ID: 1143733726

View in Genome Browser
Species Human (GRCh38)
Location 17:8895978-8896000
Sequence CCTGCTTAGCATGGGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143733710_1143733726 11 Left 1143733710 17:8895944-8895966 CCCCCTTCCTTGGCCTCTCTTGG 0: 1
1: 1
2: 13
3: 201
4: 3699
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733709_1143733726 18 Left 1143733709 17:8895937-8895959 CCATCAACCCCCTTCCTTGGCCT 0: 1
1: 0
2: 2
3: 45
4: 471
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733717_1143733726 -2 Left 1143733717 17:8895957-8895979 CCTCTCTTGGTAATGGACCTCCC 0: 1
1: 0
2: 3
3: 8
4: 70
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733706_1143733726 27 Left 1143733706 17:8895928-8895950 CCCAAAACACCATCAACCCCCTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733714_1143733726 8 Left 1143733714 17:8895947-8895969 CCTTCCTTGGCCTCTCTTGGTAA 0: 1
1: 0
2: 3
3: 30
4: 304
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733713_1143733726 9 Left 1143733713 17:8895946-8895968 CCCTTCCTTGGCCTCTCTTGGTA 0: 1
1: 0
2: 1
3: 39
4: 273
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733712_1143733726 10 Left 1143733712 17:8895945-8895967 CCCCTTCCTTGGCCTCTCTTGGT 0: 1
1: 0
2: 3
3: 40
4: 546
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733707_1143733726 26 Left 1143733707 17:8895929-8895951 CCAAAACACCATCAACCCCCTTC 0: 1
1: 0
2: 2
3: 15
4: 204
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733704_1143733726 29 Left 1143733704 17:8895926-8895948 CCCCCAAAACACCATCAACCCCC 0: 1
1: 0
2: 2
3: 25
4: 229
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733716_1143733726 4 Left 1143733716 17:8895951-8895973 CCTTGGCCTCTCTTGGTAATGGA 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1143733705_1143733726 28 Left 1143733705 17:8895927-8895949 CCCCAAAACACCATCAACCCCCT 0: 1
1: 0
2: 0
3: 10
4: 198
Right 1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143733726 Original CRISPR CCTGCTTAGCATGGGGTGTG GGG Intronic
900604089 1:3516153-3516175 CCTGCAGAGCATGGACTGTGGGG + Intronic
900894416 1:5473366-5473388 CCTGCTTAGCCCGGGGACTGAGG - Intergenic
902400376 1:16154006-16154028 CCTGCATCCCATGGGGTGTGGGG + Intronic
906402312 1:45513920-45513942 CCTCCTTAGCACAGGGTGTCAGG - Intronic
908846629 1:68331164-68331186 ACTGCTGAGCATGGAGTGGGTGG - Intergenic
911649906 1:100376141-100376163 CCTGCCTGTCATGGGGTGGGGGG + Intronic
915307541 1:154989319-154989341 CCTCTGTAGCAGGGGGTGTGGGG - Intronic
919047338 1:192470066-192470088 GCTGCCTAGCATTGGGGGTGAGG + Intergenic
922712709 1:227845414-227845436 CCTGCTTCGTGTGGGGTGGGGGG - Intronic
924941408 1:248814601-248814623 CCTGCTGAGCCTGGGGGGAGAGG + Exonic
1066232058 10:33444882-33444904 ACTGCGTTGCATGGGCTGTGTGG - Intergenic
1067054734 10:43044029-43044051 CCTGGTAAGCAGGGGGAGTGTGG - Intergenic
1067059450 10:43070505-43070527 CCTGCTTGCCCTTGGGTGTGGGG - Intergenic
1067699188 10:48556376-48556398 CCTGCCTAGCCTGGGGGTTGGGG - Intronic
1069761240 10:70812921-70812943 CCGGCTGAGCAAGGGGTGTCAGG + Intergenic
1070601537 10:77869505-77869527 CCAGGTAAACATGGGGTGTGGGG + Intronic
1070707744 10:78653602-78653624 CATGCTCAGTTTGGGGTGTGGGG - Intergenic
1071248391 10:83790517-83790539 CTTGCTTAGCCTGGGGGATGAGG + Intergenic
1074693393 10:116026907-116026929 CCTGCTTAGATTGGTGTGTGTGG + Intergenic
1075633429 10:124015092-124015114 CCTGCTTGGCAAGGGGGCTGGGG - Intronic
1076764433 10:132625290-132625312 CCTGCTGAGAAAGGGGTGTGGGG - Intronic
1078833877 11:15006579-15006601 GCTGCTTAGCTTGGGGTTAGTGG - Intronic
1079060986 11:17248618-17248640 CTTGCTTAGCAAGGGCTGTGTGG + Intronic
1079770701 11:24454898-24454920 TGTGCTTAGCATGTGGGGTGAGG - Intergenic
1081225417 11:40516045-40516067 TTTGCTGAGCATGGGGTATGGGG + Intronic
1084502277 11:69541830-69541852 CCTGCTTATGATGGGCAGTGGGG + Intergenic
1086522955 11:87691581-87691603 CCTGTTTGGGGTGGGGTGTGGGG + Intergenic
1089456396 11:118628253-118628275 CCTGTTTAGCTTGGGATCTGGGG - Exonic
1089627436 11:119760633-119760655 CCTGCTGTGCATGGGGTATTGGG - Intergenic
1089947419 11:122491575-122491597 CCTGCAGAGCATGGAGTTTGTGG - Intergenic
1090433083 11:126663108-126663130 ACTGATGAGCATGGGGAGTGTGG + Intronic
1090978549 11:131696174-131696196 CCTTGGTAGTATGGGGTGTGGGG + Intronic
1095496902 12:42794663-42794685 GTAGCTTAGCATAGGGTGTGTGG - Intergenic
1096817686 12:54211616-54211638 CCTGAGTAGGATGGGGAGTGTGG + Intergenic
1098695622 12:73550473-73550495 AATACTTAGCATGGTGTGTGAGG - Intergenic
1103941961 12:124506085-124506107 CCTGCTTTGCCTGGGGTGAAGGG - Intronic
1104299779 12:127553957-127553979 GGTGCTTAGCATGGAGTGAGGGG + Intergenic
1106174423 13:27317438-27317460 GCTACTTAGCCTGGGGTGGGAGG + Intergenic
1106432087 13:29690616-29690638 GCTGGTTGGCATGGAGTGTGGGG - Intergenic
1107263069 13:38518738-38518760 TCTTCTCAGCATGGGGTCTGTGG + Intergenic
1108593954 13:51934696-51934718 CCTGCTCAGCTTGTGGTGAGTGG + Exonic
1109453971 13:62558749-62558771 CCAGCTTAGCATGAGATGTCAGG + Intergenic
1110085944 13:71379870-71379892 CCTGATTAGCTTGTGATGTGGGG - Intergenic
1113634987 13:111913311-111913333 CCTGCTGAGCATGGAGCTTGAGG + Intergenic
1117253057 14:53954235-53954257 TCTGCTTTGCATGGGGAGAGGGG - Intronic
1117752615 14:58939338-58939360 GCTGCTTGGCTTGGAGTGTGGGG + Intergenic
1121325449 14:93017052-93017074 CCTGGGTAGCATGGGGCTTGGGG - Intronic
1127592447 15:60439078-60439100 CTTGCTTTGCATGCAGTGTGAGG + Intronic
1129301322 15:74627228-74627250 CCTGCTGAGGTGGGGGTGTGAGG + Intronic
1129756639 15:78102963-78102985 GCTGCTATCCATGGGGTGTGTGG - Intronic
1130065248 15:80597432-80597454 GCTCCTTAGTATGGGGTGTTTGG - Exonic
1132670941 16:1102115-1102137 GCAGCTGGGCATGGGGTGTGGGG - Intergenic
1132959195 16:2612758-2612780 CCTGCTCCGAATGGGGTGTGGGG + Intergenic
1132972255 16:2694733-2694755 CCTGCTCCGAATGGGGTGTGGGG + Intronic
1133234209 16:4380290-4380312 CCTGCTTAGGCTGGGGGCTGCGG - Intronic
1134085656 16:11355836-11355858 CCTGCCCAGCATGGGGTCTTAGG + Intergenic
1137058115 16:35754952-35754974 CCTGCTTAGCTTCCGGTATGGGG - Intergenic
1138089803 16:54164914-54164936 CCTGGATAGCATGGGGTGCCTGG + Intergenic
1139836770 16:69845304-69845326 CCTGCTAAGCCTGGGAAGTGAGG + Intronic
1141663806 16:85455501-85455523 CGGCCTGAGCATGGGGTGTGAGG - Intergenic
1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG + Intronic
1143777263 17:9207747-9207769 CCTGCTGTCTATGGGGTGTGGGG - Intronic
1144642373 17:16944699-16944721 CTTGCTGTGCATGGGGAGTGGGG - Intronic
1145003491 17:19321731-19321753 GCTGCTGAGCATGGGCAGTGAGG + Intronic
1146061790 17:29611714-29611736 CCTGCTTAGCATGGCCTATGTGG + Intronic
1146196014 17:30813759-30813781 AATGCTTAGCACTGGGTGTGGGG - Intronic
1149495116 17:57112687-57112709 CCTTCTTAGCCTGAGGTCTGGGG - Intronic
1150698281 17:67424822-67424844 CATGCTTAGCTTGGGCTGAGAGG - Intronic
1152644621 17:81463078-81463100 CCTGCTGAGCGGGGGCTGTGTGG - Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1156474225 18:37395441-37395463 CCTGCTATGCATGAAGTGTGCGG - Intronic
1157349077 18:46868947-46868969 CCTGGTTGCCATGGTGTGTGAGG - Intronic
1157901529 18:51522728-51522750 CCTGCTTAGGGTGGGGGATGTGG + Intergenic
1158559014 18:58498359-58498381 CCTCCTTGTCATGGGGTGGGTGG - Intronic
1161328615 19:3675704-3675726 CCTGGTTTGCATGGGCTTTGGGG - Intronic
1162585002 19:11553144-11553166 CCTGGTTACCATGGGGAGGGGGG + Exonic
1166054045 19:40278043-40278065 CCTGCTTGGGATGTGGGGTGTGG - Intronic
925389374 2:3484944-3484966 GCTGCTGAGCATGGGGAATGTGG + Intronic
925391467 2:3497248-3497270 GTTGCTTAGGATGGGGTGGGGGG + Intergenic
930031282 2:47059516-47059538 CCTGCCAAGGATGGGGTGGGAGG - Intronic
931791088 2:65664964-65664986 CCTTCTAAGCCTGGGCTGTGGGG + Intergenic
932112512 2:69013671-69013693 CCCGCTTAGCCTGGGGTGGGGGG - Intronic
933253860 2:80058780-80058802 AGTGCTTAGCAGGGGGTCTGGGG - Intronic
933307796 2:80623624-80623646 CCAGCTAAGCAAGGGGTTTGGGG + Intronic
933440157 2:82302279-82302301 CCTGCTTAGCATGGGAAATCAGG + Intergenic
934887526 2:98037961-98037983 CCTGCTTAGCATGTGGTCCTGGG + Intergenic
937590578 2:123608388-123608410 ACTGCTTAGCCTGGCATGTGTGG - Intergenic
939104626 2:137934893-137934915 CCTACTTAGCAGAGGGAGTGAGG + Intergenic
939885963 2:147682059-147682081 TCTGCTTAGAATAGGGTGTAAGG - Intergenic
944765409 2:202859612-202859634 CCTGCTTAGTGTGGGATTTGTGG - Intronic
945928515 2:215830573-215830595 CCTGCTTATCAGGGCATGTGAGG + Intergenic
946409724 2:219509977-219509999 CCTGACATGCATGGGGTGTGGGG + Intergenic
946894331 2:224307933-224307955 GCTGCATAGCAGGAGGTGTGCGG + Intergenic
948106396 2:235417639-235417661 CCTGCTTAGCATGTTTGGTGAGG - Intergenic
948904651 2:240972985-240973007 CCTGCTCAGCAAGGGGCATGGGG - Intronic
1171367382 20:24634899-24634921 GCTGCTGAGCATTGGTTGTGCGG + Intronic
1172829795 20:37823846-37823868 CGTGCTCAGCCTTGGGTGTGTGG + Intronic
1173523631 20:43716392-43716414 CCTGCTTAGGATGGGGGATGTGG + Exonic
1173670941 20:44798550-44798572 CCTGCTTAGCATGGGGGATCTGG - Intronic
1173715434 20:45199577-45199599 CCTGCTTAGTAGAGGGTATGTGG + Intergenic
1175991145 20:62789922-62789944 CCTGCCTGCCATGGGGTGTGTGG - Intergenic
1176389815 21:6157650-6157672 CCTGCTGGCCCTGGGGTGTGAGG + Intergenic
1179438838 21:41379570-41379592 CCTGGTTAGTGTGGGGGGTGGGG - Intronic
1179733652 21:43380588-43380610 CCTGCTGGCCCTGGGGTGTGAGG - Intergenic
1179881674 21:44295726-44295748 GCTGCTCAGGATGGGGTCTGGGG - Intronic
1179979128 21:44887403-44887425 CCTCCTGAGCATGGGGACTGTGG + Intronic
1181762786 22:25069493-25069515 CCAGCCCAGCATGGGGAGTGGGG - Intronic
1184259774 22:43307997-43308019 CCTGCTTGGGATTGGGTGGGGGG - Intronic
1184857973 22:47156833-47156855 CCTGCTGAGCATCGGGTGGTCGG - Intronic
1185407935 22:50666228-50666250 CCTGCTTAGCTTTGGATGTAAGG + Intergenic
953441195 3:42918940-42918962 CCTGCTAAGATTGGGGTGTTTGG + Intronic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
955408003 3:58637599-58637621 CCAGCGTAGAATGGGGTCTGGGG - Intronic
955878515 3:63519712-63519734 ACTGCTTAGCATCAGGTTTGGGG - Intronic
959740204 3:109710174-109710196 CCTGCCTAGCAAAGGCTGTGAGG - Intergenic
959913053 3:111786667-111786689 ACTGCTTATCATTGGGTGGGAGG - Intronic
960050398 3:113233811-113233833 CCTTCCAAGCATGGGGTGGGTGG - Intronic
960055409 3:113273238-113273260 CGTGCTCAGCATGGGGCCTGAGG + Exonic
961322956 3:126090910-126090932 CCTGCTTGTCATGGAGTGAGGGG + Intronic
961481446 3:127183390-127183412 CCTGCTTGGCACAGGGTGAGAGG + Intergenic
962868271 3:139465899-139465921 CCTGTGAGGCATGGGGTGTGGGG + Intronic
967586007 3:191215625-191215647 TCTGATTTGCATGGGGTCTGTGG - Intronic
967672982 3:192261065-192261087 CCTGCGTACCCTGTGGTGTGTGG - Intronic
970699872 4:18723331-18723353 ACTGTGTAGCATGGGGTATGGGG - Intergenic
977515583 4:98017504-98017526 CCTGCTCAGGTTGGGGTGAGGGG + Intronic
978054669 4:104249021-104249043 CCTGTGTAGCAGTGGGTGTGGGG + Intergenic
978534437 4:109746032-109746054 CCTTCTGAGCATGGGGTGCTGGG + Intronic
982898476 4:160965862-160965884 CATGGTTAGCATGGGTTGGGAGG - Intergenic
989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG + Intergenic
992091581 5:73322540-73322562 CCTGCTCAGCCTGGGGTCTCGGG + Intergenic
993251511 5:85530805-85530827 TGTTCTTAGGATGGGGTGTGGGG - Intergenic
994951871 5:106473732-106473754 CTTGCTTAGAGTGTGGTGTGAGG + Intergenic
996638970 5:125730044-125730066 CCTCCTTTGGCTGGGGTGTGGGG - Intergenic
996909962 5:128645151-128645173 CCTTCTCAGAATGGGGTGTAGGG - Intronic
997717348 5:136052053-136052075 CCTGCTCAGCCTGGGGTTGGGGG + Intronic
998781295 5:145659567-145659589 CTAGCTTAGAATGGGATGTGGGG + Intronic
999329083 5:150660645-150660667 CCAGCTCAGCCTGGGGTGGGGGG - Intergenic
999619415 5:153457193-153457215 ACTGCATAGCATGAGGTGGGTGG + Intergenic
1001245147 5:170100653-170100675 CATGCTGAGCATGGGCTTTGTGG - Intergenic
1005245213 6:23876438-23876460 CCTGTTCAAGATGGGGTGTGTGG - Intergenic
1008887623 6:56448274-56448296 AGTGCTCAGCAGGGGGTGTGGGG - Intergenic
1011426358 6:87235756-87235778 CCTGCTTAACATGAGAAGTGGGG - Intronic
1011481543 6:87798830-87798852 CCTGCTTGCCACGGGGTATGTGG + Intergenic
1011740019 6:90350213-90350235 CCTCCTTAACATGGTCTGTGAGG + Intergenic
1013609714 6:111783016-111783038 CGTGCTTAGCATGAAGTATGTGG - Intronic
1017770736 6:157642570-157642592 CTTTCTTAGCAGGGGTTGTGGGG + Intronic
1020355746 7:7273863-7273885 CCTGCACAGCATGGGCAGTGTGG - Intergenic
1021818695 7:24475700-24475722 ACTGGTTGGCATGGGTTGTGAGG - Intergenic
1023247765 7:38224082-38224104 CTTGCTTAGCATAAGGTTTGAGG + Intronic
1026095521 7:67343417-67343439 CATGCTGAGCATGAGGAGTGAGG - Intergenic
1032882069 7:136100467-136100489 GCTGCTTGGCATGGTGGGTGGGG + Intergenic
1033315378 7:140292695-140292717 GCTGCTTGGCATGGGCTCTGCGG - Intergenic
1035562449 8:616423-616445 CCAGGAGAGCATGGGGTGTGCGG - Intronic
1035698080 8:1615292-1615314 CCTCCTTAGCTTTGGGTGTTTGG - Intronic
1036692977 8:10956404-10956426 CCTGCTTTGTATGGGGTGTTGGG - Intronic
1038350245 8:26770017-26770039 CCTGCTGGGAATGGGGTGGGTGG - Intronic
1038895537 8:31777795-31777817 CCAGGTTGGCAGGGGGTGTGTGG + Intronic
1040400251 8:47043424-47043446 ACTGGAAAGCATGGGGTGTGTGG - Intergenic
1042510995 8:69610790-69610812 CCTGATTAGGATGGGCTGTTAGG - Intronic
1042978530 8:74499455-74499477 CCTGCTTAGAAAGGAGTGTTTGG + Intergenic
1043433151 8:80213760-80213782 CCTACTTGGAATGTGGTGTGTGG + Intronic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1047640108 8:126809785-126809807 CATGCTTAGGGTGGGGAGTGGGG + Intergenic
1048373963 8:133805462-133805484 CCTGTTAAGCATGGGGAGGGTGG + Intergenic
1048527081 8:135213051-135213073 GCTGCCCAGCATGGGCTGTGAGG + Intergenic
1049231934 8:141489035-141489057 CCTGCTAATCCTGGGGTGGGAGG + Intergenic
1049725624 8:144144406-144144428 CTTGCTTGCCCTGGGGTGTGTGG - Intergenic
1051099772 9:13507478-13507500 CCTACTTTTCATGGGGTGGGTGG - Intergenic
1054732051 9:68711123-68711145 CATGCTGAGCAAGGGGTTTGTGG + Intronic
1054898919 9:70346636-70346658 ACTGCATACCATGGGGAGTGAGG - Exonic
1058566161 9:106287528-106287550 TCTGCTTTGCTTGGGGGGTGGGG + Intergenic
1060442640 9:123655973-123655995 CCTGCTTACTCTGGGGTGGGAGG + Intronic
1060494434 9:124107659-124107681 CCTGATTGGTATGGGGGGTGGGG + Intergenic
1060778146 9:126391845-126391867 CCTTCTCAGCAGGGGGTGTCTGG + Intronic
1192195616 X:69025888-69025910 CTTGCTTAGGATGGGGGCTGGGG + Intergenic
1197256410 X:124268153-124268175 AATGCTTAGCATGGTGTCTGGGG + Intronic
1199258405 X:145743835-145743857 CTTGCTTGGCGGGGGGTGTGGGG - Intergenic