ID: 1143736683

View in Genome Browser
Species Human (GRCh38)
Location 17:8916220-8916242
Sequence GAGCGTGTCAAAGGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143736683 Original CRISPR GAGCGTGTCAAAGGGGTGGG TGG (reversed) Intronic
900363790 1:2302294-2302316 GAGCGAGGCAAAGGTGTGTGTGG + Intronic
900601653 1:3505348-3505370 GGGCGTGAGAGAGGGGTGGGTGG + Intronic
901752851 1:11422127-11422149 CAGCATGGCAGAGGGGTGGGAGG - Intergenic
902597999 1:17522137-17522159 GGGCGTGGCAGAGGGGTGGGAGG + Intergenic
903534660 1:24058958-24058980 GATCGTGCCAAAGTGGTGAGAGG - Exonic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906198965 1:43947274-43947296 GAGGGAGTCACAGGGGAGGGAGG - Exonic
908624078 1:66020466-66020488 GGGCCTGTCCATGGGGTGGGGGG - Intronic
919505543 1:198393510-198393532 GGGCTTGTCGAGGGGGTGGGAGG + Intergenic
920455409 1:206097430-206097452 CAGCATGTGAAAGGGGTAGGTGG - Intronic
922802599 1:228371206-228371228 GAGTGTGTCACCGGGGAGGGTGG - Exonic
924270297 1:242325416-242325438 GAGCGAGAGAAAGGGGTGGGGGG + Intronic
924437451 1:244054828-244054850 GAGCGTGTCCAGGTGGAGGGAGG + Exonic
1063291302 10:4752483-4752505 GGGCCTGTCGAGGGGGTGGGGGG + Intergenic
1063860973 10:10307434-10307456 GAAAGTGTGAAAGGGATGGGGGG - Intergenic
1064153861 10:12887502-12887524 GATCCTGTCAAAGGGAGGGGAGG + Intergenic
1064288425 10:14012483-14012505 CAGGGTGTGAAAGGGGTGGCGGG + Intronic
1066187015 10:33019988-33020010 GGGCCTGTCACGGGGGTGGGGGG - Intergenic
1067082417 10:43219174-43219196 GAGCGAGGCCAAGGGGAGGGGGG - Intronic
1067725604 10:48768405-48768427 GAGCCTTTCAAAAGGTTGGGGGG - Intronic
1068274303 10:54773087-54773109 GGGCCTGTCCAAGGGGTGGGGGG + Intronic
1070659342 10:78293554-78293576 GAGCCAGTCAAAGGGGGAGGGGG - Intergenic
1072028691 10:91494190-91494212 GAAAGTATAAAAGGGGTGGGGGG + Intronic
1072288058 10:93935679-93935701 GAGAGTGTGAAAAGGGTGGAAGG + Intronic
1073191153 10:101651327-101651349 GAGGGTGGGAAATGGGTGGGGGG + Intronic
1073447322 10:103589495-103589517 GAGCCTGTGAAAGGGGAGGGAGG - Exonic
1074722438 10:116274169-116274191 GAGCGTGTGTCAGGCGTGGGGGG - Intergenic
1076023063 10:127090039-127090061 GAGCTTGTTTAAGGGGTGGGAGG + Intronic
1077408705 11:2393723-2393745 GAGCGGGTGAAGGCGGTGGGTGG + Intronic
1077757356 11:5047023-5047045 GAGCCTGACAAAAGGGTAGGCGG - Exonic
1078036265 11:7808114-7808136 TAGTGTGTCGATGGGGTGGGGGG + Intergenic
1078950015 11:16120110-16120132 GAGAGAGAGAAAGGGGTGGGGGG - Intronic
1079408355 11:20164087-20164109 GTGAGTGTGAAAGGGATGGGGGG - Intergenic
1079923501 11:26461430-26461452 GAAGGTGTGAAAGGAGTGGGGGG - Intronic
1081547383 11:44081086-44081108 GGGGGTGTCAGAAGGGTGGGAGG + Intronic
1082029347 11:47593608-47593630 GAGCAGGTCAGAGGTGTGGGAGG + Intronic
1083185509 11:61015669-61015691 GGGCATGGCAAAGTGGTGGGCGG - Intronic
1083938459 11:65882545-65882567 GCGCGTGTGACAGGGGAGGGAGG + Intronic
1084857434 11:71998027-71998049 GAGCCTGACAGGGGGGTGGGGGG - Intergenic
1087719817 11:101650252-101650274 GGGCCTGTCGGAGGGGTGGGGGG + Intronic
1087888334 11:103506439-103506461 GAGCCTGTCATGGGGTTGGGGGG + Intergenic
1088732209 11:112693648-112693670 GAACCAGTCACAGGGGTGGGGGG - Intergenic
1089162870 11:116452913-116452935 GAGCATGTCTCCGGGGTGGGTGG - Intergenic
1089379321 11:118016207-118016229 GAGCTTTGCAAAGGGGTGGGGGG - Intergenic
1096482383 12:51951500-51951522 GTCCCTGTTAAAGGGGTGGGCGG - Intergenic
1096569126 12:52509860-52509882 GGGCCTATCAAAGGGGTTGGGGG - Intergenic
1101847177 12:108372007-108372029 GAGCTGATTAAAGGGGTGGGTGG - Intergenic
1102645478 12:114400924-114400946 GAGTGTGTGAAGGGGGAGGGTGG - Intronic
1103428261 12:120857807-120857829 GAGCCTGTCACAGGGGTGGGTGG + Intronic
1103583696 12:121935636-121935658 GAGTGTGTCAAAAGGCTGGTAGG - Intronic
1106120961 13:26859879-26859901 GAGGGTGGCAAAGAGTTGGGTGG - Intergenic
1107842339 13:44471993-44472015 CAGCGTGTCAAAGTGATTGGAGG + Intronic
1108336306 13:49444770-49444792 GAGGTTGTCAAAGGGGCGGCAGG + Exonic
1110398814 13:75065719-75065741 GGGCCTGTCAGAGGGTTGGGGGG - Intergenic
1111053129 13:82912454-82912476 GGGCCTGTCACAGGGTTGGGGGG + Intergenic
1111642243 13:90983080-90983102 GGGCCTGTCAAAGGGGTGAGTGG + Intergenic
1113851426 13:113420874-113420896 GAGCGGGTCCCGGGGGTGGGCGG - Intergenic
1117616485 14:57538967-57538989 GGGCCTGTCAGAGGGATGGGGGG - Intergenic
1118800192 14:69182690-69182712 GACCCTGTCAGAGAGGTGGGGGG - Intergenic
1119738742 14:77000258-77000280 GAGGGAGGCACAGGGGTGGGTGG + Intergenic
1121723788 14:96131188-96131210 GAGGGTGTCAAAGTAGGGGGAGG + Intergenic
1122381510 14:101310236-101310258 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1202841572 14_GL000009v2_random:125942-125964 GTGCGTGTGAAACGGGTGTGGGG + Intergenic
1202910960 14_GL000194v1_random:116174-116196 GTGCGTGTGAAACGGGTGTGGGG + Intergenic
1202934537 14_KI270725v1_random:74171-74193 GCGCCTGTCAGGGGGGTGGGAGG - Intergenic
1125104002 15:35949639-35949661 GGGCCTGTCATGGGGGTGGGGGG + Intergenic
1129248678 15:74296056-74296078 GAGTGTGCCTAAGGGGAGGGAGG - Intronic
1132893062 16:2214069-2214091 GACCGGGTCAAAGGGCAGGGAGG + Intronic
1134418056 16:14061727-14061749 GAGAGAGTCAAAGGAGGGGGAGG + Intergenic
1134910015 16:18017273-18017295 GGGCCTGTCAGAGGGTTGGGGGG - Intergenic
1139657562 16:68398055-68398077 GAGGGAGTCCAAGAGGTGGGTGG + Intronic
1140319570 16:73935962-73935984 GGGTCTGTCAAAGGGTTGGGGGG + Intergenic
1143333468 17:6155383-6155405 GAGAGCCTCAGAGGGGTGGGTGG - Intergenic
1143736683 17:8916220-8916242 GAGCGTGTCAAAGGGGTGGGTGG - Intronic
1147278159 17:39336104-39336126 GAGCCTGTCAGAGGGGGGAGGGG + Intronic
1151282532 17:73087668-73087690 GAGCGTGTAGAAGGGGTGTAAGG + Intronic
1155929543 18:31690978-31691000 GAGCCTGTCAGTGGGGTGGGGGG + Intergenic
1156467365 18:37356344-37356366 GAGAGTGACAAAAGGGTGGGGGG + Intronic
1157527465 18:48395309-48395331 GTGTGTGTCAGAGGGGTTGGGGG + Intronic
1157527473 18:48395395-48395417 GTGTGTGTCAGAGGGGTTGGGGG + Intronic
1157527481 18:48395487-48395509 GTGTGTGTCAGAGGGGTTGGGGG + Intronic
1158309072 18:56139529-56139551 CAGCCTGTCAGTGGGGTGGGAGG + Intergenic
1161088118 19:2344314-2344336 GAGCGTGGTGATGGGGTGGGGGG - Intronic
1164433485 19:28208288-28208310 GACCATGTCAAAGGTGGGGGTGG + Intergenic
1164840572 19:31389622-31389644 GAGAATGGCAATGGGGTGGGGGG - Intergenic
1165779589 19:38424605-38424627 GTGTGTGTCAATGGGGGGGGGGG + Intronic
1166885638 19:45959439-45959461 GGGTGTGTCAATGGGCTGGGAGG + Intronic
1167709804 19:51103762-51103784 CAGATTGCCAAAGGGGTGGGAGG - Intronic
1167850022 19:52194346-52194368 GAGAATGGCAAAGTGGTGGGAGG + Intronic
1168570076 19:57459369-57459391 GAATATGTCAAAGGGGTCGGGGG - Intronic
924964985 2:67813-67835 GTGCGTGACACAGGGGTGAGCGG - Intergenic
926807751 2:16727059-16727081 AACAGGGTCAAAGGGGTGGGAGG + Intergenic
927897336 2:26792259-26792281 GAGGGTGGCATAGGGGTTGGTGG - Intronic
929411279 2:41699395-41699417 GAGCGTATCTAAGGGCGGGGAGG + Intergenic
930085772 2:47496065-47496087 GAGCATGTCAAGGTGCTGGGAGG - Intronic
933776977 2:85776968-85776990 GTGCGTGTGGAGGGGGTGGGTGG - Intronic
934464908 2:94253229-94253251 GGGCCTGTCAGGGGGGTGGGAGG - Intergenic
934577981 2:95414970-95414992 GAGTGTGTGAGAGGGGTGGAGGG - Exonic
934836689 2:97596180-97596202 GGGCCTGTCAATGGGGTGAGGGG - Intergenic
934877880 2:97942315-97942337 GGTCCTGTCAATGGGGTGGGGGG + Intronic
934891838 2:98077624-98077646 GGTCCTGTCAATGGGGTGGGGGG + Intergenic
935373845 2:102375406-102375428 GAGGGTGTCAAAGGTGTGGGTGG + Intronic
937492023 2:122379823-122379845 GGGCTTGTCAGGGGGGTGGGGGG - Intergenic
938675540 2:133629971-133629993 GGGCCTGTCGAGGGGGTGGGAGG + Intergenic
939617354 2:144376367-144376389 AAGGGTGTCAAGGGGGTGAGAGG + Intergenic
942138712 2:172955812-172955834 GAGCGAGTGAGAGGGCTGGGTGG + Intronic
946707219 2:222470104-222470126 GGGCCTGTCAGCGGGGTGGGGGG + Intronic
1171878380 20:30598746-30598768 GTGGGTGTCCCAGGGGTGGGTGG - Intergenic
1172177413 20:32980668-32980690 GAGTGTGGGGAAGGGGTGGGTGG + Intergenic
1173941377 20:46913987-46914009 CAGAGTGGTAAAGGGGTGGGAGG - Intronic
1174978042 20:55356755-55356777 GGGCCTGTTAGAGGGGTGGGGGG + Intergenic
1175309617 20:58002686-58002708 GGGCCTGTCAGGGGGGTGGGGGG + Intergenic
1176426570 21:6552424-6552446 GAGGGTGGAGAAGGGGTGGGAGG - Intergenic
1176595943 21:8696376-8696398 GGGCCTGTCAGGGGGGTGGGAGG - Intergenic
1176630313 21:9130871-9130893 GTGCGTGTGAAACGGGTGTGGGG + Intergenic
1177571086 21:22888098-22888120 GAGCATGTCAAAGGGATAGGGGG + Intergenic
1179702061 21:43160746-43160768 GAGGGTGGAGAAGGGGTGGGAGG - Intronic
1180586062 22:16892356-16892378 GGGCCTGTCAAGGGGGTGGGAGG - Intergenic
1180880023 22:19197105-19197127 GAGAGTGTCAGAGGCGTGTGGGG - Intronic
1183373701 22:37450002-37450024 CAGCTTCTCCAAGGGGTGGGGGG - Intergenic
1183693014 22:39401729-39401751 GTGCGTGGCAAAGGGATGGCAGG + Intronic
1183829187 22:40409021-40409043 GAGTGTGGAAAAGGGGTTGGAGG + Intronic
1185304100 22:50103027-50103049 GAGCGGGTCACAGGTGTGGCGGG + Intronic
1185409824 22:50675974-50675996 GAGAGTGCCAGAGGGGTGTGTGG + Intergenic
950698954 3:14726875-14726897 GAGAGGGGCAAAGGGGAGGGCGG - Intronic
951626733 3:24673190-24673212 GAGAGAGAGAAAGGGGTGGGGGG + Intergenic
951889165 3:27552713-27552735 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
952791881 3:37206601-37206623 GAAAGTGGAAAAGGGGTGGGAGG - Intergenic
957768677 3:84659293-84659315 GAGCAAGACCAAGGGGTGGGGGG - Intergenic
959326524 3:104944523-104944545 GAGTGGGTCAATGGTGTGGGGGG + Intergenic
960418001 3:117409079-117409101 GAGCATGACAAAGGGTGGGGTGG - Intergenic
962471166 3:135710651-135710673 GAATGTGGCAGAGGGGTGGGAGG - Intergenic
963882666 3:150546158-150546180 GAGCGAGTCCGAGGGGTGGCCGG - Exonic
964176322 3:153828382-153828404 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
964252591 3:154735814-154735836 GAGCCTGTCATAGGGTTAGGGGG - Intergenic
964941190 3:162158910-162158932 GAGAGTGGAAAAGGGGTGGGAGG + Intergenic
964941309 3:162159285-162159307 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
965674998 3:171185209-171185231 GTGTGTGTCTATGGGGTGGGAGG + Intronic
965783032 3:172307822-172307844 GAGTTGGGCAAAGGGGTGGGAGG + Intronic
967471358 3:189865526-189865548 GAGGGTGCCAAAGGTGTTGGGGG + Intronic
968628558 4:1638663-1638685 GGGAGTGTCGGAGGGGTGGGGGG + Intronic
969594282 4:8140092-8140114 GGGCCTGTCAGAGGGGTGGGGGG + Intronic
970173026 4:13308104-13308126 GAGCAAGTACAAGGGGTGGGAGG - Intergenic
973922303 4:55700349-55700371 GGGCCTGCCAAGGGGGTGGGGGG + Intergenic
974310862 4:60208769-60208791 GAGAGAGTCAGAAGGGTGGGGGG + Intergenic
978234699 4:106444854-106444876 GTGCGTGTGAAGGTGGTGGGAGG + Intergenic
983237075 4:165191762-165191784 GAGCTAGTCTCAGGGGTGGGAGG + Intronic
984300899 4:177916511-177916533 GGGCCTGTCAGTGGGGTGGGGGG - Intronic
984638633 4:182140999-182141021 AAGCCTCTCAAAGGGCTGGGGGG - Intergenic
985951062 5:3221644-3221666 GAGCAGGGCAGAGGGGTGGGTGG + Intergenic
986223006 5:5787375-5787397 GAGCCTGTGAACTGGGTGGGAGG - Intergenic
986469740 5:8061859-8061881 GAGGGTGTGTAAGGGGTGTGGGG - Intergenic
989795832 5:45471221-45471243 GCGTGTGTTCAAGGGGTGGGAGG + Intronic
991290117 5:65025444-65025466 GAGCGTGTGGGAGGGGTGGCTGG - Intergenic
992163150 5:74021973-74021995 GGGCCTGTCAGTGGGGTGGGGGG - Intergenic
994536734 5:101040345-101040367 GGGCCTGTCAGGGGGGTGGGGGG + Intergenic
995320032 5:110824034-110824056 GAGAGTGACTAGGGGGTGGGTGG - Intergenic
996877162 5:128252399-128252421 GACCTTGTCCAAGGAGTGGGTGG - Intergenic
997723462 5:136100008-136100030 GAGTCTGTCAAATGGGAGGGGGG - Intergenic
998161841 5:139817366-139817388 GAGCAGGTCTAGGGGGTGGGTGG + Intronic
998540812 5:142979809-142979831 GGGCGTGCCAGAGGGGAGGGCGG + Intronic
999149915 5:149420068-149420090 TGGGGTGTCAAGGGGGTGGGAGG + Intergenic
1003143988 6:3494286-3494308 GAGCCTGTGAAAGGGGCTGGGGG - Intergenic
1006096799 6:31661164-31661186 GAGCAAGACAAGGGGGTGGGTGG + Intergenic
1006780529 6:36629360-36629382 GAGCGTGTGGAAAGGGTTGGGGG + Intergenic
1007348034 6:41247832-41247854 CTGCCTGTGAAAGGGGTGGGAGG + Intergenic
1008541204 6:52547730-52547752 CAGGGTGCCAAAGGGGTGGAGGG + Intronic
1008867286 6:56228052-56228074 GAGAGTGGGAAAGGGGTGAGGGG + Intronic
1010475337 6:76280131-76280153 AGACCTGTCAAAGGGGTGGGGGG - Intergenic
1011901214 6:92301132-92301154 GAGCATGTGAAGGGGGTGGCAGG - Intergenic
1016614759 6:146033166-146033188 GAGCCTGTCAAGGGGGAGGCAGG + Intronic
1016890949 6:149006240-149006262 GGGCGTGTCAGTGGGGTTGGGGG - Intronic
1018077421 6:160229611-160229633 AAAAGTGTAAAAGGGGTGGGAGG - Intronic
1022977790 7:35574924-35574946 GAGCGTGTCTCAGGGGAGTGTGG - Intergenic
1023289148 7:38651201-38651223 GGGCCTGTCATGGGGGTGGGGGG + Intergenic
1026228512 7:68463177-68463199 GAGTGCGTCATGGGGGTGGGAGG - Intergenic
1026261554 7:68759895-68759917 GAGCCTGCCAAAGGGATGAGTGG - Intergenic
1028633661 7:92963027-92963049 GTGTGTGTCATGGGGGTGGGGGG + Intergenic
1028767689 7:94578552-94578574 GAGACTGGCAAATGGGTGGGGGG - Intergenic
1029010072 7:97250449-97250471 GAGCCTGTCAGAGGGGCAGGGGG - Intergenic
1029424149 7:100486192-100486214 GAGGGTGGCAGAGGGTTGGGGGG - Intronic
1029941556 7:104485771-104485793 AGGCCTGTCAGAGGGGTGGGAGG - Intronic
1030935338 7:115579147-115579169 GAGTGTGTGAATGGGGTGTGTGG - Intergenic
1031911559 7:127522075-127522097 GGGCCTGTCAGAGGGGTGGGGGG + Intergenic
1033438401 7:141355276-141355298 AAGGGAGTCAAAGGGGTGGATGG + Intronic
1035770379 8:2142599-2142621 GAGGGTGTCCAAGGGGTGACGGG - Intronic
1035797419 8:2371105-2371127 GAGGGTGTCAGAGCGGTAGGAGG + Intergenic
1037091967 8:14930819-14930841 GGGCTTGTCAGAGGGGTGAGGGG + Intronic
1037548233 8:19944455-19944477 GAGAGAGAGAAAGGGGTGGGGGG + Intronic
1038941409 8:32309830-32309852 AAGAGTGTCACAGAGGTGGGAGG - Intronic
1044411654 8:91890579-91890601 GGGCCTGTCAGGGGGGTGGGGGG + Intergenic
1046368875 8:113273509-113273531 CAGCTTGGCAAAGGGATGGGTGG - Intronic
1047623479 8:126632598-126632620 GGGCCTGTCAGAGGGTTGGGGGG - Intergenic
1049316258 8:141970210-141970232 GAGTGAGCCACAGGGGTGGGGGG - Intergenic
1049319510 8:141988532-141988554 GAGAGTGGGAAAGGGGAGGGAGG - Intergenic
1049756718 8:144314092-144314114 GGGGGTGTCAAGGCGGTGGGGGG - Intronic
1051112076 9:13650752-13650774 GAGCCTGTCAAGGGGGTGGGAGG - Intergenic
1051669924 9:19499303-19499325 GGGCCTGTCGGAGGGGTGGGGGG - Intergenic
1052165369 9:25319790-25319812 GGGCCTGTCAGGGGGGTGGGGGG - Intergenic
1052801900 9:32976218-32976240 GGGCCTGTCAGGGGGGTGGGGGG + Intronic
1053113794 9:35484611-35484633 GAATGTGTCATGGGGGTGGGTGG - Intergenic
1053694987 9:40629958-40629980 GGGCTTGTCAGGGGGGTGGGAGG - Intergenic
1054269854 9:63010152-63010174 GGGCTTGTCAGGGGGGTGGGAGG + Intergenic
1054306231 9:63429183-63429205 GGGCTTGTCAGGGGGGTGGGAGG - Intergenic
1054404973 9:64753179-64753201 GGGCTTGTCAGGGGGGTGGGAGG - Intergenic
1054438598 9:65238667-65238689 GGGCTTGTCAGGGGGGTGGGAGG - Intergenic
1054491806 9:65783279-65783301 GGGCTTGTCAGGGGGGTGGGAGG + Intergenic
1054729949 9:68691418-68691440 GAGAGTGTGAAAGTAGTGGGTGG - Intergenic
1055344587 9:75321859-75321881 GAGCCTGTCAGAGGGTTGGGGGG - Intergenic
1056561981 9:87738546-87738568 GGGCCTGTCAGGGGGGTGGGAGG + Intergenic
1062378888 9:136277302-136277324 GTGGGTGTGAACGGGGTGGGTGG + Intergenic
1203753145 Un_GL000218v1:98556-98578 GTGCGTGTGAAACGGGTGTGGGG + Intergenic
1189326873 X:40117987-40118009 GAGGGAGGAAAAGGGGTGGGGGG - Intronic
1190690480 X:52909361-52909383 GAGGGTTTCAAAGGGGTTCGAGG + Intergenic
1190695503 X:52946431-52946453 GAGGGTTTCAAAGGGGTTCGAGG - Intronic
1195291409 X:103434343-103434365 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195291423 X:103434381-103434403 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195291437 X:103434419-103434441 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195291451 X:103434457-103434479 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1196741091 X:119026700-119026722 GGGCCTGTCAGAGGGGTGGTGGG + Intergenic
1198543870 X:137671009-137671031 GTGCCTCTCAAAGGGGTTGGGGG - Intergenic
1201166791 Y:11216125-11216147 GTGCGTGTGAAATGGGTGTGGGG + Intergenic