ID: 1143730533

View in Genome Browser
Species Human (GRCh38)
Location 17:8880387-8880409
Sequence ATCCTTCTCCTTCTACTGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143730526_1143730533 22 Left 1143730526 17:8880342-8880364 CCTAGACCATGCTAATGGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1143730533 17:8880387-8880409 ATCCTTCTCCTTCTACTGCCAGG 0: 1
1: 0
2: 2
3: 20
4: 254
1143730529_1143730533 16 Left 1143730529 17:8880348-8880370 CCATGCTAATGGTCAGGGACTTC 0: 1
1: 0
2: 1
3: 11
4: 109
Right 1143730533 17:8880387-8880409 ATCCTTCTCCTTCTACTGCCAGG 0: 1
1: 0
2: 2
3: 20
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143730533 Original CRISPR ATCCTTCTCCTTCTACTGCC AGG Exonic
900842752 1:5068177-5068199 ATCTTTCTCCTTCTTCCTCCAGG - Intergenic
901034364 1:6327387-6327409 CTCCTCCTCCTGCTCCTGCCGGG + Exonic
902377336 1:16036054-16036076 TTCCTGCTCCTGCCACTGCCGGG + Intergenic
902993146 1:20203704-20203726 TTCCTCTTCTTTCTACTGCCTGG - Intergenic
903549916 1:24150686-24150708 CTCCTCCTCCTCCTACTGCTGGG - Intergenic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
907853468 1:58278931-58278953 ATCCTTCTCCTTCTCCAGGAGGG - Intronic
908829901 1:68168479-68168501 TTCCTTCTCCATCTAGTCCCAGG + Intronic
910590959 1:88927667-88927689 ATTCTCCTCCTCCTACTGCTTGG - Intergenic
912410501 1:109477835-109477857 CTCCTTCACCTTCTTCTGGCTGG + Exonic
915826045 1:159078056-159078078 CTCCTTCACTTTCTACTGCAAGG + Intronic
916424708 1:164669512-164669534 CTTCTTTTCCTTCTACTTCCAGG + Intronic
917936975 1:179877905-179877927 ATCCTTCACCCTCTACTGCCAGG + Intergenic
918966641 1:191358592-191358614 AACATTTTCCTTCTACAGCCTGG + Intergenic
920542543 1:206790404-206790426 TTCCTTCCCCGTCTACTGCAGGG + Intergenic
921166618 1:212512598-212512620 ATCCTTCCCCATCTGCTCCCAGG - Intergenic
922002203 1:221490942-221490964 CTCTTTCTCCTTCTACTGGATGG - Intergenic
922319112 1:224469841-224469863 ATCATTTTCCTTCTACTTTCAGG + Intronic
923271185 1:232356535-232356557 AACCTTCTAATTCTAATGCCAGG - Intergenic
923783002 1:237042427-237042449 TGCCTTCTGCTTCTGCTGCCGGG - Exonic
1063264853 10:4436311-4436333 CTCTTTCTCCACCTACTGCCTGG - Intergenic
1066583059 10:36901495-36901517 CACCTTCTCCTTCTGGTGCCAGG - Intergenic
1066695020 10:38069606-38069628 TACTTTCTCCTTCTACTCCCGGG - Intergenic
1066997491 10:42577573-42577595 TACTTTCTCCTTCTACTCCCGGG + Intronic
1067749246 10:48959176-48959198 AGCCTCCTCATTCTACTGTCAGG + Intronic
1070606231 10:77900369-77900391 ACGCTTCTGCTTCTCCTGCCTGG + Intronic
1070608239 10:77914650-77914672 ATCCATGTCCTTCTCCTCCCAGG + Intronic
1072195726 10:93116016-93116038 CTCCTCCTCCTCCTCCTGCCTGG - Intergenic
1072196400 10:93120314-93120336 GCCCTTGTCCTTCTACAGCCAGG - Intergenic
1076997626 11:306452-306474 GTCCTCCTCCTTCTGCTGGCTGG - Intergenic
1077218791 11:1406115-1406137 AGCCTTCCCCTCCTCCTGCCTGG + Intronic
1077899441 11:6477405-6477427 ACCCTTCTCCTTTGACTCCCTGG - Intronic
1078134177 11:8638576-8638598 ATCCTCCTCCTCCAAGTGCCTGG + Intronic
1078172049 11:8935683-8935705 TTCCTTCTCCTTTAACTCCCAGG - Intergenic
1081481299 11:43491998-43492020 ACCATTCTCCTTCTTCTCCCAGG + Exonic
1081957454 11:47105879-47105901 AGCCTTCTGATTCTACTTCCAGG - Intronic
1082790091 11:57341180-57341202 CTCCTACTCCTTCCACTTCCAGG - Intronic
1082875006 11:57978970-57978992 ATTCTTCTTTTTCTGCTGCCTGG - Intergenic
1088487530 11:110355184-110355206 AGGCTTTTCCTTCTCCTGCCAGG - Intergenic
1089900063 11:121972636-121972658 ATTCTGCTCCTTCCACTGTCTGG - Intergenic
1090817767 11:130314410-130314432 CTCCTCCTCCTTCTCCCGCCAGG + Exonic
1091325792 11:134686496-134686518 ATCCCTCTCTTTCTCCAGCCAGG + Intergenic
1091346253 11:134856368-134856390 ATTCTTCTCCTCCTCCTCCCAGG - Intergenic
1094503070 12:31037431-31037453 CACCTTCTCCTGCTCCTGCCAGG + Intergenic
1095243386 12:39887918-39887940 ATCCTTTTCCTTCTAATTTCAGG + Intronic
1096254300 12:50053523-50053545 ATATTTCTCCTTCTGCTGGCAGG - Intergenic
1096430525 12:51539248-51539270 AACCTCCACCTTCTCCTGCCTGG + Intergenic
1098355941 12:69612637-69612659 CTCCTTCCCCATCTACTGGCTGG + Intergenic
1103793822 12:123490042-123490064 CCCTTTCTCCTTCTCCTGCCTGG + Intronic
1103878816 12:124150197-124150219 ATCATTTTACTTCTAGTGCCTGG - Intronic
1104067406 12:125317104-125317126 ATCCTTCTCCATCATCAGCCTGG + Intronic
1105298988 13:19116724-19116746 CTCCTTCTCCTCCTCCAGCCTGG + Intergenic
1105679865 13:22714934-22714956 ATCCTTCCCTTTTTAATGCCTGG + Intergenic
1106304677 13:28498822-28498844 ATTCTCCTCCTGCTACTCCCAGG + Intergenic
1107838186 13:44429077-44429099 CTCCTTCTCCTTCCACTGATGGG - Intergenic
1108041650 13:46344936-46344958 ATCCTTTTCCTTCTAGAGGCTGG - Intronic
1109352506 13:61202718-61202740 ATACTTTTCCTTCAAATGCCAGG - Intergenic
1110390058 13:74963043-74963065 GTCCTTCTACTTCTATTGCTTGG - Intergenic
1110905792 13:80887705-80887727 ATCATTTTCCTTCTACTTCGAGG - Intergenic
1114295325 14:21324138-21324160 ATGCTTCTCCTTCTCTAGCCAGG - Intronic
1114488550 14:23080429-23080451 TTCCTTCTCCTGCTGCTGTCTGG + Exonic
1116758450 14:48979092-48979114 ATTTTTCTCTTTCTTCTGCCTGG + Intergenic
1117337853 14:54770043-54770065 ATGTTTCTCCCTCTAATGCCAGG + Intronic
1118038596 14:61893943-61893965 AGCCTTCTCCTTAGACTGCCAGG - Intergenic
1118326406 14:64784465-64784487 GGCCTTCTCCTTCTGCAGCCAGG - Intronic
1120871284 14:89339523-89339545 ATCCTGCTCCTTCCAATGCTGGG + Intronic
1121339464 14:93096621-93096643 CTCCTTCTCCTTGTGCTGCTGGG - Intronic
1121971997 14:98366933-98366955 ATCCTCCTGCTTCAGCTGCCTGG + Intergenic
1121988239 14:98529008-98529030 TTCCTTCTCCTTCTCCTTCATGG - Intergenic
1122483565 14:102063530-102063552 ATCTTTGTCCTCTTACTGCCTGG - Intergenic
1122969768 14:105147802-105147824 CTCCTTCTCCTGCATCTGCCGGG - Exonic
1123003843 14:105311985-105312007 CCCCTACTCCTTCTCCTGCCAGG - Exonic
1123866694 15:24526645-24526667 ATCCTCCACCTGCTCCTGCCTGG - Intergenic
1124013842 15:25860438-25860460 CTCCTCCTCCTTCTATTCCCAGG + Intronic
1124120268 15:26882924-26882946 CTCCTCCTCCTTCTGCTCCCTGG - Intronic
1124570337 15:30857042-30857064 CTCCTTCTCCTTCTTCTTCTAGG + Intergenic
1124637332 15:31373566-31373588 CTGCTTCTCCTTGTCCTGCCTGG + Exonic
1124990584 15:34669540-34669562 CTCCTTCTCCTTCTTCAGACAGG - Intergenic
1128362702 15:66973727-66973749 ATTCTCCTCCTTCCACTGCTTGG + Intergenic
1130867468 15:87945003-87945025 ATCAATCTCCTTTTACTGCCTGG + Intronic
1130964968 15:88690299-88690321 ATCCTTCTCCTACCTGTGCCTGG + Intergenic
1132147165 15:99435896-99435918 TCCGTTCTCCTTCTACTTCCTGG + Intergenic
1132418017 15:101638216-101638238 ATCTTTCTCCTGTTACTGCTGGG - Intronic
1132647947 16:1007707-1007729 ATCCTTCTCCCACTCCTGCTCGG + Intergenic
1134212468 16:12289246-12289268 ACCCTTCTCCTCCTGCTGCATGG - Intronic
1135484035 16:22848073-22848095 GTCCTTTTCCTTCAACTGGCTGG + Intronic
1137053293 16:35731069-35731091 GTCTTTATCCTTCGACTGCCTGG + Intergenic
1137728843 16:50675131-50675153 ATCCTTCTCCTTCACTTACCTGG - Intronic
1138302369 16:55943273-55943295 ATCCTGATCTTCCTACTGCCTGG - Intronic
1140959327 16:79897079-79897101 TTCCTTCTCCTTTGCCTGCCTGG - Intergenic
1141171466 16:81694328-81694350 ATCCTTCCCCCTGTTCTGCCGGG - Intronic
1141326253 16:83062166-83062188 ATCTTTCTCATTTTACTGTCTGG + Intronic
1141935560 16:87235929-87235951 CTCTTTCTCCTTCACCTGCCTGG - Intronic
1142862250 17:2769775-2769797 AAGCTTTTCCATCTACTGCCAGG + Intergenic
1143730533 17:8880387-8880409 ATCCTTCTCCTTCTACTGCCAGG + Exonic
1143989938 17:10949281-10949303 TTCCTTCTGCTTCTACTTCCTGG + Intergenic
1144078442 17:11740057-11740079 GGCCTTCTCCTTCTTCAGCCAGG + Intronic
1144465315 17:15492644-15492666 ATCCTGCTCCTTCTGCGGCAGGG + Intronic
1145083031 17:19911496-19911518 TTCATTCTCATTCTACTGACAGG + Intronic
1145193284 17:20866671-20866693 CTCCTTCTCCTCCTTCAGCCTGG + Exonic
1145276627 17:21435265-21435287 CAGCTTCTCCTTCCACTGCCAGG - Intergenic
1145298733 17:21614413-21614435 CTCCTTCTCCTCCTTCAGCCTGG - Intergenic
1145314468 17:21721153-21721175 CAGCTTCTCCTTCCACTGCCAGG - Intergenic
1145351546 17:22088877-22088899 CTCCTTCTCCTCCTTCAGCCTGG + Intergenic
1145403706 17:22568681-22568703 CTCCTTCTCCTCCTGCAGCCTGG + Intergenic
1145712923 17:26993130-26993152 CAGCTTCTCCTTCCACTGCCAGG - Intergenic
1145723220 17:27091149-27091171 CTCCTTCTCCTCCTTCAGCCTGG - Intergenic
1146013585 17:29214864-29214886 TTCCTAGTCCATCTACTGCCTGG + Intergenic
1147155466 17:38542530-38542552 ATCTTTTTCCTGCCACTGCCAGG - Intronic
1148341611 17:46876625-46876647 GGCCTTCTCCTGCCACTGCCAGG + Exonic
1148891919 17:50814138-50814160 TTCCTTCTCCTCCTCCTCCCAGG - Intergenic
1150433446 17:65137194-65137216 CTCCTCCTCCTTCTCCTCCCGGG + Intergenic
1150769045 17:68025879-68025901 ATCATCCTCCTTCCCCTGCCAGG + Intergenic
1151241107 17:72758604-72758626 ATCCTTTTCCTTTTCTTGCCTGG + Intronic
1155327123 18:24675680-24675702 ATGCTTCACCTTCTACTTCTGGG + Intergenic
1155587040 18:27378325-27378347 ATTCTTCTCCTCCTACTCACTGG + Intergenic
1157070991 18:44408367-44408389 TTCCTTCTTGTTCTTCTGCCTGG - Intergenic
1157312122 18:46560381-46560403 GTCCTTCTCCTTCTTCTTCCGGG + Intronic
1157678295 18:49583783-49583805 CTCCTGCTCCTTCTTCTGCCTGG + Intronic
1158398132 18:57095626-57095648 CTCCTTCTCCTTCTTCTTCATGG - Intergenic
1159467591 18:68804563-68804585 ATGGTTCTCCTCCTACTCCCTGG - Intronic
1159885241 18:73897357-73897379 ATCCTCCTGCTTCAACTTCCAGG - Intergenic
1161272643 19:3398543-3398565 AACCATCACCTTCTTCTGCCTGG + Intronic
1165148474 19:33747633-33747655 AGCCCTCTCCTGCTCCTGCCGGG - Intronic
1165787990 19:38473720-38473742 ATCCTTCTCATTCTCCGCCCTGG - Exonic
1165861208 19:38910575-38910597 AGCCTCCTCCTTCTCCTGCCTGG + Exonic
1166309904 19:41957051-41957073 CTCCTTCCCCTTCTTCTGGCTGG - Exonic
925364462 2:3302520-3302542 CTGCTTCTCCTTCTGCTGCTGGG + Intronic
926864394 2:17342023-17342045 ATTCTCCTCCTCCCACTGCCTGG - Intergenic
928223261 2:29423057-29423079 TTCTTTCTCCTTCTTCTGGCAGG - Intronic
930497872 2:52172135-52172157 AGCCTTGTCCTTCACCTGCCTGG - Intergenic
930768412 2:55108392-55108414 ACCCTTCTCCCTCTCCTGCCTGG - Intronic
932096880 2:68858053-68858075 ATCCTACTTCTGCTTCTGCCTGG + Intergenic
932329896 2:70892236-70892258 CTCCCTCTCCTCCTCCTGCCAGG - Intergenic
933143375 2:78821359-78821381 GTCCTACAGCTTCTACTGCCTGG - Intergenic
935549699 2:104439587-104439609 TTTCTTCTCCTTCCACAGCCTGG + Intergenic
937261605 2:120590173-120590195 GTCCTTCTCATCCTGCTGCCTGG + Intergenic
941676939 2:168353809-168353831 ATTCTTCTGATTCTACAGCCAGG + Intergenic
942296641 2:174523902-174523924 CTCCTTCCTCTCCTACTGCCAGG + Intergenic
944834045 2:203561010-203561032 TTCCTTCTCCTTCATCTGACTGG + Intergenic
945591214 2:211733936-211733958 ATGATTCTCCTTCCTCTGCCTGG - Intronic
945612166 2:212017387-212017409 AACCTTTTCATTCTACTGTCTGG - Intronic
945810369 2:214542469-214542491 AAGCTTCTCCTGCTGCTGCCTGG + Intronic
946270414 2:218587970-218587992 ATCCTGCTCCTTCTATAACCGGG + Intronic
947994172 2:234512916-234512938 AGCCTTCTGCTTTTACTTCCAGG + Intergenic
948223406 2:236290849-236290871 ACCCTTCCCCTGCTTCTGCCGGG - Intergenic
948668633 2:239552249-239552271 ATCCTTCTCCCTCCACCCCCAGG - Intergenic
948795876 2:240401874-240401896 CTTCTTCTCCTTCTTCTCCCAGG - Intergenic
1170504385 20:17009924-17009946 CTCCATCTCCTTCTGCTGTCTGG + Intergenic
1171561849 20:26134162-26134184 CTCCTTCTCCTCCTTCAGCCTGG + Intergenic
1173470443 20:43319551-43319573 ATTTTTCTCCTCCTACTGACAGG + Intergenic
1175542008 20:59753915-59753937 TGCCTCCTCCTTCCACTGCCAGG + Intronic
1175571101 20:60023073-60023095 TTCCCTCTTCTTCTACTGGCTGG + Intronic
1178501739 21:33131314-33131336 ATCCTCCTACTCCTACTCCCTGG + Intergenic
1178596714 21:33960961-33960983 ATCTTTTTCCTTCTAGTCCCTGG + Intergenic
1179385495 21:40938166-40938188 CTCCTTCTCCCTCTACCCCCTGG + Intergenic
1180105919 21:45617962-45617984 CTCCTTGTCCTTCTCCTCCCAGG - Intergenic
1180843428 22:18969754-18969776 TTCCTTCTCCGTCTTCTGCTCGG - Intergenic
1181169275 22:20999173-20999195 ATCCTTTTCCTTCAACTCCCAGG - Intronic
1183085663 22:35485389-35485411 ATTCTCTTCCTTCTGCTGCCTGG - Intergenic
1184404224 22:44291157-44291179 TGCCTTCTCCTTCTACAGCAGGG + Intronic
1185271473 22:49931241-49931263 ATTCTTCTCCATCTCCTGTCTGG - Intergenic
949671963 3:6409027-6409049 CTGCATTTCCTTCTACTGCCTGG - Intergenic
950567687 3:13780785-13780807 ATCCCTGTCCATCTGCTGCCCGG + Intergenic
950579265 3:13852109-13852131 TTTATTCTCCTTCGACTGCCAGG + Intronic
950665938 3:14494989-14495011 CTCCTCCTCCTTCTGCTTCCAGG - Exonic
951425687 3:22542601-22542623 ATCCTTCTGATTCTTCTCCCTGG + Intergenic
952586741 3:34902181-34902203 ATCCTGCTGACTCTACTGCCTGG - Intergenic
952922300 3:38294076-38294098 ATTCTCCTCCTCCTACTGCTTGG + Intronic
954447924 3:50556693-50556715 CTCCATCTCATTCCACTGCCTGG + Intergenic
955427366 3:58806394-58806416 CACCTTCTCCTTCTAATCCCCGG - Exonic
955915197 3:63900717-63900739 ATTCTTCTCCTTTTCCTCCCAGG - Intronic
958121997 3:89302997-89303019 ATCCTTCTACTTCAGCTTCCCGG + Intronic
959016174 3:101136328-101136350 TTCCTTCTCTTTCTGCTTCCTGG - Intergenic
959292789 3:104495682-104495704 ATCCTTTTCCTTCTGCTCCCTGG + Intergenic
959533869 3:107464312-107464334 ATCCTCATCCCTCTATTGCCTGG + Intergenic
962265839 3:133943784-133943806 TTCCTTGTCCTTCCTCTGCCTGG + Intronic
962752562 3:138444633-138444655 TTCCTTCTCTTCCTCCTGCCTGG + Intronic
963048621 3:141123663-141123685 ACCCTTCTGCTTCCCCTGCCTGG + Intronic
963610381 3:147459665-147459687 ATCTTTCTCTTTCTCCTGCCAGG + Intronic
964110450 3:153082174-153082196 ATCGTTCTCCTACAAGTGCCTGG - Intergenic
966954736 3:184864115-184864137 CTCCTTCTCCTTCCTCTTCCTGG - Intronic
967222165 3:187256568-187256590 AACCTTCACCTTCTTCTCCCAGG - Intronic
968015601 3:195329635-195329657 GTCATTCCGCTTCTACTGCCTGG + Intronic
969327107 4:6450466-6450488 TTCCTTCTCCTTCCAGTGCTTGG - Intronic
969338233 4:6524380-6524402 TTCCTCCTCCTTCTAGTCCCTGG - Intronic
970235743 4:13956470-13956492 ATCCTTCTGCTCCCACTTCCTGG - Intergenic
970959555 4:21856713-21856735 AGCCCTCCCCTTCCACTGCCTGG + Intronic
971509977 4:27412774-27412796 ATCCTTATCATTCTAGGGCCAGG + Intergenic
973019950 4:45190567-45190589 ATCCTAGTTCTTCTACTGCCTGG - Intergenic
975658190 4:76662430-76662452 TGCCTTCCTCTTCTACTGCCAGG + Intronic
977666995 4:99653682-99653704 CTCCTTCTCCTCCCACGGCCTGG + Exonic
980596933 4:134966677-134966699 TTCCTTCTCCTTCCTCAGCCAGG - Intergenic
983443602 4:167820044-167820066 ATCCTTATCCTTTTACAGACAGG - Intergenic
984878330 4:184389095-184389117 TTCCTTCTCCTTCTATTGGATGG + Intronic
988056281 5:26101507-26101529 ATCTTTCTTCTTCAAATGCCAGG - Intergenic
988487198 5:31676968-31676990 ATCCTATTCCTTCCCCTGCCAGG + Intronic
990057351 5:51599854-51599876 GTCCTTCTGCTTCTTCTGGCTGG + Intergenic
990325407 5:54670672-54670694 CTCCCTCTCCTTCTTCTGCCCGG + Intergenic
990366214 5:55073045-55073067 ATGCTTCTCCTTCTAATTCCTGG + Intergenic
992175736 5:74147088-74147110 AGCCTCCCCCTTCTCCTGCCTGG + Intergenic
994926430 5:106122070-106122092 ATCCTTCTCCTTCTCAGGCCAGG - Intergenic
995143790 5:108763602-108763624 AGCCTTCTCCTTCCCCTCCCTGG - Intronic
997469093 5:134106865-134106887 ATCTTTCTCCTTCCAGTTCCTGG + Intergenic
997779403 5:136641601-136641623 TTCCTTCTTCTTCTGTTGCCAGG - Intergenic
998369349 5:141651037-141651059 ATCCGCCTCCCTCTGCTGCCAGG + Exonic
998451161 5:142235656-142235678 ATCCTTCTTCCCCTCCTGCCTGG + Intergenic
999324986 5:150638362-150638384 TTCCTTCTCCTCCCACTCCCAGG + Intronic
999828614 5:155298155-155298177 TTCCTCCTCGTTCTACTACCTGG + Intergenic
1000060782 5:157653110-157653132 ATCATTCTCTTTCTACTGCAGGG + Intronic
1000065788 5:157691939-157691961 ATCATTCTCTTTCTACTGAAGGG + Intergenic
1000702780 5:164473851-164473873 CTCTTTTTCCTTCTACTGTCTGG + Intergenic
1001970863 5:175953957-175953979 AGCCTTCTCCCTCCACTCCCAGG + Intronic
1002246575 5:177889807-177889829 AGCCTTCTCCCTCCACTCCCAGG - Intergenic
1002382565 5:178840852-178840874 TTCCTTCATCTTCCACTGCCAGG - Intergenic
1005393843 6:25361338-25361360 ATCTTTCTCCTTCTACTTCTAGG + Intronic
1005405940 6:25488133-25488155 ATCCTTCTCTTAATCCTGCCAGG - Intronic
1005434067 6:25788761-25788783 ATCCTTCTCATTCTTTTCCCAGG - Intronic
1005944584 6:30586035-30586057 CTCCTTCTTCCTCCACTGCCAGG - Intronic
1006168366 6:32079178-32079200 ATCCCTGTCCTTGTACTGCACGG + Intronic
1007794819 6:44339032-44339054 ATCTTTCTCCCTCTGCTGTCTGG + Intronic
1008199627 6:48570265-48570287 ATCCTTCTCCTTATATTGTAAGG + Intergenic
1010214779 6:73392059-73392081 ATCCCTCTGCTTCTACTTTCTGG + Intronic
1011670173 6:89675579-89675601 ATGTTTTTCCTTCTTCTGCCAGG - Exonic
1013052161 6:106546898-106546920 ATCCTTTTGCTTCCTCTGCCAGG - Intronic
1013574492 6:111468050-111468072 ATCCTACTCCTTGGACTGCCCGG + Intronic
1014677139 6:124380491-124380513 ATCTGTCTCCTTCAACTGGCTGG + Intronic
1015200525 6:130574900-130574922 ACCCTTCTCCTTCTTCTGCCTGG + Intergenic
1016460907 6:144279427-144279449 CTCCTGCTCCTACTACTGGCTGG - Intergenic
1017346910 6:153394129-153394151 ATCCTTCTACTTTTACATCCAGG - Intergenic
1018317161 6:162568561-162568583 CTCCTTCTCCTGCTCCTGCACGG - Intronic
1019109036 6:169694994-169695016 ACCCTTCTCCCTCTGCTGGCCGG - Intronic
1020350536 7:7214211-7214233 ATCCATCTCCTTTTAATTCCTGG + Intronic
1022314483 7:29232392-29232414 ATCCTTTTACGTCTACAGCCAGG + Intronic
1022496946 7:30859331-30859353 ATCTTTCTCCCTCAACTCCCTGG + Intronic
1026353076 7:69534461-69534483 ATCCTGCTCCTTCTAGGACCTGG - Intergenic
1026591257 7:71697590-71697612 ATCCTTCTCCTCCCACTAGCAGG + Intronic
1026678978 7:72451075-72451097 CCCCTCCTCCTTCTTCTGCCTGG - Intergenic
1029504052 7:100951462-100951484 CTCCTCCCCCTGCTACTGCCTGG - Intronic
1029559054 7:101290349-101290371 CACCTGCTCCTTCTATTGCCAGG - Intergenic
1032336826 7:131032888-131032910 CTCCTTTTTCTTCTACTGCCAGG - Intergenic
1032995446 7:137441065-137441087 GTGCTTCCTCTTCTACTGCCTGG + Intronic
1034273521 7:149814456-149814478 ACCATTCTCCTTGTAGTGCCCGG + Intergenic
1035098928 7:156380769-156380791 ATCCTTAGCCTTCTGCTGCACGG - Intergenic
1035201653 7:157271499-157271521 ATGCGTCTCCTTGAACTGCCAGG + Intergenic
1035278680 7:157763769-157763791 AGCCTCCTCCTACCACTGCCGGG - Intronic
1035566561 8:644983-645005 ATCCTTCTCCTCCCACGGGCTGG + Intronic
1036463517 8:8974797-8974819 CTCCTTCTCCTTCTTCTGACAGG + Intergenic
1037280582 8:17237373-17237395 GTCTTTCTCTTTCTTCTGCCAGG - Exonic
1037676079 8:21051803-21051825 ATCCTTTTCTTTCTACAGCTGGG - Intergenic
1040695766 8:49995974-49995996 TTCCTTCTAGTTCTACTCCCTGG - Intronic
1043245478 8:77994480-77994502 ATCTTTTCCCTTCTACTTCCTGG + Intergenic
1044324413 8:90843389-90843411 ATCCTTCTCTTTCTTTTGCTAGG - Intronic
1044362508 8:91304723-91304745 ATCCATCTACTTCTAGGGCCAGG + Intronic
1045478932 8:102577216-102577238 ATCCCTCTCCTCCAACTGCAGGG - Intergenic
1045815395 8:106271237-106271259 CTCCTCCTCCGTCTACTACCCGG + Intronic
1046595625 8:116258154-116258176 TACCTTCTCCTTCTAAGGCCTGG - Intergenic
1048485489 8:134844003-134844025 CTCCTTCCCCTTCTGCTGCGTGG + Intergenic
1049443135 8:142618233-142618255 ATCTGTCACCATCTACTGCCCGG + Intergenic
1050384045 9:5065403-5065425 GTCCATCTCCTTCTACTGAAAGG + Intronic
1056273658 9:84971607-84971629 GTCCTTCTGCTTCTACAGCTGGG - Intronic
1056587366 9:87937609-87937631 CTCCTTCTCCTCCTTCAGCCTGG + Intergenic
1056609511 9:88115334-88115356 CTCCTTCTCCTCCTTCAGCCTGG - Intergenic
1057475735 9:95399546-95399568 GTCCTTTGCCTTCCACTGCCAGG - Intergenic
1057726633 9:97572750-97572772 TTCTTTCTCCTTATACGGCCAGG + Intronic
1058265720 9:102897291-102897313 GTCCTGCTCCTTGTACTTCCTGG - Intergenic
1060649613 9:125314054-125314076 ATCTCTCTTCTGCTACTGCCTGG - Intronic
1061803900 9:133127715-133127737 TTCCTCCTCCTTCTGCCGCCAGG + Intronic
1062102325 9:134734706-134734728 ATCCTTATCCTTGTGCTTCCAGG + Intronic
1062377894 9:136272173-136272195 ATCCTTTTCCTTCTGCTGGAAGG - Intergenic
1186448717 X:9654402-9654424 CTTCTTCTTCTTCTACAGCCTGG - Intronic
1190061970 X:47217567-47217589 ATCCTTCACTTCCTTCTGCCTGG - Intergenic
1192180906 X:68914924-68914946 AGCCTACTCATTCTACTTCCTGG - Intergenic
1193113414 X:77753000-77753022 ATCCTTCTTTTTCTATTGCTTGG + Intronic
1195687793 X:107601716-107601738 ATCTGTCTCCTTCTTCTGGCGGG - Exonic
1196069957 X:111509511-111509533 ATCGCTCCCCTTCTACTGCAGGG + Intergenic
1199449736 X:147966031-147966053 CTGCTTCTCCTTCTACTTCCAGG - Intergenic