right 1143724374 17:8835343-8835365 ACGTGGCGCATGCAGGTCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1143724360_1143724371 -5 Left 1143724360 17:8835308-8835330 CCTCCCCCAGAGCCGCCTGCAGG 0: 1
1: 0
2: 8
3: 47
4: 506
Right 1143724371 17:8835326-8835348 GCAGGGCGTGGGAGACCACGTGG 0: 1
1: 0
2: 1
3: 24
4: 220
1143724360_1143724375 28 Left 1143724360 17:8835308-8835330 CCTCCCCCAGAGCCGCCTGCAGG 0: 1
1: 0
2: 8
3: 47
4: 506
Right 1143724375 17:8835359-8835381 TCTCTGGTGTCTGCTGCGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143724360 Original CRISPR CCTGCAGGCGGCTCTGGGGG AGG (reversed) Exonic