ID: 1143732879

View in Genome Browser
Species Human (GRCh38)
Location 17:8890894-8890916
Sequence GTTCAGCAGCAGCACGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143732876_1143732879 -7 Left 1143732876 17:8890878-8890900 CCTGCACTTCCACTGGGTTCAGC 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG 0: 1
1: 0
2: 1
3: 31
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143732879 Original CRISPR GTTCAGCAGCAGCACGGTGC TGG Exonic
900393165 1:2442649-2442671 GTGCAGAAGCAGCATGGTGTGGG + Intronic
901662575 1:10807863-10807885 GATCTGCAGCAGCATGGAGCTGG - Intergenic
901689229 1:10961606-10961628 CCTCAGCAGCAGCACAGGGCTGG + Intronic
902184070 1:14711988-14712010 GTACAGAAGGAGCATGGTGCAGG + Intronic
903059679 1:20661246-20661268 GTCCAGCAGCACTAAGGTGCGGG + Exonic
903867821 1:26411457-26411479 CCTCAGCTGCTGCACGGTGCGGG + Exonic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
906126211 1:43428421-43428443 CTTCAGCAGCAGCATGGAGGAGG + Exonic
906318487 1:44802874-44802896 GTTCAGCAGCAGACAGGTGGTGG + Intronic
909348488 1:74620775-74620797 GTTTATCAGCAGCACTGTGGTGG - Exonic
912414255 1:109497485-109497507 TTTCAGCTGCAGCAAGGAGCGGG - Intronic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
917476409 1:175373071-175373093 GCACAGAAGCAGCATGGTGCTGG + Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922504912 1:226120861-226120883 GTTCAGCTGGAGCATGCTGCCGG - Intergenic
922725460 1:227920958-227920980 GTACAGCTGGAGCAGGGTGCCGG - Exonic
922756407 1:228099513-228099535 GTTCAGCAGCAGGCCGATGGAGG - Intergenic
1067526746 10:47043759-47043781 GTCCAGCAGCAGCAGCTTGCAGG - Intergenic
1067567655 10:47350211-47350233 GTCCAGCAGCGGCACCGTGCGGG - Exonic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074702482 10:116104585-116104607 GTTCAGCAAAAGCAGGCTGCAGG + Intronic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1075225320 10:120623949-120623971 ATCCAGCAGCAGCACGCAGCTGG - Intergenic
1076362663 10:129900464-129900486 GGTCAGCACCAGCAAGGTCCTGG + Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1079263617 11:18908700-18908722 ATTCAGCATCAGCAGAGTGCTGG + Intergenic
1079268007 11:18954341-18954363 ATTCAGCATCAGCAGAGTGCTGG + Intergenic
1083328302 11:61884916-61884938 GTTGAGCAGCTGCTCTGTGCCGG - Intronic
1084481259 11:69421566-69421588 ATTCAGCAGCCTCAAGGTGCTGG - Intergenic
1086874816 11:92082924-92082946 GTTCAGCAGCAGCAGGAAACTGG + Intergenic
1086988572 11:93277519-93277541 GTTGAGCAGGAGAATGGTGCTGG - Intergenic
1089134298 11:116237028-116237050 GTTGATGGGCAGCACGGTGCAGG + Intergenic
1092832815 12:12461691-12461713 TTTCAGCAGCAGCAGAGTGGAGG + Intronic
1094482667 12:30897131-30897153 GTTTGGCAGCATCAAGGTGCAGG - Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1095990724 12:48032746-48032768 GTTGAGCAGGAGCAGGGAGCAGG + Intergenic
1099316861 12:81094923-81094945 GAGCAGCAGCAGCACGATGCAGG - Intronic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1103321956 12:120097349-120097371 GTTCAACTGCATCACGGAGCTGG - Exonic
1103566833 12:121820288-121820310 GTGCAGCAGCATCACGATGCCGG - Intronic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1105024158 12:132837679-132837701 GACCAGCAGCAGGACGGAGCCGG - Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1112752384 13:102596531-102596553 GGTCAGCAGCACCCCGGGGCTGG + Intergenic
1113362749 13:109645938-109645960 GTTCAGCAGGAGCACTGAGCAGG + Intergenic
1113801238 13:113087470-113087492 GGTCTGCAGCAGCACGCTCCTGG + Intronic
1113834469 13:113319607-113319629 GTTCAGCTGCAGCCCCATGCTGG - Exonic
1113942509 13:114025620-114025642 GCTGATCACCAGCACGGTGCTGG + Intronic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1118135843 14:63025980-63026002 GTACAAAAGCAGCACGGTACTGG + Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1121525934 14:94619330-94619352 CTTCAGCTCCACCACGGTGCAGG - Exonic
1121526062 14:94620376-94620398 CTTCAGCTCCACCACGGTGCAGG + Intronic
1121802880 14:96789666-96789688 GTTTAGCTACAGCACGGTGGTGG + Intergenic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1129954015 15:79617126-79617148 GTTCAGCAGCTCCAGGATGCAGG + Intergenic
1131999574 15:98165191-98165213 GTTGCGCAGCAGCAAGGTGGGGG - Intergenic
1134672818 16:16068281-16068303 GGTCATCAGCAGCATCGTGCAGG + Exonic
1135300138 16:21319674-21319696 TTTCAGCAGCAGCACCAGGCTGG - Intergenic
1136547756 16:30965211-30965233 CTTCAGCAGCATCTCGATGCGGG - Exonic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139170963 16:64628521-64628543 AGTCAGCACCAGCACAGTGCAGG + Intergenic
1139640271 16:68286654-68286676 GTTTAGCAGGAGCAAAGTGCCGG + Intronic
1141783482 16:86181599-86181621 GTTCAGCAACAGCAGGCTGAGGG - Intergenic
1142231626 16:88902824-88902846 TGTCAGCAGGAGCAGGGTGCGGG - Intronic
1142231637 16:88902871-88902893 TGTCAGCAGGAGCAGGGTGCGGG - Intronic
1142558747 17:797323-797345 GTTCAGGAGTAGCACTGAGCAGG - Intergenic
1143323106 17:6080744-6080766 CTGCAGCAGCAGCAGGCTGCCGG - Exonic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1144195698 17:12892759-12892781 GTTCAACAGCAGAACAGAGCGGG - Intronic
1144546816 17:16204837-16204859 GTCCCACAGCAGCATGGTGCTGG + Intronic
1150289441 17:63973024-63973046 GTGCAGCAGCAGCACCTTGCAGG - Intergenic
1151091060 17:71440643-71440665 TTTCACCAGCTCCACGGTGCCGG + Intergenic
1152126516 17:78450504-78450526 TCTCAGCAGCAGCTGGGTGCAGG + Intronic
1152850065 17:82628426-82628448 GTTCTTCAAAAGCACGGTGCTGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156613248 18:38752164-38752186 CAGCAGCGGCAGCACGGTGCTGG - Intergenic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1160824825 19:1074667-1074689 GTTCGGCCACAGCATGGTGCAGG + Exonic
1162395861 19:10417805-10417827 GATCAGCAGCGGCAGGGTGGTGG - Intronic
1163368642 19:16889792-16889814 GTTCATCAGCAGCATGGTGGAGG - Exonic
1163553884 19:17982055-17982077 GAAGACCAGCAGCACGGTGCCGG - Exonic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1167867563 19:52340555-52340577 GATCAGCAGCAGCCAGGAGCAGG - Intronic
925423287 2:3728838-3728860 GTTCTGCAGCAGCCAGATGCTGG + Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
927317002 2:21695526-21695548 GTTCACAATCTGCACGGTGCTGG - Intergenic
929588992 2:43133166-43133188 GCTCAGCAGGTGCAGGGTGCGGG + Intergenic
931213464 2:60219676-60219698 GGTCAGAAGCAGCACGATGTTGG + Intergenic
932314322 2:70769264-70769286 GTTCCACAGCAGCACTGTGGTGG - Intergenic
932646865 2:73511460-73511482 GGTGAGCAGCAGCAGGGTGGGGG - Intronic
934857339 2:97737574-97737596 GTTAACCAGCAGGACGTTGCGGG - Exonic
934989181 2:98909610-98909632 GGTCAGCAGCAGAAATGTGCTGG - Intronic
935406884 2:102718741-102718763 GTAGAGCAGCAGCAGTGTGCAGG + Exonic
935848111 2:107188177-107188199 CATCAGCAGCAGCAGGGTGCTGG - Intergenic
936057570 2:109272367-109272389 GTGCAGAAGCAGGACTGTGCAGG + Intronic
938043067 2:128091740-128091762 GTTGAGAAGCAGCACTTTGCAGG + Intronic
938764073 2:134448864-134448886 CTTCCCCAGCAGCATGGTGCAGG - Exonic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939310104 2:140465064-140465086 GTTTACAAGCAGCATGGTGCTGG + Intronic
942649598 2:178153152-178153174 GTTCAGCAGCATAAGGGTGATGG - Intergenic
943081170 2:183260744-183260766 GCTCAGCTGCTGCACGGTGAGGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
947702564 2:232246663-232246685 ACTCAGCAGCAGCATGGTGCAGG - Intronic
947723271 2:232381755-232381777 CTCCAGCAGCAGCAGGGTCCCGG - Exonic
947738926 2:232476093-232476115 ATTCAGCAGCAGGACAGGGCAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1169220641 20:3820436-3820458 GTGCTGCAGCAGCCAGGTGCTGG - Intergenic
1170802621 20:19602935-19602957 GCTCAGCTGAACCACGGTGCGGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1173743867 20:45421488-45421510 GTCCAGCAGCAGCACCGGGAAGG - Exonic
1174308617 20:49632790-49632812 GTTCACCTGCAGCACGGGTCAGG + Intergenic
1174309935 20:49644373-49644395 GCTCAGCTGCAGCCAGGTGCAGG - Intronic
1176650238 21:9539335-9539357 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
1184464755 22:44662294-44662316 CTTCAGCAGCTGCAGGGGGCGGG + Intergenic
1184500352 22:44867874-44867896 GCTCAGTAGCAGCTCGGTGCTGG + Intergenic
1185070179 22:48651804-48651826 CTCCAGCAGCAGGTCGGTGCGGG + Intronic
1185141459 22:49104308-49104330 GTTCATCAGGATCACGGTTCTGG + Intergenic
1185219437 22:49622126-49622148 GTTCAGGAGCAGCTGGGGGCAGG - Intronic
949416830 3:3824039-3824061 TTTGAGAAGCAGCACGGTACAGG - Intronic
949753748 3:7384704-7384726 GTTCAACAGCCACACGGGGCTGG + Intronic
952425797 3:33173669-33173691 GTTCAGTAACATCATGGTGCTGG + Intronic
952505171 3:34000600-34000622 GCTCTGCAGCTGCAAGGTGCTGG + Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954165457 3:48753756-48753778 GATCAGCAGCAGCATGGCACTGG - Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
960635773 3:119782817-119782839 ACTCAGCCGCAGCACTGTGCAGG - Exonic
961370213 3:126424167-126424189 GTTCAGCAGCATAACGGGGACGG + Intronic
962266279 3:133946602-133946624 GTTTAGCATCAGCTCTGTGCTGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962688263 3:137868227-137868249 CAGCAGCAGCAGCATGGTGCAGG + Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
969233053 4:5845248-5845270 GCTCATCAGAAGCAAGGTGCTGG - Intronic
969353304 4:6610762-6610784 GCACAGCAGCAGCATGGGGCTGG - Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
969963640 4:10972242-10972264 CTTATGCATCAGCACGGTGCTGG - Intergenic
980989488 4:139726957-139726979 ATTCAGCAGCTGCAGGGAGCAGG - Intronic
981052758 4:140327191-140327213 GTTCATCAGCAACACTGTGATGG - Intronic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984742444 4:183178758-183178780 GTTCAGAAGCAGCAGGCTTCAGG + Intronic
985947852 5:3200676-3200698 GTTCAGCAGCAGCCCAGAGCCGG - Intergenic
985965485 5:3336196-3336218 GGGCAGCAGCTGCACGGAGCGGG + Intergenic
986719151 5:10547713-10547735 GGTCAGCAGCAGCATGGTGGGGG - Intergenic
988482293 5:31640181-31640203 ATTCAGCAGCAGGAGGGTCCAGG + Intronic
991745945 5:69741359-69741381 GTTCACCAGATGCACTGTGCTGG + Intergenic
991751759 5:69813882-69813904 GTTCACCAGATGCACTGTGCTGG - Intergenic
991797546 5:70321317-70321339 GTTCACCAGATGCACTGTGCTGG + Intergenic
991825323 5:70616673-70616695 GTTCACCAGATGCACTGTGCTGG + Intergenic
991831048 5:70688775-70688797 GTTCACCAGATGCACTGTGCTGG - Intergenic
991889888 5:71320638-71320660 GTTCACCAGATGCACTGTGCTGG + Intergenic
992558829 5:77929946-77929968 GTTGAGCAGCCGCCTGGTGCGGG - Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
999082389 5:148856607-148856629 GATCAGCTGCAGCAAGGAGCAGG + Intergenic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1002660828 5:180790312-180790334 GATCAGCAGGAGCACAGTCCGGG + Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1005556605 6:26991824-26991846 GTTCACCAGATGCACTGTGCTGG + Intergenic
1006275330 6:33000783-33000805 CTTCAGCAGCAACAGGCTGCAGG - Intergenic
1007111178 6:39314240-39314262 GAGCAGCAGGAGCACGGTGCTGG + Exonic
1007309770 6:40936068-40936090 CTTCAGCAGCTGCCCTGTGCAGG - Intergenic
1008148755 6:47924224-47924246 GGGCAGCAGCAGGACAGTGCTGG - Intronic
1012766901 6:103378215-103378237 TTTCAGCAGCAGCAGTGTCCAGG + Intergenic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017805571 6:157942634-157942656 GTCCAGCAGCAACGCGGGGCAGG + Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1018717240 6:166543068-166543090 CGTCAGCAGCAGAACAGTGCTGG - Intronic
1018915680 6:168131066-168131088 CCTCAGCAGCAGCACGGTGCTGG + Intergenic
1020275553 7:6622470-6622492 CTTCAGCCGCAGCACGGACCTGG + Exonic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023984934 7:45088856-45088878 GGGCAGCAGCAGCTCGGCGCGGG + Exonic
1024232038 7:47370042-47370064 GTTGAGCATCAGCTAGGTGCTGG + Intronic
1025276861 7:57589631-57589653 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1028639911 7:93030163-93030185 TATCAGCTGCAGCAGGGTGCTGG - Intergenic
1032143330 7:129354523-129354545 TTTCAGCAGCAGAACAGTCCAGG + Intronic
1032486686 7:132292964-132292986 GTTCTGCAGCAGGAAGGAGCTGG + Intronic
1033120728 7:138664764-138664786 GGTGAGCAGCAGCAGCGTGCGGG - Intronic
1034908151 7:154969475-154969497 GTGGTGCCGCAGCACGGTGCAGG - Intronic
1036533110 8:9615573-9615595 GTGCTGCAGCAGCACTGTGCAGG - Exonic
1037111011 8:15164455-15164477 CTCCAGCAGCAGCACGTGGCGGG - Intronic
1038751770 8:30302726-30302748 GTTCAGCAGCAGCATGGAGGAGG - Intergenic
1039733492 8:40305306-40305328 GTTCAGCAGCACCCAGGCGCAGG + Intergenic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1049031671 8:140042732-140042754 ACTCAGGAGCAGCCCGGTGCTGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1050986719 9:12091948-12091970 GTGCAGCAGCAGCAGCATGCTGG + Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1056568999 9:87799511-87799533 GCTCAGCAGCTCCACAGTGCAGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060508505 9:124215768-124215790 GGCCTGCAGCAGCATGGTGCAGG - Intergenic
1060918641 9:127405550-127405572 GTTCAGCAGCCTCATGGTGAGGG + Exonic
1061867245 9:133499195-133499217 GTCCAGCAGGGGCAGGGTGCTGG - Intergenic
1203627979 Un_KI270750v1:42890-42912 GTCCCACAGCAGCACAGTGCTGG - Intergenic
1187245861 X:17552421-17552443 GCTCAGCAGCTGAACAGTGCTGG + Intronic
1187691967 X:21877647-21877669 GTTTACCAGCACCACAGTGCAGG + Intronic
1189098818 X:38168065-38168087 GTTCAGCTTCAGCTGGGTGCTGG - Intronic
1191123217 X:56927130-56927152 GTACAGCAGCTGCACTGTTCTGG + Intergenic
1191664615 X:63687142-63687164 GTTTAACAGCATCACGTTGCAGG + Intronic
1192152810 X:68722565-68722587 GCTCAGCAGCATCACGCAGCAGG - Exonic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1197774226 X:130109717-130109739 ATTCAGCAGCCGCACCGTGCGGG - Intronic
1198206143 X:134466769-134466791 GTTCAGTAGCAGAAAGGTGCTGG + Intronic
1198338853 X:135693905-135693927 GGGCAGCAGCAGCATTGTGCGGG - Intergenic
1199085835 X:143630060-143630082 GTTTTGCAGAAGCAAGGTGCCGG + Exonic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic
1199819018 X:151426296-151426318 GGTTAGCAGGAGCAGGGTGCAGG - Intergenic
1200182543 X:154159480-154159502 GATCAGCATCAGCATGGTGCAGG + Intergenic
1200188197 X:154196594-154196616 GATCAGCATCAGCATGGTGCAGG + Intergenic
1200193847 X:154233734-154233756 GATCAGCATCAGCATGGTGCAGG + Intergenic
1200199602 X:154271538-154271560 GATCAGCATCAGCATGGTGCAGG + Exonic
1201437509 Y:13975310-13975332 GTTCAGCAGCTGCACAGCGATGG + Intergenic