ID: 1143734095

View in Genome Browser
Species Human (GRCh38)
Location 17:8898286-8898308
Sequence TATCAAATGGGGAACAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143734095_1143734106 25 Left 1143734095 17:8898286-8898308 CCAGGTTTGTTCCCCATTTGATA 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1143734106 17:8898334-8898356 TTAAGCAACCCAAAGGGAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 235
1143734095_1143734107 26 Left 1143734095 17:8898286-8898308 CCAGGTTTGTTCCCCATTTGATA 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1143734107 17:8898335-8898357 TAAGCAACCCAAAGGGAAAGGGG 0: 1
1: 0
2: 2
3: 24
4: 321
1143734095_1143734105 24 Left 1143734095 17:8898286-8898308 CCAGGTTTGTTCCCCATTTGATA 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1143734105 17:8898333-8898355 ATTAAGCAACCCAAAGGGAAAGG 0: 1
1: 0
2: 3
3: 24
4: 207
1143734095_1143734103 19 Left 1143734095 17:8898286-8898308 CCAGGTTTGTTCCCCATTTGATA 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1143734103 17:8898328-8898350 GCCATATTAAGCAACCCAAAGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1143734095_1143734101 -10 Left 1143734095 17:8898286-8898308 CCAGGTTTGTTCCCCATTTGATA 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1143734101 17:8898299-8898321 CCATTTGATAGGAAGTCAAAGGG 0: 1
1: 0
2: 3
3: 12
4: 176
1143734095_1143734108 30 Left 1143734095 17:8898286-8898308 CCAGGTTTGTTCCCCATTTGATA 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1143734108 17:8898339-8898361 CAACCCAAAGGGAAAGGGGCAGG 0: 1
1: 0
2: 0
3: 25
4: 268
1143734095_1143734102 18 Left 1143734095 17:8898286-8898308 CCAGGTTTGTTCCCCATTTGATA 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1143734102 17:8898327-8898349 AGCCATATTAAGCAACCCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143734095 Original CRISPR TATCAAATGGGGAACAAACC TGG (reversed) Intronic
901624099 1:10613801-10613823 TAGCAAGTGGGCAACAAGCCTGG - Intronic
904148847 1:28419282-28419304 TATCAAATGGGGACAAAAACAGG - Intronic
904676606 1:32202558-32202580 TATTTAGTGGGGAACAAACATGG - Intronic
906822113 1:48940605-48940627 TATCAAATGGGTAAGTACCCTGG - Intronic
910038431 1:82817977-82817999 TCTCATTTGAGGAACAAACCTGG + Intergenic
910607988 1:89108340-89108362 TACCAAAAGGGGAACTAATCTGG - Intronic
911118813 1:94274667-94274689 TAGCAAAAGGGCAACAAACCTGG + Intronic
911679596 1:100699762-100699784 TAAGATATGGGAAACAAACCTGG - Intergenic
917644293 1:177014792-177014814 GAACGAATGGGGGACAAACCAGG - Exonic
918230900 1:182530746-182530768 TATCAAACAGGGCAAAAACCTGG - Intronic
919105131 1:193140181-193140203 TAACAAATGAGAAACAAACAAGG - Intronic
920629284 1:207635720-207635742 TATCACATGGGGAAAAACCTTGG + Intronic
922979486 1:229813586-229813608 CATCAAATGTGGCACTAACCAGG - Intergenic
1063327039 10:5114359-5114381 TATGAAATGGGAAAAAAACCTGG + Intronic
1063378936 10:5572172-5572194 TATCGAATGGGGGACAACCATGG + Intergenic
1064250458 10:13702665-13702687 TATCTAATTTGGAAGAAACCTGG + Intronic
1072516721 10:96190681-96190703 AATTAAATGGGGAACACACTTGG - Intronic
1075220118 10:120577386-120577408 TAGGAAATGAGGAACAAAACAGG - Intronic
1075297682 10:121292456-121292478 TATCAAACTGGGAACAAGCCCGG - Intergenic
1077586352 11:3456590-3456612 TATCACATGGGGAAAAACCTTGG + Intergenic
1080262877 11:30368794-30368816 TATTAAGTGGGGAAAAAAGCAGG + Intergenic
1080721083 11:34849274-34849296 TATCAACTGTGAGACAAACCTGG - Intergenic
1083040562 11:59681495-59681517 TATCACATGGGGAGAAACCCTGG - Intergenic
1083393055 11:62369095-62369117 TATCACATGGGGAGAAACCCTGG + Intronic
1084845906 11:71899720-71899742 TATCACATGGGGAGAAAACTTGG - Intronic
1086404648 11:86489315-86489337 TATCAAATGGGGATAAAATAGGG + Intronic
1089994748 11:122895717-122895739 TATCAAATGGGGAGGAAAAGAGG + Intronic
1090444122 11:126748703-126748725 TAACAAATGAGGATTAAACCAGG + Intronic
1090477630 11:127037876-127037898 TATTAAATGGGTAAAACACCAGG + Intergenic
1093190729 12:16071832-16071854 TATCAAATGAGAGAGAAACCTGG + Intergenic
1093249800 12:16788289-16788311 AATTAAATGGGGATCTAACCTGG - Intergenic
1093769278 12:23000569-23000591 TATCAAAGGGGGAAAAAATCTGG - Intergenic
1093964056 12:25306856-25306878 GATCAAATGGGTTACATACCAGG + Intergenic
1095475264 12:42580707-42580729 TATGCAATGGTGAACAAACATGG + Intronic
1095607178 12:44083096-44083118 TATAAAATTGGGAAGAAAACTGG - Intronic
1100973373 12:100095344-100095366 AAGCAAATGAGGAAAAAACCTGG - Intronic
1102054658 12:109887552-109887574 GATCAAATGAGGAAAAAACAAGG - Intergenic
1102108194 12:110343879-110343901 TATGAAATGGGGAAGAACCCGGG - Intronic
1107379016 13:39835682-39835704 TGTGGAATGGGGAACAAACAAGG + Intergenic
1108284209 13:48890012-48890034 AATCAAAAGGGAAACTAACCTGG + Intergenic
1109678894 13:65719721-65719743 GATCAAATGGGTCACATACCAGG + Intergenic
1110274389 13:73627489-73627511 GATTCAATGGTGAACAAACCAGG + Intergenic
1111636847 13:90915915-90915937 TATCAAATGGGAAAAAAATGAGG + Intergenic
1111689853 13:91550073-91550095 TATCAAATGGTGAAAAGACATGG + Intronic
1112170147 13:96963133-96963155 TATAAAAAGAAGAACAAACCTGG + Intergenic
1112701160 13:102010368-102010390 TCTAAAATGTGGACCAAACCAGG - Intronic
1114006542 14:18319815-18319837 TATCACATGGGGAGAAAACTTGG - Intergenic
1116416358 14:44682434-44682456 TATCAACTGGGGAACAAGTTTGG - Intergenic
1117875096 14:60244077-60244099 TATCGTACGGGGGACAAACCTGG + Intergenic
1117890415 14:60415333-60415355 TTTAAAAAGGTGAACAAACCTGG + Intronic
1119841332 14:77795283-77795305 TATCACATGGGGAGAAAACTTGG + Intergenic
1122911637 14:104831821-104831843 AATAAAATGGAGAACAAGCCAGG - Intergenic
1127150129 15:56065838-56065860 TTTCAAATGTTGAACCAACCTGG - Intergenic
1128566701 15:68705507-68705529 TATCAAATGGGGATAAAGCAAGG + Intronic
1131729922 15:95268722-95268744 TTTCAAACAGGGAACAAACAAGG - Intergenic
1132533156 16:463731-463753 TAACAAATGGGGAACAGGCCGGG - Intronic
1133423197 16:5664917-5664939 TAACAAATGGGAAATCAACCTGG - Intergenic
1133455350 16:5937034-5937056 TGTCAAATGGGGATAAAATCTGG + Intergenic
1134807471 16:17138242-17138264 TATCACATGGTGCCCAAACCTGG - Intronic
1135289409 16:21222395-21222417 TATCACATGGGGAGAAAACTTGG + Intergenic
1136178165 16:28532761-28532783 TAGCAAAGGGGGAAAAATCCAGG + Intronic
1137067900 16:35868711-35868733 TTCCAAATGGTGAACAACCCCGG - Intergenic
1139166474 16:64571358-64571380 TATCAAAAGGGGAGCACACAAGG + Intergenic
1139282695 16:65784223-65784245 TATAAAGTGGGGAACAAGCCGGG - Intergenic
1139769297 16:69260307-69260329 TATTAAATGAGGAACCATCCTGG - Intronic
1140263711 16:73402545-73402567 TGTCAAATGGTTAACAGACCAGG + Intergenic
1142390139 16:89794127-89794149 TAGCAAATAGGCAACAAACAGGG - Intronic
1143734095 17:8898286-8898308 TATCAAATGGGGAACAAACCTGG - Intronic
1147499099 17:40945163-40945185 TATCAAGTGGGGAAGAATGCTGG - Intergenic
1148668703 17:49394055-49394077 CATGAAATGGGGAAGAAACAGGG - Intronic
1155426047 18:25708656-25708678 TATGAAATGTGGAACAATCTTGG - Intergenic
1157203817 18:45681726-45681748 AAAAAACTGGGGAACAAACCAGG - Intronic
1157457540 18:47848069-47848091 CACCAAAGGGGGAAAAAACCTGG + Intronic
1157461441 18:47899434-47899456 TATCAAATGTGGAAAAAAAGTGG + Intronic
1159647052 18:70931223-70931245 TATCAAATGGAGAAGATGCCTGG - Intergenic
1164208605 19:23078076-23078098 TATCACATGGGGAAAAACCTTGG - Intronic
1164390414 19:27814931-27814953 TATCACATGGGGAGAAAACTTGG - Intergenic
1168048629 19:53811939-53811961 TTTCAAAGGGGGCACAAGCCAGG + Intronic
1168219588 19:54950891-54950913 TATCACATGGGGAGAAACCCTGG + Intronic
927128541 2:20036391-20036413 TATCACATGGGTACTAAACCTGG - Intronic
928084826 2:28339514-28339536 CAGCAAATTAGGAACAAACCTGG + Intergenic
928692074 2:33810423-33810445 TATCAAATGGAAAACAAAAATGG - Intergenic
929761159 2:44807781-44807803 TCTCGGATGGGGAAGAAACCCGG + Intergenic
931598226 2:63974389-63974411 TATTAAAAGAGGAACAAAGCTGG - Intronic
931931347 2:67138934-67138956 TCTCAAATCAGGAACAAAACTGG - Intergenic
935227153 2:101062553-101062575 TATCAAATGAAGGGCAAACCAGG + Intronic
936067198 2:109341658-109341680 GAGCAAAGGGGGAAGAAACCTGG - Intronic
939578805 2:143924544-143924566 AAGCAAATGGAGAACAAATCTGG - Intergenic
940358344 2:152769717-152769739 TATCACATGGGGAAAAACCTTGG + Intergenic
940432979 2:153615662-153615684 TCTCAAATGGGAAACAAAAATGG - Intergenic
941229104 2:162886546-162886568 TTTCAAATGTGGATCAAATCAGG + Intergenic
941565996 2:167108960-167108982 TATTACATGGGTAACAAACTTGG + Intronic
944784634 2:203056432-203056454 TATCAAATGTGGAAGAAATTGGG + Exonic
944841118 2:203624523-203624545 TATAAAAAGGGGAACAGGCCAGG - Intergenic
946949125 2:224853223-224853245 TATCAATTGGTGTACAAGCCAGG - Intronic
947651519 2:231790397-231790419 AATCAGAAGGGGAAGAAACCTGG - Intronic
1168857512 20:1019200-1019222 AATCAAATAGTGAACAATCCAGG + Intergenic
1170397868 20:15947304-15947326 TATCACATGGGGAAAAACCTTGG + Intronic
1177491708 21:21834050-21834072 TTTCAAAGCGGGAAGAAACCTGG - Intergenic
1180040177 21:45273618-45273640 GATCAAATGGGTATCATACCAGG + Intronic
1180431051 22:15250626-15250648 TATCACATGGGGAGAAAACTTGG - Intergenic
1180891240 22:19291038-19291060 AAACAAATGGAGAACAAACTGGG + Intronic
1183258491 22:36778651-36778673 TATCAAATGGGGATGATACATGG - Intergenic
1184196622 22:42934057-42934079 TCTCCAATGGGGAAAAAGCCTGG - Intronic
949764879 3:7515565-7515587 TATCAAAAAGGAAACTAACCTGG + Intronic
955136613 3:56225168-56225190 TAACAAATGGGGAAAAAAGGAGG - Intronic
955399034 3:58578062-58578084 TGTCAAATGTGGAGCATACCAGG + Intronic
955469058 3:59267241-59267263 TATTAAATGGTAACCAAACCAGG - Intergenic
955838705 3:63087897-63087919 TATCAAATGGGAAAAAATTCTGG - Intergenic
957371836 3:79304218-79304240 TATCAAATGAGTAACTAACTTGG + Intronic
959143304 3:102512478-102512500 TTTCAAATGGGGAAGAAAGTGGG + Intergenic
961285611 3:125799886-125799908 TATCACATGGGGAGAAACCCTGG + Intergenic
961878022 3:130038927-130038949 TATCAAATGGGGAGAAACCTTGG + Intergenic
966170101 3:177070394-177070416 TATCAACAGGGGAACAAAGAAGG + Intronic
969790327 4:9490041-9490063 TATCACATGGGGAGAAACCCTGG - Intergenic
970006232 4:11413434-11413456 TGTCATATGTGGCACAAACCAGG - Intronic
970522140 4:16896368-16896390 TCTCAAATGGGAAACAAACCTGG + Intronic
972749795 4:41977276-41977298 TGTGAAATGGTAAACAAACCCGG - Intergenic
979811143 4:125037815-125037837 TAGCAAATGGGGAGGAAGCCGGG - Intergenic
982447019 4:155504041-155504063 TATATAATGGGGCACAAAACAGG + Intergenic
983330950 4:166328530-166328552 TATAAATTAGGGAGCAAACCTGG + Intergenic
985026373 4:185743372-185743394 TAGCAAATGGGGAGCAAATTGGG - Intronic
986977341 5:13409679-13409701 TATGAAATGGGGCACAATCCAGG - Intergenic
988137851 5:27198637-27198659 TATTCACTGGGGAACAAAGCAGG + Intergenic
990688402 5:58334494-58334516 AATCAAAAGGGGAAAATACCTGG + Intergenic
991976963 5:72193059-72193081 GAGCAAATGGGGAACGAACTTGG + Intronic
994133076 5:96253310-96253332 TATCAAACTTGGCACAAACCTGG + Intergenic
996448692 5:123591411-123591433 TATCTAAAGGGCAGCAAACCTGG - Exonic
998969451 5:147575593-147575615 TAGCTAATGGGGAACAGAGCTGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1000488298 5:161876702-161876724 TATTAAATTGGGAAAAAAGCAGG - Intronic
1000664805 5:163981664-163981686 TATCATATAGGGAACTCACCAGG - Intergenic
1003469617 6:6417015-6417037 TCTCAAACAGGGAAAAAACCTGG + Intergenic
1005133712 6:22542275-22542297 TATCATATGGGGGCCAAAGCAGG + Intergenic
1009539792 6:64939915-64939937 TATCAAATAGAGACAAAACCAGG + Intronic
1010435478 6:75825295-75825317 TATAAAATTGGAAAGAAACCGGG + Intronic
1011757410 6:90515526-90515548 TACCAAATGAGAAATAAACCAGG - Exonic
1013166782 6:107601323-107601345 TCTCATATGGGAAACAAACCTGG - Intronic
1014433398 6:121395570-121395592 TATTTAATGGGGAATAAAACAGG - Intergenic
1024370224 7:48574440-48574462 TATCAAATTTATAACAAACCTGG - Intronic
1024418769 7:49138334-49138356 TAATAAATGGAGAACAGACCTGG + Intergenic
1026572324 7:71542045-71542067 TACAAAATGGGGAATAAAACAGG + Intronic
1026607711 7:71829774-71829796 GATGAAATGGGAAACAAACAGGG + Intronic
1027809787 7:82880896-82880918 TAACAAATGGGTTACAAACATGG + Intronic
1029856185 7:103519304-103519326 TATCAAATCGAATACAAACCCGG + Exonic
1030585178 7:111409856-111409878 TAACAAAAGGGAAACAAATCAGG + Intronic
1031205455 7:118751489-118751511 TATCAAAAGGGCAACAGATCTGG + Intergenic
1031230630 7:119100851-119100873 TATCACATGGGGAGAAAACTTGG + Intergenic
1032207121 7:129876565-129876587 TATCAATTGGGGTATAAAACCGG - Intronic
1032881964 7:136099779-136099801 TAGGCAATGGGGAACAAAACAGG + Intergenic
1036142637 8:6222710-6222732 TACCCAATGGGGTACACACCAGG + Intergenic
1036992820 8:13618225-13618247 TATCAAATAGGTGGCAAACCAGG + Intergenic
1037546414 8:19928442-19928464 TGTCAAATGGGGGAGAAAGCAGG - Intronic
1037629865 8:20645325-20645347 TTACAAATGGGGAACAAAGGGGG + Intergenic
1038067897 8:23982686-23982708 TATCATATGGGCATCAAAGCAGG + Intergenic
1043883015 8:85566010-85566032 GGACAAATGGGGAAAAAACCAGG - Intergenic
1045474977 8:102545019-102545041 TATAAAATGGGGATCATAACTGG + Intergenic
1045570838 8:103367896-103367918 TATTAAATGGAAAAAAAACCTGG - Intergenic
1048484557 8:134834615-134834637 TATCAAGAGGGGAACAATACTGG - Intergenic
1049237713 8:141520570-141520592 AATCAAATAGGAAACAAACACGG + Intergenic
1049481923 8:142829177-142829199 TATCACATGGGGAGAAACCCTGG - Intergenic
1050972019 9:11889878-11889900 GATCAAATGGGTTTCAAACCAGG - Intergenic
1058459689 9:105171593-105171615 TAGCAAATGGGAAACAAATGGGG + Intergenic
1061175632 9:128994775-128994797 TATCAAACAGGGAACAGAGCAGG - Intronic
1186554385 X:10542053-10542075 TTTAAAATGGTTAACAAACCTGG + Intronic
1188973906 X:36650734-36650756 TTTCCAACGGGGAACACACCCGG + Intergenic
1189098886 X:38168672-38168694 TGCCAAATGCAGAACAAACCTGG + Intronic
1190833159 X:54077394-54077416 TTTAAAATGGGGAACAGGCCAGG + Intronic
1193540940 X:82771770-82771792 GATCAAATGGGTATCATACCAGG - Intergenic
1193590053 X:83378085-83378107 TATCAAATGGGTTTCATACCAGG - Intergenic
1197635599 X:128911585-128911607 TTTCAACTGGGTAACAAAACAGG + Intergenic
1198377900 X:136057461-136057483 TATCAAATAAAGCACAAACCAGG + Intergenic