ID: 1143725063

View in Genome Browser
Species Human (GRCh38)
Location 17:8838991-8839013
Sequence CTGCAGGCCTGGAGTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 410}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143725057_1143725063 -2 Left 1143725057 17:8838970-8838992 CCGAGCCACATTCTGGAAGTCCT 0: 1
1: 0
2: 1
3: 15
4: 209
Right 1143725063 17:8838991-8839013 CTGCAGGCCTGGAGTGCTGAGGG 0: 1
1: 0
2: 7
3: 56
4: 410
1143725054_1143725063 30 Left 1143725054 17:8838938-8838960 CCACAGAGCAGCAGTGCTTGCAG 0: 1
1: 0
2: 3
3: 33
4: 328
Right 1143725063 17:8838991-8839013 CTGCAGGCCTGGAGTGCTGAGGG 0: 1
1: 0
2: 7
3: 56
4: 410
1143725058_1143725063 -7 Left 1143725058 17:8838975-8838997 CCACATTCTGGAAGTCCTGCAGG 0: 1
1: 0
2: 1
3: 13
4: 223
Right 1143725063 17:8838991-8839013 CTGCAGGCCTGGAGTGCTGAGGG 0: 1
1: 0
2: 7
3: 56
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143725063 Original CRISPR CTGCAGGCCTGGAGTGCTGA GGG Intronic
900388348 1:2420716-2420738 CCTCAGGCCTGGAGGGCTGTGGG + Intergenic
900520927 1:3105188-3105210 CTGCCTGCCTGGTGTCCTGAGGG + Intronic
900614382 1:3558106-3558128 CTGCAGGCAGTGAGTGCTGAGGG - Intronic
900797752 1:4719590-4719612 CTGCAGGCCTGGATTGTGGAGGG + Intronic
901254115 1:7806233-7806255 CTGCTTGCCTGCAGTGCTGCTGG - Intronic
902151745 1:14448786-14448808 GTGCAGGGCTGGAGAGGTGAGGG - Intergenic
902998621 1:20248123-20248145 TTGCAGGACTGGGATGCTGAAGG - Intergenic
903026741 1:20434796-20434818 CTGCGTGCCTGGAGTGCGGTAGG + Intergenic
903347309 1:22694994-22695016 ATTCAGGCGTGAAGTGCTGAGGG + Intergenic
903459117 1:23508573-23508595 CTGCAGGCCTGGGGTCCTGAGGG - Exonic
903588024 1:24431849-24431871 CTGAAGACCTGGAGTGGTGGGGG - Intronic
904212231 1:28893583-28893605 CTGGAGGCCTGATGAGCTGAGGG + Intronic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904799762 1:33084064-33084086 CAGCAGCCCAGGTGTGCTGAAGG + Exonic
905894835 1:41538865-41538887 CTGCAGGCCAGGGCTGCTCATGG - Intronic
906083403 1:43108785-43108807 CTGCAGGGGTGGTGTGCTCATGG - Intergenic
906748641 1:48239417-48239439 CCGGAGGCCAGCAGTGCTGAAGG + Exonic
907411324 1:54285776-54285798 CTGCAGCCCTGGCATGCTGTAGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
908407736 1:63831317-63831339 CTGCAGGAGTGGAGTCCTCATGG - Intronic
909412873 1:75374703-75374725 CTCCAGGCATTGAGCGCTGAAGG - Intronic
910556572 1:88541248-88541270 CAGCAGCCTTGGAGGGCTGAAGG - Intergenic
910724955 1:90328464-90328486 ATGCAGGCCTGGGGTGGTGGTGG + Intergenic
910836454 1:91517740-91517762 CTCCAAGCCTTAAGTGCTGACGG - Intronic
910904509 1:92160903-92160925 TTGCAGTCTTGGAGTGCTGATGG - Intergenic
911150049 1:94589813-94589835 CTGCTGGGCTGGAGAGCTGTGGG - Intergenic
912135895 1:106659824-106659846 CTCATGGTCTGGAGTGCTGATGG + Intergenic
912950509 1:114117410-114117432 CTGCCTGCCTGGTGGGCTGAGGG + Intronic
913077348 1:115352253-115352275 CAGCATGCCTGGAGTGTTGAAGG - Intergenic
914517210 1:148384141-148384163 CTGCAGGACCGCAGTGCTCAAGG - Intergenic
917043056 1:170827810-170827832 GTGCAGGACTGGAGTGAGGAAGG + Intergenic
917894910 1:179478310-179478332 CTGCAGGAGTGGGGTGCTAATGG - Intronic
919738793 1:200970318-200970340 CAGCAGGGCTGGACAGCTGAGGG + Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
921007103 1:211104704-211104726 CTGAAGGCCTGGAGTGGGCAGGG - Intronic
921357895 1:214303805-214303827 CTGCAGCCCAGCAGAGCTGACGG - Intronic
921457495 1:215389686-215389708 CTGCAGGGCTGGAGCCCTCATGG - Intergenic
924944430 1:248837057-248837079 ATGCAGGTCTGGAGTGATCAGGG - Intergenic
1062789511 10:292948-292970 CTCCAGAGCTGGGGTGCTGATGG - Intronic
1063040683 10:2334117-2334139 CTGCAGGCCAGGACTGATGGTGG - Intergenic
1063161721 10:3423445-3423467 CTGCAGCTCTGCAGAGCTGAGGG - Intergenic
1064625211 10:17254394-17254416 CTGCAGGCCTGGACTGATGGTGG - Intergenic
1065154213 10:22853061-22853083 CTGCAAGCCTGAAATCCTGATGG + Intergenic
1065513876 10:26506025-26506047 GGGCAGGCCTAGAGTGCTTAAGG - Intronic
1065876302 10:30000265-30000287 CTGCAGGCAAGGAGCCCTGAGGG - Intergenic
1066354276 10:34666604-34666626 CTTCCTGCCTGGAGGGCTGAGGG - Intronic
1066527352 10:36296115-36296137 CTATAGGCCTGTGGTGCTGACGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1068648964 10:59500418-59500440 CTCCAGGCCAGGAGCCCTGAAGG + Intergenic
1068963332 10:62887040-62887062 CAGCCGGGCTGGAGTGCTGGGGG - Intronic
1069512392 10:69052206-69052228 CTGCTGGTCTGGAGTGGGGAAGG + Intergenic
1069786652 10:70992629-70992651 GTGAAGGCCTGGAGTGCCCATGG + Intergenic
1073176557 10:101560679-101560701 CTGAAGGCCTGCCCTGCTGAAGG + Intergenic
1074359293 10:112812450-112812472 CTGCCGGCCTGTATTGCTGTAGG - Intronic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG + Intergenic
1076086206 10:127634423-127634445 CTGCAGGGGTAGAGTGCTTATGG - Intergenic
1076163937 10:128267454-128267476 CTGGAGGCTTGGTGTGCTGGAGG + Intergenic
1076522797 10:131091360-131091382 CTGCAGGCGCTGAGTGCTGCTGG - Intergenic
1076886832 10:133266902-133266924 CTGGAGCCCTGGCATGCTGAGGG - Intronic
1077118086 11:894412-894434 CGGCCGGCCTGGGGTCCTGACGG - Intronic
1077466562 11:2736348-2736370 TTGGAGCCCTGGAGTGCCGAGGG + Intronic
1078241073 11:9531198-9531220 CTGCCAGCCTGGAGTGGGGATGG - Intergenic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078686627 11:13538240-13538262 CTGCAGGCATGGAGCCCTCATGG + Intergenic
1078884459 11:15486176-15486198 CTGCAGGAGTGGGGTTCTGATGG - Intergenic
1079024312 11:16934011-16934033 CTGGAGGCCTGGTTTGCTGGAGG - Intronic
1079134001 11:17765857-17765879 CTGCAGGCATGGCGTGTAGAAGG + Intronic
1081866942 11:46365407-46365429 CTGTATGTCTGAAGTGCTGATGG - Intronic
1083737657 11:64690802-64690824 CTGGGGGCCTCCAGTGCTGAGGG - Intronic
1084069594 11:66725733-66725755 CTGCAGGCTTGGGGTCCTGCTGG + Intronic
1084574081 11:69977508-69977530 CTGCAGGCTGGGAGGGCTGGGGG - Intergenic
1084592886 11:70100574-70100596 CTTCAGGCCTCCAGAGCTGAAGG + Intronic
1084714055 11:70862583-70862605 CTGATGGACTGGACTGCTGATGG + Intronic
1084880743 11:72169814-72169836 CTGCAGGGGTGGGGTGCTCATGG + Intergenic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1086605011 11:88685887-88685909 CTGCAGGATTGGGGTGCTCATGG + Intronic
1089581826 11:119486215-119486237 GTGCAGGCCTGGGGAGCTGCCGG + Intergenic
1090875903 11:130788973-130788995 CTGCATCCCTGGACTGCTGAAGG - Intergenic
1091663677 12:2403110-2403132 ACGTAGGCCTGGAGTGATGAGGG + Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091769208 12:3140496-3140518 CTGCAGGCCTGGGATGCAGAGGG - Intronic
1092070300 12:5626432-5626454 GTCCAGGCCTGGAGTACGGAGGG + Intronic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1092358157 12:7814161-7814183 CTGCAGCCTTGGGGTGCTCATGG + Exonic
1092593678 12:9976079-9976101 CTGCAGGCATGGGGTGCTCATGG + Intronic
1093370511 12:18359024-18359046 CTGCAGCCTGGGAGTGCTGAAGG + Intronic
1094286724 12:28802152-28802174 GTGCTGCCCTGGATTGCTGAGGG + Intergenic
1094524537 12:31222914-31222936 CTGCAGGTCTGGTGGGATGACGG + Intergenic
1094695278 12:32811991-32812013 GTGCAGGCCAGGCATGCTGATGG - Intronic
1094823589 12:34248410-34248432 CTCCTGACATGGAGTGCTGAAGG - Intergenic
1095088096 12:38080049-38080071 CTCCTGACATGGAGTGCTGAAGG + Intergenic
1095169745 12:39020097-39020119 CTGTGGGCCTGGGGTGGTGATGG + Intergenic
1095259659 12:40083540-40083562 CTGCAGTGCTGCAGTGGTGATGG - Intronic
1095419157 12:42007312-42007334 GAGCAGACCTGGAGTGCTTAAGG + Intergenic
1095464401 12:42475506-42475528 CTCCAGGGGGGGAGTGCTGATGG + Intronic
1095985001 12:47993636-47993658 CAGCAGGCCTGGAGAGCTCAGGG - Intronic
1096002740 12:48142924-48142946 CTGCAGGTCTCGAATGGTGAAGG - Exonic
1096740068 12:53686714-53686736 CTGTTGGCCTGTAGTGCAGATGG - Intergenic
1098761863 12:74435005-74435027 CTGCAGGGGTGGAGTCCTCATGG + Intergenic
1099487777 12:83249485-83249507 CTGCAGGGGTGGAGAGCTCATGG + Intergenic
1099491424 12:83292884-83292906 CCGCAGGCCTGGGGTGGTGGTGG + Intergenic
1100086227 12:90913983-90914005 CTGCAGGGGTGGAGTCCTCATGG - Intronic
1101052093 12:100874163-100874185 CTGCAGGGGTGGAGTCCTCATGG + Intronic
1101269026 12:103123277-103123299 TTGCAGGTAGGGAGTGCTGAAGG + Intergenic
1101532447 12:105585999-105586021 GTGCAGGCATGGAGTGATGGTGG + Intergenic
1101726991 12:107395962-107395984 CAGCAGGGAGGGAGTGCTGAAGG + Intronic
1102584752 12:113915078-113915100 CGGCTGGCCTGGAGTGGTGGGGG + Exonic
1102596404 12:113996148-113996170 CTGCAAGCCCAGAGGGCTGATGG + Intergenic
1102998529 12:117367612-117367634 CTCTAAGCCTGGAGTTCTGATGG + Intronic
1103765238 12:123275050-123275072 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765248 12:123275082-123275104 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765254 12:123275098-123275120 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765264 12:123275130-123275152 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765274 12:123275162-123275184 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1104044796 12:125154168-125154190 CTGCAGGCAAGCAGTGCTGAAGG + Intergenic
1104874810 12:132026475-132026497 CTGCAAGGCTGGAGTGGGGAGGG + Intronic
1104925046 12:132309639-132309661 CTGCAGGCCTGTCCTGCTCAGGG - Intronic
1105351362 13:19619205-19619227 CTCCTGACTTGGAGTGCTGATGG - Intergenic
1105783404 13:23724143-23724165 CTGAAGACCTGGAAAGCTGAGGG + Intergenic
1106420285 13:29580207-29580229 CTCCAGGCCGTGACTGCTGAGGG + Intronic
1107105349 13:36636917-36636939 CTGCAGGGGTGGAGTCCTCATGG - Intergenic
1108429036 13:50335473-50335495 CTGGAGGGCTGGAGTGCAAATGG + Intronic
1108663363 13:52605990-52606012 CTGCAGGCCAGGACTGCAGTGGG - Intergenic
1108848203 13:54699980-54700002 AGGCAGGCATGGAGTGGTGAGGG + Intergenic
1109037724 13:57286795-57286817 CGGCAGGCCGGAAGTGCTGGCGG + Intergenic
1110357761 13:74588195-74588217 CTGCTGGCCTGGACGACTGAAGG + Intergenic
1114171084 14:20273141-20273163 CTGCAGGGGTGGAGTTCTCAGGG + Intronic
1114657069 14:24322692-24322714 CTTCAGGCCCGGAGTGCTGAAGG - Exonic
1115065679 14:29256995-29257017 CTGCAGGAGTGGAGTCCTCATGG - Intergenic
1116192631 14:41679983-41680005 CTGAGGGCCTGGAGTGGTGGCGG + Intronic
1116239027 14:42317043-42317065 CTGGCAGCCTGTAGTGCTGATGG - Intergenic
1116991989 14:51286477-51286499 CTGCAGGCCAGGGGTGCTCATGG + Intergenic
1117881849 14:60320214-60320236 CTGCAGGGGTGGAGTCCTCATGG + Intergenic
1117907521 14:60605819-60605841 CTGCAGGGGTGGAGTCCTCATGG + Intergenic
1117908215 14:60611937-60611959 CTGCAGGGGTGGAGTCCTCATGG - Intergenic
1118310172 14:64686137-64686159 GGGCAGGCCTGGAGTGCAGCTGG - Intergenic
1118989019 14:70781303-70781325 CTGGAGGCCAGGACTGCTGATGG - Intronic
1119264294 14:73254954-73254976 CCACAGGCTTGGAGTGCTGCAGG - Exonic
1119420324 14:74504342-74504364 CTTCAGGACTAGGGTGCTGAGGG + Intronic
1119862660 14:77947800-77947822 CTGCAGGGGTGGAGCGCTAATGG + Intergenic
1120417336 14:84236443-84236465 ATGCAGGCCTGTACTGGTGAGGG - Intergenic
1121592955 14:95133414-95133436 CTGCAGGCCTGCCATGCTGAGGG + Exonic
1121699564 14:95942337-95942359 CTGCAGGGGTGGAGTCCTTATGG + Intergenic
1122251855 14:100445535-100445557 CTGCAGGCTGGGAGTGGAGAAGG + Intronic
1122414000 14:101540154-101540176 ATGCGGCCCTGGAGTGCTGCTGG + Intergenic
1122635831 14:103129214-103129236 CTGCAGGGCTGGAGCGCAGTGGG + Intronic
1123143682 14:106108022-106108044 CTGCAGGTAGGCAGTGCTGATGG + Intergenic
1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG + Intergenic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG + Intergenic
1124847344 15:33304321-33304343 CAGGAGGCCTGCAGTGCTGCTGG - Intergenic
1125365318 15:38907979-38908001 CAGTTGGCCTGGAGTGATGATGG - Intergenic
1125885535 15:43226739-43226761 CGGTAGGCCGGCAGTGCTGAGGG + Intergenic
1126097223 15:45098139-45098161 CTGCTGGCCCTGACTGCTGAGGG + Intronic
1126347975 15:47717025-47717047 CTGCAGCCCAGGAGAGCTGCGGG - Intronic
1126716724 15:51525666-51525688 CTGTAGGCCTGAAGTCCTGGTGG + Intronic
1127269020 15:57384153-57384175 CTCCAGGCCTGGCTTGCTCATGG + Intronic
1128324010 15:66711808-66711830 CTGGAGGGCTGGAGGGCTGGAGG + Intronic
1128882062 15:71252995-71253017 CTGCAAGCCTGGAGGGCAGAGGG - Intronic
1129659743 15:77546520-77546542 AAGCAAGCCTGGAGTACTGAAGG + Intergenic
1131113857 15:89782093-89782115 CTGCTGGACTTGAGTGCTGAGGG + Intergenic
1131176285 15:90211623-90211645 CTCCAGGGCAGGAGTGCTGACGG - Intronic
1132005029 15:98218958-98218980 CAGCAGGCCAGGAGGCCTGATGG + Intergenic
1132242165 15:100266337-100266359 CTGCAGGGCCAGAGTGCTGCTGG + Intronic
1132860340 16:2067955-2067977 CTCCAGCCCTGGAGGCCTGAGGG + Intronic
1132974646 16:2705287-2705309 CAGCTGGCATGGAGTGCGGACGG - Intronic
1133931000 16:10232021-10232043 CTGCATTCCTTGAGTGATGAAGG + Intergenic
1134097055 16:11424858-11424880 TGGGAGGCCTGGAGGGCTGATGG + Intronic
1134110807 16:11514482-11514504 CTTCCGGGCCGGAGTGCTGAGGG - Exonic
1134941536 16:18293374-18293396 GTAGAGGCCTGGAGTGCTGGTGG - Intergenic
1137288704 16:47037472-47037494 CCGAGGGCCTGGAGTGCGGAGGG - Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1140407361 16:74719568-74719590 CTGGAGTGCTGGAGTGCTGGAGG + Intronic
1141170244 16:81686399-81686421 CTGCAGTGCTTGAGTGCGGAAGG - Intronic
1141226326 16:82119548-82119570 CTGCAGGCCTGGGGTAGTGCTGG + Intergenic
1141547245 16:84778570-84778592 CTGTAGGCCTGTACAGCTGATGG + Intronic
1141983681 16:87565763-87565785 CCGCAGGCCTGGGGTGTAGAGGG + Intergenic
1142285411 16:89169623-89169645 CTGGAGGCTTGGGGTGCTGAGGG + Intergenic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1143304002 17:5931817-5931839 CTGCAGGCGGGGAGTACTGCGGG + Intronic
1143725063 17:8838991-8839013 CTGCAGGCCTGGAGTGCTGAGGG + Intronic
1144380598 17:14693704-14693726 TGGCAGTCCTGGAGTTCTGATGG - Intergenic
1144663188 17:17084801-17084823 CTGCAGGCCTGCAACGCTGTAGG + Intronic
1144848116 17:18230572-18230594 CTGCAGGCCTGGGGTGGGGGTGG + Intronic
1146269672 17:31476749-31476771 CTGCAGCCCAGGAGGGCTGAAGG - Intronic
1146586874 17:34090369-34090391 CTGCAGACCTGGTGTTCTGATGG + Intronic
1147212854 17:38882147-38882169 CTGCATGGCTGCAGTCCTGAAGG - Intronic
1148716183 17:49717745-49717767 CTGCAGGCCTGAAATACTCAGGG - Intronic
1148807882 17:50273347-50273369 CTCCGCGCCTGGAGTGCTGGAGG + Intronic
1149238091 17:54616640-54616662 CGTCAGGCGTGGAGTGGTGAGGG - Intergenic
1149348179 17:55759773-55759795 CTCCAGGCCTGGATGGGTGATGG + Intronic
1149555926 17:57573579-57573601 CAGCAGGTCTGGAGTGATGGGGG - Intronic
1149598568 17:57878497-57878519 GCTCAGGCCTGGAGTGGTGAGGG - Intronic
1150073122 17:62169369-62169391 CTGCAGTCCAGGAATGATGAGGG + Intergenic
1150836151 17:68565803-68565825 ATGGAGGCCTGGAGTGGAGAAGG - Intronic
1151855317 17:76717157-76717179 CTGAAGCCCTTGACTGCTGAAGG - Intronic
1152233150 17:79124986-79125008 CTCCGGGCCTGGCGTGGTGATGG + Intronic
1152568634 17:81111558-81111580 CTGCAGACCTGGAGGGCTGCTGG + Intronic
1152631413 17:81412193-81412215 CTGCTGGCCTGGAGTGACCAGGG - Intronic
1152941618 17:83175705-83175727 CTGCTTGCCTGGAGTCCAGAGGG + Intergenic
1153342995 18:3994335-3994357 CTTCAGGCCTAGAGTGGCGAGGG + Intronic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1156632376 18:38985434-38985456 CTGCAGGTGTGGAGTACTCATGG + Intergenic
1157444568 18:47735092-47735114 CTGAAGCCCAGGAGGGCTGATGG - Intergenic
1157564072 18:48668069-48668091 CTGCAGGTTTGGAGGGCTGAAGG - Intronic
1158234801 18:55301018-55301040 CTCCAGGCCGGATGTGCTGAGGG - Intronic
1159316351 18:66778694-66778716 CTGAAGGCCAGAAGTCCTGAAGG + Intergenic
1160498381 18:79388331-79388353 CTCCAGGAGTTGAGTGCTGACGG - Intergenic
1160752550 19:741354-741376 CAGCTGGGCTGGAGGGCTGAGGG + Intronic
1160905870 19:1451543-1451565 CTGCAGGGCAGGAGTGCCCAAGG - Exonic
1161001663 19:1913977-1913999 CTGCAGGCCTGGCGGGCTCCTGG - Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161166671 19:2791507-2791529 CTGCAGGCTTGGGGTGCTTGCGG - Intronic
1161821117 19:6531744-6531766 CTCCTGGCCTGGGGTGCTGATGG - Intronic
1161982944 19:7639315-7639337 CTGCAGCCAGGGAGTGCTGCAGG - Intronic
1162306238 19:9875932-9875954 CTGCAGGCCTGCATGGCTAAAGG - Intronic
1162514392 19:11139213-11139235 CTGCAGGCCTGGCGTGATCAAGG + Intronic
1162992894 19:14314781-14314803 CTCCAAGCCTGGAGTGATGAGGG + Intergenic
1163289333 19:16369181-16369203 CTGCAGGCTGGGAGTCCTGCAGG + Intronic
1165632343 19:37312480-37312502 GTGCAGGGCAGCAGTGCTGAGGG - Intergenic
1168361593 19:55745379-55745401 CTGAAGGTCTGGAGTGCATAAGG - Intergenic
926311691 2:11680103-11680125 CAGCAGTCCAGGAATGCTGAGGG + Intronic
926921181 2:17941670-17941692 CTCCAGGGCTGGGGTGCTTAAGG + Intronic
927083577 2:19653567-19653589 CAGCAGGCCGGCAGTGCAGAAGG - Intergenic
929076000 2:38079363-38079385 CTTCAAGCCTGGAGTTCTTAGGG + Intronic
929195621 2:39181454-39181476 CTGCAGGTCTGGAGTTCACAGGG - Intronic
929467350 2:42156940-42156962 CTGCCCACCTGGGGTGCTGAGGG - Intergenic
929532740 2:42762878-42762900 CTGCAGGGCTGCAGCGCTGTGGG - Exonic
929534324 2:42771040-42771062 CTGCTGGCCTGCAGTGCTCTAGG + Intronic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
929920472 2:46167859-46167881 CTTCAGGGCTGGGGTGCTGAGGG - Intronic
930145981 2:48004717-48004739 CTTCCTGCCTGGAGTGTTGAGGG - Intergenic
930599307 2:53424976-53424998 CTGCTGGCCTGGAGTGCCCGGGG + Intergenic
930892195 2:56403481-56403503 ATGCAGGAGTGGAGTGGTGAGGG - Intergenic
931217956 2:60263814-60263836 CTCCAGGCCTGGAGTGCTAGTGG - Intergenic
931248395 2:60509833-60509855 CTGAAGTCCTGAAGTGGTGAAGG + Intronic
932206558 2:69888615-69888637 CCGCAGGCCTGGGGTGGTGAAGG + Intergenic
932280009 2:70482507-70482529 CAGCAGTCCTGGAATGCTGTTGG + Intronic
932407202 2:71521551-71521573 GGGCAAGCCAGGAGTGCTGAAGG + Intronic
932411643 2:71551205-71551227 ATGCAGGCCTGGGCTCCTGAGGG - Intronic
934614800 2:95764326-95764348 CTGCAGGCCTGGATGGTTGAAGG + Intergenic
934646103 2:96060168-96060190 CTGCAGGCCTGGATGGTTGAAGG - Intergenic
934650017 2:96085386-96085408 ATGCAGGCCTGGGCTGCAGAGGG + Intergenic
934751958 2:96799419-96799441 CTGGAGCCCTGGAGAGCTCAGGG - Intronic
934839506 2:97616251-97616273 CTGCAGGCCTGGATGGTTGAAGG - Intergenic
934996614 2:98967443-98967465 GTGCAGGGCTGGGGTGCTGGTGG + Intergenic
936270802 2:111047059-111047081 CAGCAGGCATGGGGTCCTGAGGG + Intronic
937958466 2:127437250-127437272 CTGCAGGCCTGGCGTGCGTGGGG + Intronic
938236422 2:129710004-129710026 CTGGAGGCCTGCAATCCTGATGG + Intergenic
939361252 2:141175615-141175637 CTGCAGGACTGGAGCCCTCATGG + Intronic
939712254 2:145536806-145536828 CTGCAGTCCTGGAGGAATGAAGG - Intergenic
939754608 2:146094156-146094178 CTGCAGGGCTGGAGCCCTCATGG - Intergenic
940361929 2:152805009-152805031 CAGCAGGCCGGCACTGCTGAGGG + Intergenic
940974354 2:159926801-159926823 CTTCAGGCCTGGGGTGGTGAAGG - Intergenic
941005761 2:160245334-160245356 GTGCATGCTTGGAGTGTTGATGG - Intronic
942027191 2:171922246-171922268 TTGCAGGCCTGAAGTGGAGAAGG - Intronic
942403508 2:175628648-175628670 CTGAGGACCAGGAGTGCTGAAGG - Intergenic
942914765 2:181291974-181291996 CTACAGACCTGGAGTGATAATGG + Intergenic
942930625 2:181488354-181488376 CTTTAGGAGTGGAGTGCTGAGGG - Intronic
944055198 2:195515866-195515888 CTGCAGGTCTGGAGCCCTGCAGG - Intergenic
944487004 2:200217563-200217585 CTGCAGGCCTGCAGAGCTCCAGG + Intergenic
945457107 2:210063292-210063314 CTGCAGGGGTAGAGTGCTCATGG + Intronic
948101255 2:235374905-235374927 CTGCAGCCCAGGAGTCCTTAAGG - Intergenic
948306844 2:236954727-236954749 CTGCAGGGCTGGGGTGCAGAAGG + Intergenic
948368753 2:237474628-237474650 CTGCAGGCCTGGAGTTCCTGGGG + Intergenic
948425433 2:237884281-237884303 CTGCAGCCTTGGTTTGCTGATGG + Intronic
948616933 2:239205035-239205057 CTGCAGGAGTTCAGTGCTGAGGG - Intronic
948776760 2:240293224-240293246 CTGGAGGCCTGCAGTGCCCAGGG + Intergenic
948903422 2:240967126-240967148 CTGCAGGCCTGGGGAGGTGGAGG - Intronic
948920917 2:241065564-241065586 CAGCAGGCCTGCCGTGCTGCTGG + Exonic
1170161262 20:13313524-13313546 CAGCAGGGCTGGAGTGTTGCTGG + Intergenic
1170866878 20:20165418-20165440 CTGTAGCCCTGGATTGCTGTTGG - Intronic
1172091591 20:32436651-32436673 CCGCAGGCCTGGGGCGCTGAAGG - Exonic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1173282722 20:41643719-41643741 CTGCGTGCCTGGAGTGGTGTAGG - Intergenic
1173423434 20:42923067-42923089 GGGCAGGGGTGGAGTGCTGAAGG - Intronic
1174388824 20:50204628-50204650 CTGCAGGCCTGCATCGCTGCTGG - Intergenic
1174403268 20:50287709-50287731 CTGCACTCCTGGAGTCCTGATGG + Intergenic
1174883049 20:54302112-54302134 CAGAGGGCCTGGAGTACTGATGG + Intergenic
1175525791 20:59632472-59632494 CTGTGGGCTTGGAGTGCTGGTGG + Intronic
1175660478 20:60808284-60808306 CTGCAGGCCTGGCCAGCTGCTGG + Intergenic
1175899480 20:62354377-62354399 GCTCAGGCCTGGAGTCCTGAGGG - Intronic
1175905474 20:62377546-62377568 ATGCAGGCCTGGAGCTCAGATGG + Intergenic
1176195388 20:63834520-63834542 CAGCAGGCCAGGAGTTCTGGAGG + Intergenic
1177133294 21:17282962-17282984 CTGCAGGGATGGGGTGCTCATGG + Intergenic
1177529761 21:22343930-22343952 CTGCTGGGCTGAAGTGCTAAAGG - Intergenic
1177532087 21:22373785-22373807 CTGCAGGGCTGGAGGCCTCATGG - Intergenic
1178351308 21:31874250-31874272 CTGCCGGCCTGAAGGGCAGAGGG - Intronic
1178388756 21:32181203-32181225 CTGAAAACCAGGAGTGCTGAGGG - Intergenic
1178741678 21:35207222-35207244 CTGCAGACCCTGAGTGCTGAGGG + Intronic
1179471319 21:41612698-41612720 CTGCCTTCCTGAAGTGCTGAAGG + Intergenic
1179559160 21:42201908-42201930 CTGAAGGGCAGAAGTGCTGAAGG - Intronic
1179585984 21:42374323-42374345 CTGCAGGGCGGCAGTGCTGGAGG + Intronic
1180042707 21:45288255-45288277 CTGGGGGCCGGGAGGGCTGACGG + Intergenic
1180075355 21:45459078-45459100 ATGCAGGCCAGGAACGCTGATGG - Intronic
1180713976 22:17859048-17859070 CTACAGACCTGGGGGGCTGAGGG + Intronic
1181402842 22:22661725-22661747 CAGCCTGCCTGGAGGGCTGAAGG - Intergenic
1183671671 22:39276504-39276526 CTTCCAGCCTGCAGTGCTGAGGG + Intergenic
1184338891 22:43874625-43874647 CTGCAGGGGTGGAGTCCTCATGG + Intergenic
1184411492 22:44328854-44328876 CTGCAGACCTGGAGGGCTGGGGG - Intergenic
1184596776 22:45518699-45518721 CTGGAGGCCTGCTGTGCGGACGG + Exonic
1184922308 22:47614192-47614214 CTGCAGGCCTGGCATGAGGAAGG - Intergenic
1185085701 22:48739952-48739974 CTGCAGTCCTGGACAGTTGAGGG - Intronic
1185275624 22:49949200-49949222 GTGGAGGCCTGGAGTCCTGCAGG + Intergenic
1185366589 22:50439647-50439669 GGGCAGGCCTGGGGTGCTGCAGG - Intronic
1185383830 22:50522579-50522601 CAGCGGGCTAGGAGTGCTGAGGG + Intronic
949359993 3:3221504-3221526 CTGCAGGCCAGGGGTGGTGGTGG + Intergenic
952070182 3:29625125-29625147 CTGCAGGGCTGGGGAGGTGAAGG - Intronic
952318065 3:32249092-32249114 CTGCAGGCCTGGACTCCCAAAGG + Intronic
952980413 3:38729483-38729505 CTGCACGGCTGGAGTTCTGGGGG - Intronic
953391179 3:42534757-42534779 CTCCAGGCCAGGAGGGCTGGGGG + Intronic
953972055 3:47355578-47355600 GTGCAGGACAGGGGTGCTGAAGG + Intergenic
957929767 3:86863103-86863125 CTGCAGGAGTGGGGTGCTCAAGG + Intergenic
960383507 3:116992538-116992560 CTGGAGGCCTAGAGTGCTTAGGG - Intronic
960519939 3:118643101-118643123 CTGTAGGCATGGAGGTCTGAGGG - Intergenic
960671364 3:120157866-120157888 CCGCAGTTCTGGAGTGATGAGGG + Intergenic
961434331 3:126906277-126906299 CTGGAGGCCTGGAGGCCTGGAGG - Intronic
961986278 3:131138280-131138302 CTGTAGGCCTGTAGTGGTGGTGG + Intronic
962309841 3:134317667-134317689 CTGCTGGCATGCAGGGCTGATGG - Intergenic
962853429 3:139324828-139324850 CTGCAGGCCAGCAGGGCTAAGGG + Intronic
963277997 3:143352055-143352077 CTGCAGGCTCTGGGTGCTGAAGG - Intronic
963798844 3:149657713-149657735 CTGGAGCCCTGGAGTGGTGCCGG + Intronic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
966898282 3:184461980-184462002 CTGCAGGCCAGGACTGATGCTGG + Intronic
968359851 3:198139214-198139236 CTGCCGGCCTTCAGTGCTGATGG - Intergenic
968502529 4:957551-957573 CTGCTGGCCCAGAGTGCTGCTGG - Intronic
968658630 4:1789573-1789595 CTGCCTGCCCGGAGTGCTGTGGG + Intergenic
969078316 4:4598585-4598607 CTGTAGCCCTGGAGGCCTGAAGG + Intergenic
969652777 4:8477765-8477787 CTGCAGGACTGGGGGGCCGAGGG - Intronic
970683143 4:18534656-18534678 CTGGAGGCCAGGAAAGCTGATGG - Intergenic
971024157 4:22571572-22571594 CTGCAGGCCTGGAATGTCAATGG + Intergenic
971593393 4:28497463-28497485 CTGCAGGGGTGGAGTCCTTATGG + Intergenic
973330414 4:48906373-48906395 CTGCAGGGCTGGACGGCGGACGG + Intronic
973540416 4:51929770-51929792 CTGAGGTCCAGGAGTGCTGAAGG + Intergenic
974248905 4:59359929-59359951 CTGCAGGGCTGGAGCCCTCATGG + Intergenic
974372248 4:61032602-61032624 CTGAAAGTCTGCAGTGCTGAGGG - Intergenic
975052245 4:69880325-69880347 CTTCAGGCCAGGAGTGGTGATGG - Intergenic
975796565 4:78012462-78012484 CTGCAGGGCTGGAGCCCTCATGG + Intergenic
977754236 4:100647809-100647831 CTGTTGGCCAGGAGTGGTGAAGG - Intronic
977976263 4:103270245-103270267 CTTGAGACCTGGAGAGCTGATGG + Intergenic
978074227 4:104509048-104509070 CTGGAGGCCAGGAAAGCTGATGG - Intergenic
981038034 4:140192232-140192254 CTGCTGGCCTGGAGACCTGTCGG - Intergenic
981545342 4:145887606-145887628 CTGCTGGGGTGGAGTGCTGGGGG + Intronic
982730783 4:158953469-158953491 CTGCAGGGGTGGGGTGCTCATGG + Intronic
984925898 4:184806393-184806415 ATTCAGGCCTGGAGTGCTGCAGG - Intronic
985246845 4:187987481-187987503 CGGCATGCCTGAAGAGCTGAGGG + Intergenic
986046148 5:4040187-4040209 CTGCAGACCTGGGGTTCTGATGG - Intergenic
986129068 5:4910352-4910374 CTGCAGGGGTGGAGTCCTCATGG - Intergenic
986353305 5:6900667-6900689 CTGCAGGGCTGGAGTGCGGAGGG + Intergenic
986946945 5:13033015-13033037 CTCCACGCCTGGAGTTCTCATGG - Intergenic
987300956 5:16597800-16597822 TTTCAGGCCTGGAGAACTGACGG - Intronic
987727058 5:21716619-21716641 CTGCAGGGGTGGAGTCCTCATGG - Intergenic
987983892 5:25121651-25121673 CTGCAGGCATGGAGCCCTCATGG - Intergenic
988892240 5:35630367-35630389 CTGCAGGCATGGAGCCCTCATGG - Intronic
989349047 5:40463588-40463610 CTGCAGTCCTGAGGTGCTGCAGG - Intergenic
989702896 5:44291722-44291744 CTGCATACAGGGAGTGCTGAAGG + Intergenic
991942280 5:71864300-71864322 ATGGAGGCCTGGAGGGGTGATGG + Intergenic
992108244 5:73468376-73468398 CTGAAGACCTGGAGTGCTGATGG + Intergenic
993060320 5:83030501-83030523 CTGCAGGCCTGGGGTGGTGGTGG + Intergenic
993190137 5:84670595-84670617 CTGCAGGCTTGGAGCCCTCATGG + Intergenic
994775150 5:104030463-104030485 GTGAAGGCCTGGAAAGCTGATGG + Intergenic
999048618 5:148496968-148496990 CTGCAAACCTGGAGTTCTGATGG + Intronic
999261310 5:150240596-150240618 CTCCTGGCTTGGAGAGCTGAGGG - Intronic
1000229088 5:159298340-159298362 CTGCAGGGGTGGAGTCCTCATGG - Intergenic
1000515985 5:162236801-162236823 CTGCAGGGGTGGAGTCCTCATGG - Intergenic
1002284311 5:178152094-178152116 CTGTAGTCCTGGAGAGGTGATGG - Intronic
1002556537 5:180046131-180046153 GTGCAGGCCCACAGTGCTGAGGG + Intronic
1002772890 6:304371-304393 TTGCAGCCCTGCAGTGCTGGTGG - Intronic
1003670266 6:8150870-8150892 CTGGAGACCAGGAGAGCTGATGG + Intergenic
1004405697 6:15331373-15331395 CTGTAGGCCAGGAGTGGTGAAGG + Intronic
1004966048 6:20852924-20852946 CTGCAATCCAGGAGTGGTGAAGG + Intronic
1005089743 6:22043811-22043833 CTGCGGGCATGCTGTGCTGATGG + Intergenic
1005173010 6:23009821-23009843 CTGGAGACCAGGAGAGCTGATGG - Intergenic
1006736060 6:36273427-36273449 CTGAAGGCCTGGAGTTCAGTGGG - Intronic
1006789633 6:36691288-36691310 CTGCAGGCCTAGAAGGCTCAAGG + Intergenic
1007417932 6:41702933-41702955 CCGCCTGCCTGGTGTGCTGATGG + Intronic
1007785527 6:44277233-44277255 CTGCAGGACTGGGGAGCGGAAGG - Exonic
1008528859 6:52435632-52435654 CTGCAGACCTGGACTATTGAAGG + Intronic
1011218872 6:85033474-85033496 CTGCAGGCATGGAGCCCTCATGG - Intergenic
1012987194 6:105887533-105887555 TTCCAGGCCTGGCTTGCTGATGG - Intergenic
1013759159 6:113496321-113496343 CTGCAGGTCAGGGGTGATGAAGG + Intergenic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1014374762 6:120659150-120659172 CTGCAGGGGTGGAGCCCTGATGG - Intergenic
1016939868 6:149474847-149474869 CTGCAGCCCTGGTGTGCGGTCGG - Intronic
1017038605 6:150289399-150289421 AAGCAGGACTGGAGAGCTGAGGG + Intergenic
1018244965 6:161813829-161813851 CTGAAAGACTGGGGTGCTGATGG + Intronic
1018492962 6:164315591-164315613 CTGCTGGCATGTAGTGATGAAGG + Intergenic
1019294458 7:266553-266575 CTGCAGGCCAGGTGTGCCGAGGG - Intergenic
1019482838 7:1274326-1274348 CCGCAGGCCTGAAGTGGTGGGGG + Intergenic
1024487186 7:49932095-49932117 CTGCAGGGGTGGAGTTCTCATGG + Intronic
1024488472 7:49947970-49947992 CTGCAGGCCTGGGGCAATGATGG - Intronic
1025297734 7:57789608-57789630 GTGCAGGGCAGCAGTGCTGAGGG + Intergenic
1026158555 7:67849115-67849137 CTGCAGGCCTGGAACACTGGGGG + Intergenic
1026282339 7:68933098-68933120 CTGCATGCCTGGAGTGAGCAGGG - Intergenic
1028524850 7:91772710-91772732 CTCAATGCCTGCAGTGCTGACGG - Intronic
1029125271 7:98291105-98291127 CTGCAGGGTTGGGGTGCTGGAGG + Exonic
1029574899 7:101396935-101396957 CCCCAGGCCTGGGCTGCTGAAGG - Intronic
1029637368 7:101793970-101793992 CTGGAGGGCTGGAGCACTGATGG + Intergenic
1030170664 7:106599452-106599474 CTTCATGCCTGGGGTGGTGAAGG + Intergenic
1031170019 7:118281679-118281701 CTCCAAGCCTGGTGTGCTTAAGG - Intergenic
1033062430 7:138121872-138121894 GTTCAAGCCTGGAGTGCAGAAGG - Intergenic
1034940829 7:155229090-155229112 CAGCAGGGCTGGCGTGGTGAGGG + Intergenic
1035929586 8:3765703-3765725 CTGCAAGGCTGCAGTGCTGATGG - Intronic
1036952509 8:13154385-13154407 CTGCGGGCCAGCAGTGCTGGGGG + Intronic
1039699333 8:39946265-39946287 CAGCGAGCCAGGAGTGCTGACGG - Intronic
1039843481 8:41309455-41309477 CTGCAGGGCTGGAGTGCGCGGGG + Exonic
1039888386 8:41668541-41668563 CTGCAGGACTGGGATGCAGACGG - Exonic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1040900328 8:52411185-52411207 CTGCATGCCTGCAGTGGGGAGGG - Intronic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041416064 8:57609775-57609797 CTGCAGGCCTGGCATGGTGATGG + Intergenic
1042605467 8:70541634-70541656 CTGCAGGAGTGGAGTCCTCATGG + Intergenic
1043134182 8:76500578-76500600 CTGCAGGCCTGGGGTGGTGATGG - Intergenic
1043812004 8:84752865-84752887 CTGCAGGGCTGGAGCCCTCATGG + Intronic
1044241513 8:89893489-89893511 CTGCATGCCTGGGGTGGTGGTGG + Intergenic
1044303938 8:90616671-90616693 CTGCAGGGGTGGAGCCCTGAGGG + Intergenic
1045124198 8:99071847-99071869 CTGCAGACCTGGGGTGATGATGG - Intronic
1045172484 8:99686630-99686652 CTGCAGGCCTGGGATGGTGGTGG - Intronic
1047456448 8:125017392-125017414 CTGCAGGCCTGGAGCACTGGTGG - Intronic
1048416791 8:134235494-134235516 CTGCAGGGGTGGAGTCCTCATGG - Intergenic
1049004215 8:139844668-139844690 CTGCTGGCATGGACTGCTGGTGG + Intronic
1049700954 8:144012314-144012336 CTGGTGGCATGGAGAGCTGAGGG + Intronic
1050097526 9:2082219-2082241 GTGCAGACCTGTAATGCTGATGG - Intronic
1050674521 9:8036816-8036838 CTGCAGGAGTGGAGTCCTCATGG - Intergenic
1050832283 9:10029215-10029237 CTGCAGGGGTGGGGTGCTCATGG + Intronic
1051476618 9:17515921-17515943 ATGCAGGCCTTGAAGGCTGAAGG - Intergenic
1052267410 9:26590517-26590539 CTGCAGGGGTGGGGTGCTCATGG - Intergenic
1052767942 9:32660542-32660564 CTGCAGGGGTGGGGTGCTCATGG - Intergenic
1052975053 9:34403958-34403980 CTAGAGGCCTGGAGTGGTAATGG - Intronic
1053317315 9:37063046-37063068 GTGCACGCCTGTAATGCTGATGG + Intergenic
1053531605 9:38887526-38887548 ATGGAGGCTTGGAATGCTGAGGG + Intergenic
1053795873 9:41726423-41726445 GTGCAGGGCAGCAGTGCTGAGGG - Intergenic
1054149306 9:61588450-61588472 GTGCAGGGCAGCAGTGCTGAGGG + Intergenic
1054184280 9:61938494-61938516 GTGCAGGGCAGCAGTGCTGAGGG - Intergenic
1054203829 9:62111954-62111976 ATGGAGGCTTGGAATGCTGAGGG + Intergenic
1054469068 9:65519561-65519583 GTGCAGGGCAGCAGTGCTGAGGG + Intergenic
1054634533 9:67476411-67476433 ATGGAGGCTTGGAATGCTGAGGG - Intergenic
1054654226 9:67650001-67650023 GTGCAGGGCAGCAGTGCTGAGGG + Intergenic
1055713322 9:79088961-79088983 CTGCAGGAGTGGGGTGCTCATGG - Intergenic
1056202719 9:84291849-84291871 CTGCATATCTGGAGTGATGAGGG + Intronic
1057083447 9:92189266-92189288 CTGCGGGCCTGGACCCCTGAGGG + Intergenic
1058217962 9:102258367-102258389 ATACAGGCCGGGAGTGATGATGG - Intergenic
1058401561 9:104625355-104625377 CTGCAGGGATGGGGTGCTCATGG + Intergenic
1061396142 9:130344147-130344169 CTGCAGGTCGGGAGGGGTGATGG - Intronic
1062040261 9:134401308-134401330 GGACGGGCCTGGAGTGCTGAGGG + Intronic
1062480240 9:136747720-136747742 CTGCAGGGCTGGAAGGCTGGAGG - Intronic
1062480274 9:136747840-136747862 CTGGAGGGCTGGAGAACTGAAGG - Intronic
1062496474 9:136833787-136833809 CTGCAGGCTGGGACTGCTGCTGG + Intronic
1062542005 9:137045745-137045767 CTGCAGGCCTGGTCCGCTGGTGG - Intronic
1185641937 X:1593139-1593161 CTGCAGGCCTTGGGAGCTGCTGG + Intronic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1188773947 X:34189622-34189644 CTGCAGGGGTGGAGTCCTAATGG - Intergenic
1190387617 X:49898180-49898202 CTGCAGGGGTGGAGTGCTCATGG + Intergenic
1190822285 X:53985108-53985130 CTGCAGGCCTGGTGGACTGGGGG - Exonic
1192378321 X:70587605-70587627 CTGCAGGGGTGGAGTCCTCATGG + Intronic
1192680446 X:73248274-73248296 CTGTAGGGGTGGAGTGCTCATGG + Intergenic
1192858454 X:75039672-75039694 CTGCAGGCCTGGGGTGGTGATGG - Intergenic
1193291340 X:79776903-79776925 ATGCAGTCCAGGAGTGCTGAAGG - Intergenic
1194043324 X:88970513-88970535 CTGCAGGGCTGGAGCCCTTAAGG - Intergenic
1194484808 X:94473563-94473585 CTGCAGGCATGGAGTCCTCATGG + Intergenic
1194692877 X:97009199-97009221 CTGCAGGCCTGGGGTGGTGATGG - Intronic
1194843627 X:98776165-98776187 CTGCAGGCTTGGAGTCCTCATGG + Intergenic
1195608345 X:106835100-106835122 CTGCAGGGGTGGAGTCCTCATGG - Intronic
1198405979 X:136312815-136312837 GTCAAGGCCTGGAGTGCTGGGGG - Intronic
1198952186 X:142083728-142083750 CTGCAGTCCTGATGGGCTGAGGG - Intergenic
1199117342 X:144008361-144008383 CTGCAGGGCTGCAGGGCTGCAGG + Intergenic
1199383258 X:147194507-147194529 CTGCAGGGGTGGAGTCCTCATGG + Intergenic
1199566101 X:149217239-149217261 CTGCAGGGGTGGAGTCCTCATGG + Intergenic
1200168038 X:154050748-154050770 AAGCAGTCCTGGACTGCTGAGGG + Intronic
1200243668 X:154511397-154511419 CTGCCGGCCTGGAGTGAAGGGGG + Intronic
1201430428 Y:13896965-13896987 CTGCTGGACAGGAGTGATGAAGG - Intergenic
1201911881 Y:19141086-19141108 CAGGAGGCCTTGAGTCCTGAAGG - Intergenic