ID: 1143739995

View in Genome Browser
Species Human (GRCh38)
Location 17:8945459-8945481
Sequence CTGGTGACCCAGAGAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 347}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143739993_1143739995 -3 Left 1143739993 17:8945439-8945461 CCTTCATAAGCGAGGCTTCACTG 0: 1
1: 0
2: 1
3: 2
4: 102
Right 1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG 0: 1
1: 0
2: 5
3: 37
4: 347
1143739988_1143739995 18 Left 1143739988 17:8945418-8945440 CCTGGCAGCCCCTTGGCTACTCC 0: 1
1: 0
2: 0
3: 21
4: 239
Right 1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG 0: 1
1: 0
2: 5
3: 37
4: 347
1143739990_1143739995 9 Left 1143739990 17:8945427-8945449 CCCTTGGCTACTCCTTCATAAGC 0: 1
1: 0
2: 2
3: 15
4: 140
Right 1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG 0: 1
1: 0
2: 5
3: 37
4: 347
1143739984_1143739995 25 Left 1143739984 17:8945411-8945433 CCCTCCACCTGGCAGCCCCTTGG 0: 1
1: 0
2: 2
3: 35
4: 328
Right 1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG 0: 1
1: 0
2: 5
3: 37
4: 347
1143739989_1143739995 10 Left 1143739989 17:8945426-8945448 CCCCTTGGCTACTCCTTCATAAG 0: 1
1: 0
2: 2
3: 7
4: 118
Right 1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG 0: 1
1: 0
2: 5
3: 37
4: 347
1143739991_1143739995 8 Left 1143739991 17:8945428-8945450 CCTTGGCTACTCCTTCATAAGCG 0: 1
1: 0
2: 0
3: 11
4: 76
Right 1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG 0: 1
1: 0
2: 5
3: 37
4: 347
1143739986_1143739995 24 Left 1143739986 17:8945412-8945434 CCTCCACCTGGCAGCCCCTTGGC 0: 1
1: 0
2: 4
3: 41
4: 376
Right 1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG 0: 1
1: 0
2: 5
3: 37
4: 347
1143739987_1143739995 21 Left 1143739987 17:8945415-8945437 CCACCTGGCAGCCCCTTGGCTAC 0: 1
1: 0
2: 2
3: 18
4: 230
Right 1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG 0: 1
1: 0
2: 5
3: 37
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143739995 Original CRISPR CTGGTGACCCAGAGAGAGCC TGG Intronic
900226169 1:1534555-1534577 CTGGTGACCCTGAGAGAGGAGGG + Exonic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
901237934 1:7677525-7677547 CTGGTGAACCACACAGGGCCTGG - Intronic
901873633 1:12153259-12153281 CTGCTGCCCCAGTGAGAGCTGGG - Intergenic
902360745 1:15941463-15941485 CAGGCAACCCAGAGCGAGCCTGG - Intergenic
902922711 1:19676612-19676634 CTGGAGGCCTAGAAAGAGCCGGG + Intronic
903050052 1:20593968-20593990 CTGGACACCCAGAGGAAGCCTGG + Intronic
903318498 1:22527240-22527262 CATATGACCCAGAGGGAGCCAGG - Exonic
903557839 1:24206315-24206337 CGGGAGACCCAGAGCCAGCCTGG - Intergenic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
904388728 1:30164902-30164924 CTGCTGACCCACTCAGAGCCTGG - Intergenic
904483643 1:30809696-30809718 ATAATGACTCAGAGAGAGCCTGG - Intergenic
904852631 1:33470472-33470494 GTGCTGAACCAGAGAGAACCTGG + Intergenic
905236703 1:36554964-36554986 CTGGTGAGATAGAGAGAGACAGG - Intergenic
905923011 1:41731578-41731600 CTGGGGTCCAAGAGAGAGCAAGG - Intronic
907944650 1:59124310-59124332 ATGGTGACCCAGACAGAGCCAGG - Intergenic
908403375 1:63791231-63791253 ATGGTGACACAGTGAGAGTCTGG + Intronic
910158229 1:84244632-84244654 CTGGTGTCCCAGAGAGTGAGAGG - Intergenic
912006662 1:104911486-104911508 CTGGTGACCAAGAGTGACCAAGG + Intergenic
912530273 1:110315752-110315774 CTGGTGAGGCAGAGAGATACTGG + Intergenic
913070577 1:115294824-115294846 CTGGAGAGCCAGGAAGAGCCAGG + Intronic
915087377 1:153397772-153397794 CTGGTTACCCAGAGAGGAGCTGG + Intergenic
915476261 1:156154511-156154533 CTGCTCACCCAGAAAGTGCCCGG + Intronic
916118433 1:161507603-161507625 CTGCTGTACCAGAGAGATCCTGG + Intronic
916990731 1:170241697-170241719 CTGATGGCTAAGAGAGAGCCTGG - Intergenic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
919075365 1:192807290-192807312 CAGGAGACCCAGTTAGAGCCTGG - Intergenic
919779683 1:201213887-201213909 CTGGTAACCCACAGAGAGTTGGG - Intronic
919944903 1:202311953-202311975 CTGCTGGCCCAGAGCCAGCCAGG - Intronic
920028963 1:203024590-203024612 CTGTTCACACAGAGTGAGCCTGG + Exonic
920234589 1:204494433-204494455 CTGGAGCCGCAGAGCGAGCCCGG - Intronic
921555277 1:216591341-216591363 GTGGTGTGCCAGAGAGAGCATGG + Intronic
922157654 1:223052650-223052672 GTGGTGCCCCAGAGAGTGGCCGG - Intergenic
922566041 1:226602400-226602422 CTGCTCACCCAGACAGGGCCCGG - Exonic
923471426 1:234294318-234294340 CTGCTGGCCGAGACAGAGCCAGG - Intronic
924140038 1:241012747-241012769 AGGGGGACTCAGAGAGAGCCTGG - Intronic
1063291039 10:4749180-4749202 TTGGTCCCCCACAGAGAGCCAGG - Intergenic
1063559738 10:7114755-7114777 CTGGGGGCCCACAGTGAGCCAGG - Intergenic
1063666336 10:8062813-8062835 CTGGGTGCCCAGAGAAAGCCAGG - Intronic
1065450853 10:25855465-25855487 CTGATGAGCCAGAGACAGCAGGG + Intergenic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1068798671 10:61114348-61114370 ATAGTGACCCAGAGGGTGCCTGG + Intergenic
1069997184 10:72349594-72349616 CTGGTGGCCCAGGCTGAGCCTGG + Intronic
1070168725 10:73916553-73916575 CTGGGGACCCTCAGAGGGCCAGG - Exonic
1070520693 10:77250531-77250553 CTGGTGCTCCAGAGTGAGCCTGG - Intronic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1073440641 10:103550529-103550551 CAGGTGACCCAGACAGACACTGG - Intronic
1074900489 10:117812387-117812409 CTGGTTACTCAGAGAAATCCAGG - Intergenic
1074912665 10:117925601-117925623 CTGGTGGCCCAGAGAGTGGGAGG - Intergenic
1075311774 10:121420331-121420353 CTTGTGAGCTAGTGAGAGCCAGG - Intergenic
1075517494 10:123120280-123120302 CTGGTGACTCGCAGAGGGCCTGG + Intergenic
1075546924 10:123362160-123362182 CTTGTGTCCCAGAGGGAGCTTGG + Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076179377 10:128394892-128394914 ATGATAGCCCAGAGAGAGCCTGG - Intergenic
1076290825 10:129344190-129344212 CTCGTGGCCCAGACACAGCCAGG - Intergenic
1076516578 10:131048544-131048566 TTAGGGACACAGAGAGAGCCAGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1077201338 11:1309132-1309154 ATGGTGCCCCAGAGGGAGGCAGG - Intronic
1077468705 11:2746815-2746837 CTGGGGCCCTAGAGAGACCCTGG + Intronic
1079009402 11:16815997-16816019 CTGGGGACCCAGTGACAGCCAGG + Intronic
1079030099 11:16980364-16980386 CTGGTCCCACAGAGAGAGCCTGG + Intronic
1079156971 11:17956943-17956965 CTCGAGGCCAAGAGAGAGCCAGG - Intronic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1083057533 11:59837333-59837355 CAGGTGTTACAGAGAGAGCCTGG + Exonic
1083662701 11:64259143-64259165 CAGGTGGCCCAGACAGCGCCGGG + Exonic
1083696823 11:64448906-64448928 ATGGTGTCCCAGGGAGGGCCGGG - Intergenic
1083926433 11:65809755-65809777 GGGGTGACCCCGAGAGAGACTGG - Intergenic
1084561710 11:69909309-69909331 ATGGTGACCCAGAGAGGAGCTGG - Intergenic
1084671472 11:70609123-70609145 CGGGCGGCCCAGAGAGGGCCTGG + Intronic
1084930634 11:72553012-72553034 CAGGTGACCCAGTCAGAACCTGG - Intergenic
1085400046 11:76230468-76230490 CTGGGGACCCCCAGAGAGCAGGG - Intergenic
1086280996 11:85188269-85188291 GGGGTGACCCATAGAAAGCCAGG + Intronic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1088783234 11:113156363-113156385 ATGGTGACCCAAAGACAGCAAGG + Intronic
1089111668 11:116062359-116062381 CAGATGACTCAGAGAGAGCTGGG - Intergenic
1089867462 11:121644081-121644103 CTGGTGAGCCAGAGATAACGAGG - Intergenic
1090196348 11:124820240-124820262 CTAGTGTACCAGAGAGAACCAGG - Intergenic
1091194673 11:133720636-133720658 CTAGTGACCCAGGCAAAGCCAGG - Intergenic
1092181968 12:6452284-6452306 CTGCTGCTCCAGATAGAGCCAGG - Exonic
1092508011 12:9124522-9124544 CCACTGAGCCAGAGAGAGCCCGG + Intergenic
1096245785 12:49985003-49985025 CAGATGACCCAGAAAGAGCAGGG - Intronic
1096413633 12:51394182-51394204 CTGGTGCTCCTGAGAGGGCCGGG + Intronic
1097314645 12:58159208-58159230 TTGGATCCCCAGAGAGAGCCCGG + Intergenic
1097643084 12:62205440-62205462 CTGCTGACCCAGAGAGACTTTGG + Intronic
1101305352 12:103522420-103522442 CTGGTGTTACAGAGAGGGCCGGG - Intergenic
1101592926 12:106139282-106139304 CTGGCGAGCCCGAGAGCGCCCGG - Exonic
1102605305 12:114063875-114063897 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605354 12:114064019-114064041 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605452 12:114064380-114064402 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605462 12:114064416-114064438 CTGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605480 12:114064488-114064510 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1102606619 12:114072758-114072780 CTGGTAACCCAGAGTGAGCCAGG - Intergenic
1102857001 12:116302708-116302730 CTGAAGAACTAGAGAGAGCCAGG + Intergenic
1102929650 12:116852397-116852419 CTGGGTACCAGGAGAGAGCCAGG - Intronic
1103198001 12:119062273-119062295 CTGGTGAGCCAGGGAGAGAATGG + Intronic
1103823573 12:123717946-123717968 CAGGTGACACAGTGAGACCCTGG - Intronic
1103919119 12:124390317-124390339 CGAGTGACCCAGAGAGAGGCTGG - Intronic
1104251896 12:127102584-127102606 ATGCTGAACCAGAGAGAGACAGG + Intergenic
1104601990 12:130161066-130161088 ATCGTGACCCGGAGAGACCCTGG + Intergenic
1104908714 12:132229273-132229295 CTGGTGACCCAGGGCGAGATGGG - Intronic
1105029499 12:132872956-132872978 CTGCTGACCCAGGGACAGACAGG + Intronic
1112626061 13:101105785-101105807 CTGGCAATCAAGAGAGAGCCAGG + Intronic
1114579978 14:23748462-23748484 CTGGGAACCCACAGAGATCCAGG - Intergenic
1118076850 14:62308774-62308796 CAGGTGACACAGAGAAAGCATGG + Intergenic
1118499720 14:66347810-66347832 CTGGTAACCAAAAGAGAGCAAGG + Intergenic
1121087479 14:91157531-91157553 ATGGTGACCCACAGTGTGCCAGG - Intronic
1121491305 14:94363371-94363393 CGGGTCACCCAGAGAGAGCCAGG - Intergenic
1122151050 14:99726442-99726464 CTGGAGAGCCTGTGAGAGCCTGG - Intronic
1122346768 14:101065761-101065783 CTGGTCACCGAGAGTGGGCCGGG + Intergenic
1122363413 14:101180776-101180798 GGGGTGACCCAGAGGGAGCAGGG - Intergenic
1122797356 14:104212680-104212702 CTGGAGGCCCAGAGAGGACCCGG + Intergenic
1122884696 14:104705802-104705824 CTGGTGACCCGGGGGCAGCCTGG + Intronic
1122905172 14:104798256-104798278 CTGGCGGGACAGAGAGAGCCTGG - Intergenic
1123995195 15:25713317-25713339 CTGGTGCAGCAGAGAGATCCAGG - Intronic
1124996192 15:34725112-34725134 CTGTTGATCCAGAGTGAGTCTGG - Intergenic
1125077196 15:35633252-35633274 GAGGTGTCCCACAGAGAGCCTGG + Intergenic
1125832840 15:42728733-42728755 CTGGTGACACAGGGAGAGGAAGG - Exonic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1128520141 15:68369759-68369781 CTGGTGCCCCAGAGTGGGTCAGG + Intronic
1128708638 15:69855779-69855801 CTGGTTCCCCAGGGAGACCCAGG + Intergenic
1128733839 15:70039365-70039387 CTGGTGACTCAAAGGGGGCCTGG - Intergenic
1128767946 15:70262473-70262495 CTGGAGAGCTGGAGAGAGCCAGG + Intergenic
1130094567 15:80846312-80846334 TTACTGACCCAGAGAGAGACGGG - Intronic
1130225615 15:82056293-82056315 CTGGCCACACAGAGAGAGGCGGG + Intergenic
1130651417 15:85764131-85764153 CTGGTGACCCAGGGAAGGCCAGG + Intronic
1130983111 15:88826476-88826498 CTGGAGACACAGGGAAAGCCAGG + Intronic
1132392204 15:101447275-101447297 CAGGTGACCCTGCGTGAGCCTGG - Intronic
1132544055 16:524940-524962 GTGGTGGCCCAGAGAAAGGCGGG + Intergenic
1132592884 16:734004-734026 CTGCTCACCCAGAGGCAGCCAGG - Intronic
1132593226 16:735588-735610 CTGGTGTCCCAGGGAAAACCTGG - Intronic
1132656994 16:1045562-1045584 CTGGGGGCCCAGGGAGCGCCAGG + Intergenic
1132973838 16:2701847-2701869 CTGGTGACCCGGAGGGAGGCAGG + Intronic
1133309333 16:4833413-4833435 CTGTTGATCCACAGAGAGTCAGG + Intronic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1138035462 16:53601162-53601184 CTGGTTACCCAGATACACCCTGG + Exonic
1138464830 16:57181857-57181879 ATGGTGCCCCAGAGAGTGCATGG - Intronic
1141642318 16:85348478-85348500 CGGGTGACCAAGAAAGAGCTGGG - Intergenic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1141860492 16:86713118-86713140 CTGGTGCCTCCCAGAGAGCCTGG + Intergenic
1142132077 16:88435735-88435757 CTGGGGACCAAGAGAGACCAAGG + Exonic
1203143854 16_KI270728v1_random:1786654-1786676 CTGGTGACTCCGAGGGACCCGGG - Intergenic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143302032 17:5917597-5917619 TCCTTGACCCAGAGAGAGCCCGG - Intronic
1143331668 17:6141369-6141391 CTGATGACCGGGTGAGAGCCAGG + Intergenic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG + Intronic
1144640103 17:16932253-16932275 CCTGTGACCCAGCGAGGGCCAGG + Intronic
1145752369 17:27364406-27364428 CTGGTGACCGAGAAAAAACCAGG + Intergenic
1146954712 17:36930803-36930825 CTGGTGGTCCAGAGAGAGCTGGG - Intergenic
1147384161 17:40071887-40071909 CTGGGTACCCAGAAAGAGGCTGG - Intronic
1148166966 17:45490528-45490550 CTGGTTACCCTGAGACTGCCCGG - Intronic
1148552593 17:48559467-48559489 CTGGGAACCCAGACAGGGCCAGG - Intronic
1148644347 17:49210697-49210719 CTGGGGAGCCAGACAGAGGCTGG + Exonic
1149370133 17:55985770-55985792 ATGGTGAGCCAGGGAGAGGCTGG - Intergenic
1150398143 17:64836932-64836954 CTGGTTACCCTGAGACTGCCCGG - Intergenic
1152563874 17:81091585-81091607 CTGAAGACCCTGAGAGAGGCAGG + Intronic
1152783231 17:82235628-82235650 CGGGTCAGCCAGAGCGAGCCAGG + Exonic
1152914454 17:83026203-83026225 CTGGAGAACCAGCGAGAGCGTGG + Intronic
1153915638 18:9741908-9741930 CCAGGGACCCAGAGGGAGCCAGG + Intronic
1154342928 18:13519338-13519360 CTGGTGTTCCGGAGGGAGCCGGG + Intronic
1155000806 18:21684777-21684799 CAGGTGAGCCACAAAGAGCCTGG + Intronic
1157370262 18:47104377-47104399 GTGGTGAGCTAGAGAGGGCCAGG + Intergenic
1157809410 18:50684042-50684064 CTCCTGAGCCAGAGAGAGCCAGG + Intronic
1158429249 18:57369392-57369414 GAGGTGATCTAGAGAGAGCCTGG - Intronic
1159951332 18:74486413-74486435 CTGGTGGCCTGGAGGGAGCCTGG + Intergenic
1160039611 18:75333731-75333753 CTGGGGACCCCCAGAGACCCTGG - Intergenic
1160438275 18:78867717-78867739 CCGGTTACCCCGAGAGATCCAGG - Intergenic
1160837400 19:1131336-1131358 CTGGGGCCCCAGGGAGGGCCGGG + Intronic
1160956257 19:1693405-1693427 CTGGGGAGTCAGAGAGAGACTGG - Intergenic
1162968712 19:14167719-14167741 CCCGGGCCCCAGAGAGAGCCAGG + Intronic
1163278763 19:16302258-16302280 CTGATGACCCACAGAAGGCCTGG - Intergenic
1164222044 19:23203796-23203818 CTCCTGACCCAGAGTGAGGCTGG + Intergenic
1165211599 19:34240447-34240469 CTGGTCACACAGAGAGCTCCAGG - Intergenic
1165993312 19:39827891-39827913 CTGGTGACCCAGAAGGGCCCAGG - Intronic
1166147076 19:40845234-40845256 CTGGGGACACAGAGAGGGGCTGG + Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166373554 19:42315101-42315123 CTGGTGTCCCACAGAGAGCCTGG - Intronic
1166997487 19:46726660-46726682 CAGGGGACCCGGAGAGGGCCAGG + Intronic
1167118036 19:47499454-47499476 GTGATGACCCAGGGAGACCCTGG - Intronic
1167666767 19:50826904-50826926 CTGGTGTCCCACAACGAGCCTGG - Exonic
1167959140 19:53091670-53091692 CTGACGACCTAGAGAGATCCCGG - Exonic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
925234622 2:2267052-2267074 ATGGTGAACCAGAGCAAGCCAGG + Intronic
927658497 2:24971908-24971930 CGGGTGGCCCCGAGAGAGCCAGG - Exonic
928767898 2:34670304-34670326 CAGGTAACCCAGAGAGACACCGG + Intergenic
929449517 2:42027473-42027495 CTGGGGACCCCAAGACAGCCTGG + Intergenic
929996329 2:46828396-46828418 ATGAGGACCCAGAGAGAGCTGGG - Intronic
930241148 2:48936907-48936929 CTGGTGACCCAGAACAATCCTGG + Intergenic
930379761 2:50613224-50613246 TTAGTGACTCAGAGAGAGGCTGG - Intronic
930404685 2:50940535-50940557 CTTGTGACCCAGAGAGCACAAGG - Intronic
930729614 2:54715139-54715161 CTAGATACCCAGAGAGAGTCTGG - Intergenic
931801754 2:65765528-65765550 CTGAGGAGCCAGAGAGAGCTGGG - Intergenic
931941078 2:67252950-67252972 CTCATGACCCAGAAAGAGCCTGG + Intergenic
933844690 2:86315736-86315758 ATGGTGACCCAGAGAGCATCTGG - Intronic
934778293 2:96952685-96952707 CTGGTCATCCCCAGAGAGCCTGG + Intronic
934796930 2:97109274-97109296 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
934836483 2:97594157-97594179 CTGGTGACTCAAAGAGAGAAAGG + Intergenic
935949326 2:108314543-108314565 ATGGGGCCCCAAAGAGAGCCGGG + Intergenic
936046676 2:109193959-109193981 CTGGTGCCCCAGAAGGAGCATGG - Intronic
936089252 2:109490377-109490399 CGGGTGAACCAGTGAGGGCCAGG - Intronic
936545321 2:113387303-113387325 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
937877910 2:126839322-126839344 CTGATGACCCAGGGATTGCCAGG - Intergenic
937969031 2:127535766-127535788 CTGGGCACCCTGAAAGAGCCAGG - Intergenic
938749814 2:134317817-134317839 CTGGTCAGCATGAGAGAGCCTGG + Intronic
938802802 2:134778384-134778406 TTGGTGGACCAGAGAAAGCCTGG + Intergenic
939639986 2:144628598-144628620 CTGGTGACCCAGGAAGAGTGAGG - Intergenic
940012118 2:149065584-149065606 CTGGTTACTCAAAGTGAGCCTGG + Intronic
941091876 2:161186162-161186184 CTGGTGACAGAGCGAGACCCTGG + Intronic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
942911100 2:181245297-181245319 CTGATGAACCAGAGAGATCCTGG - Intergenic
943436017 2:187866854-187866876 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943436024 2:187866910-187866932 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
943436200 2:187868141-187868163 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436207 2:187868191-187868213 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436234 2:187868385-187868407 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436252 2:187868532-187868554 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436326 2:187869066-187869088 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436382 2:187869480-187869502 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
944168678 2:196750809-196750831 CTGGTGGCCCAGACTGAGCCAGG - Intronic
944821632 2:203438488-203438510 CTGGTGACCCAAAGACATACTGG + Exonic
946285845 2:218701900-218701922 CTGATTCCCCAGAGAGAGCAAGG - Exonic
947420445 2:229937616-229937638 CTGCTGAAGCAGGGAGAGCCAGG - Intronic
947810055 2:232998506-232998528 TTAGTTCCCCAGAGAGAGCCAGG - Intronic
947875144 2:233462741-233462763 CTGGTGCCCCAGGGACAGCAGGG + Intronic
1168753753 20:301370-301392 CTGGTGGCCCAGGGACAGCCAGG + Intergenic
1170630926 20:18064311-18064333 CTGGTACCTGAGAGAGAGCCTGG + Intergenic
1172503036 20:35440492-35440514 GGGTTGAACCAGAGAGAGCCTGG - Intronic
1172715701 20:36961882-36961904 CTGGTTCCCCAAAGAGAGTCAGG + Intergenic
1173597382 20:44267749-44267771 ATTGTGATCCAGAGAGACCCAGG + Intronic
1173908274 20:46644738-46644760 CTGGTGTTCAGGAGAGAGCCTGG - Intronic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1174536000 20:51251851-51251873 CTGTGGCCCCAGAGAGACCCAGG - Intergenic
1175542759 20:59758099-59758121 CTGGTGACCCAGCAAGACCTGGG + Intronic
1175728270 20:61334077-61334099 CTGGTCACCCCAAGAGGGCCTGG + Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1179801494 21:43813434-43813456 CAGGTGACCCAGCGAGGCCCAGG + Intergenic
1179979601 21:44889189-44889211 CTGGGGTCCCCGAGTGAGCCCGG + Intronic
1180980990 22:19877870-19877892 CTGTTGAGCCAGCCAGAGCCAGG - Intronic
1180999367 22:19980941-19980963 CTGGTTACCCAGAGTGTGGCTGG + Intronic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1183686393 22:39363548-39363570 CTGGGGAGGCTGAGAGAGCCTGG + Intronic
1183755728 22:39762453-39762475 TGGGTGACACAGTGAGAGCCTGG - Intronic
1183755731 22:39762473-39762495 TGGGTGACACAGTGAGAGCCTGG - Intronic
1184386432 22:44178371-44178393 AGGGGGACCCAGACAGAGCCAGG + Intronic
1184726646 22:46351143-46351165 CCGGTGTCCCAGAGAGGGCTGGG + Intronic
1184923898 22:47624353-47624375 CTGGCGCCCCAGGGAGAGCCGGG + Intergenic
949132998 3:528536-528558 CTGGTAACCAAAAGAGAGCTAGG - Intergenic
949159278 3:860529-860551 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159306 3:860776-860798 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159375 3:861318-861340 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
950193205 3:10992307-10992329 CTGGTGACCCAGGATGAGGCCGG + Intergenic
954070749 3:48141312-48141334 TTGGTGAACCACAGACAGCCTGG - Intergenic
954320574 3:49829740-49829762 CTGGCCACCCAGTGAGAGCTGGG + Exonic
954800617 3:53185046-53185068 CTGGGGAGCCACAGACAGCCAGG + Intronic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
959498928 3:107082933-107082955 GTGGTGAACCTGACAGAGCCTGG + Intergenic
959632766 3:108527335-108527357 CTGGTGACCCAGACAGACACTGG + Intronic
961793410 3:129392700-129392722 CTGGTGACTCAGAGAGGGCATGG + Intergenic
961807407 3:129499318-129499340 CTGGTGACTCAGAGAGGGCATGG + Intronic
963254550 3:143131744-143131766 CTTGTGACTGAGAGGGAGCCAGG + Intergenic
964868645 3:161289349-161289371 CTGGTGCCTTAGAGAGGGCCTGG - Intergenic
965157475 3:165082660-165082682 CTGGAAATGCAGAGAGAGCCAGG + Intergenic
968541986 4:1172503-1172525 CGGGACACCCAGAGAGGGCCCGG - Intronic
969073656 4:4559697-4559719 CTTGTGATACAGAGAGAGCCTGG + Intergenic
969718453 4:8879844-8879866 CTAGAGCCTCAGAGAGAGCCTGG + Intergenic
970968912 4:21958928-21958950 CTGGAGTTCCAGAGAGAGACTGG + Intergenic
973152056 4:46900453-46900475 CTGGTGAGACAGTGAGAGCCAGG - Intronic
974467573 4:62276756-62276778 GTGATAACCCAGAGAAAGCCTGG + Intergenic
974490363 4:62557063-62557085 CTGGTTACCCAGAGTGATGCAGG + Intergenic
975288936 4:72653425-72653447 CTGCTGCCCCAGAAAGGGCCAGG + Intergenic
979542503 4:121901402-121901424 CAGGTGCCGCAGAGAGAGCTAGG + Intronic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
980984071 4:139678595-139678617 CTGGTGACCCAGTGACTGCTGGG - Exonic
982353529 4:154442815-154442837 CTAGTGACCAAGAGAAAGACAGG - Intronic
985519953 5:369533-369555 CAAGTGACACAGAGGGAGCCCGG - Intronic
985604139 5:849602-849624 CTGGAGTCCCCGAGAGAGTCCGG - Intronic
985757675 5:1728900-1728922 GTGGTGACACAGAGTGGGCCTGG - Intergenic
985822950 5:2172714-2172736 CAGGTGACCCAGAGGCGGCCGGG + Intergenic
986242640 5:5974950-5974972 GTTGTTAGCCAGAGAGAGCCTGG + Intergenic
988065433 5:26225306-26225328 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
988065534 5:26226096-26226118 TTGGAGACCCAGAGAGGACCTGG - Intergenic
988065540 5:26226146-26226168 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065571 5:26226392-26226414 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065635 5:26226881-26226903 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065721 5:26227617-26227639 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988865140 5:35325881-35325903 CTGGTGTCCCAGAAAGAGATGGG + Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
990926395 5:61029959-61029981 ATGGTGACCCAGCAAAAGCCTGG + Intronic
991037006 5:62137433-62137455 CTGGCTCCGCAGAGAGAGCCAGG - Intergenic
993189272 5:84660532-84660554 CTGGAGCCCTAGAGAAAGCCAGG - Intergenic
995894286 5:116994521-116994543 CTGGGGACCCAGATAGACCTGGG - Intergenic
998105993 5:139469583-139469605 CTGGAGAGCCAGAGACACCCTGG - Intergenic
998918227 5:147039432-147039454 CTGAAGACCCAGATAGATCCCGG + Intronic
999551236 5:152689414-152689436 CTGGTGAGACTGAGACAGCCTGG - Intergenic
999831508 5:155324630-155324652 ATGGTGACTCAGAGAGATCCTGG - Intergenic
999992444 5:157061862-157061884 ATGATGAGCCAGAGAGAGCCAGG + Intergenic
1001253979 5:170169760-170169782 CGGGTGACCAAGACAGGGCCTGG + Intergenic
1001482317 5:172096688-172096710 TTGGAGACCCAGAGACAGCCTGG + Intronic
1001813202 5:174646319-174646341 CTGGTGCCCCAAACTGAGCCTGG - Intergenic
1002013038 5:176299458-176299480 CTGGTAATCCAAAGAGAGCAAGG + Intronic
1002518795 5:179778764-179778786 CTGGTGACCTGGAGAGACTCGGG - Intronic
1003976891 6:11353082-11353104 ATGTTCACCCAGAAAGAGCCTGG - Intronic
1003991581 6:11492102-11492124 CTGGTGAACGATAGAAAGCCAGG + Intergenic
1004522011 6:16370194-16370216 CAGGCGACCCCGACAGAGCCTGG + Intronic
1006429200 6:33984744-33984766 CTGGAGCCCCGGAGAGAGGCTGG + Intergenic
1007503039 6:42313162-42313184 CTTGTGACCCTGAGATCGCCTGG + Intronic
1007602305 6:43090148-43090170 CTGGTGACCCAGAAAGGGGTAGG + Intronic
1008332176 6:50258602-50258624 CTGGTGCCCCTGAAAGAGACAGG - Intergenic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1013300870 6:108803868-108803890 CTGGTGACCCAGCAAGAGCAAGG + Intergenic
1014162484 6:118186108-118186130 ATCGTGACCCAGAGAGGCCCAGG - Intronic
1016295376 6:142567649-142567671 CTTGTGACACAGGGAGAGCCAGG - Intergenic
1018217140 6:161539415-161539437 CTGCTGTTCCAGAAAGAGCCAGG - Intronic
1018435127 6:163752433-163752455 CTGGTGAGGGAGAGAGAGGCCGG - Intergenic
1019074137 6:169373450-169373472 CTGGGGACCCAGGGGGAGCGTGG + Intergenic
1019321007 7:415250-415272 CCTGTGACCCAGGGTGAGCCTGG - Intergenic
1019321021 7:415307-415329 CGCGTGACCCAGGGTGAGCCTGG - Intergenic
1019539386 7:1544995-1545017 CTGGAGACCCAGACACCGCCTGG - Exonic
1019742166 7:2680385-2680407 CTGGAGACCCCGGGAGACCCCGG + Intronic
1020029242 7:4921163-4921185 GTGGTGGCCCAGAGAGGGGCTGG - Intronic
1021874314 7:25034248-25034270 ATGGTGTCCCAGTGAGATCCGGG - Intergenic
1023230242 7:38020236-38020258 CTGGGAAACCAGAGAGAGCCCGG - Intronic
1024554616 7:50592834-50592856 CTGGGGACCCAGAGCGAGATGGG - Exonic
1024653399 7:51428389-51428411 CTGCTGACCCACAGAAATCCTGG - Intergenic
1026019234 7:66694960-66694982 CTGGTGACCCAGGGAGAGTATGG + Intronic
1026461497 7:70619092-70619114 AGGGAGACCCAGGGAGAGCCTGG - Intronic
1026881150 7:73907683-73907705 CTGGTGACCCAGGGAGAGTGTGG - Intergenic
1027476031 7:78632494-78632516 CAGGGGATCCAGAAAGAGCCTGG + Intronic
1029551114 7:101237606-101237628 CTGGTGCCCCAGAGAGGGGGAGG + Exonic
1030078564 7:105758001-105758023 CTAGTGATCCAGAGAGGGCCTGG - Intronic
1032059966 7:128716058-128716080 CTGGGGTCCCAGAGACAGCTGGG + Intronic
1033290462 7:140078621-140078643 GTGGTGACCCAGAGAGCAACAGG + Intergenic
1033582490 7:142750319-142750341 CTGGTGACCCCAGGAGAGCTCGG + Intronic
1034820946 7:154215794-154215816 CTGGCGACCCAGAGAGGGGAAGG - Intronic
1037004676 8:13762570-13762592 ATGGTAACCAAGAGAGAGCAGGG + Intergenic
1037659563 8:20915277-20915299 CTGGTGACCAGGCCAGAGCCTGG - Intergenic
1038054446 8:23845067-23845089 GTGGTCACCCAGTGAGAGCCCGG + Intronic
1038186393 8:25278693-25278715 CTGAGGACCCAGAGTGACCCTGG - Intronic
1039268414 8:35854235-35854257 CTGGGGACCCAGCGAGGTCCTGG - Intergenic
1040416477 8:47200420-47200442 ATGGTGACCCAGAGAGATAAAGG - Intergenic
1040709972 8:50176205-50176227 CTTGTGACACAGAGAGGGGCAGG - Intronic
1041333820 8:56757587-56757609 TTGGCAAGCCAGAGAGAGCCTGG + Intergenic
1041923684 8:63213391-63213413 CTGGTCATCTAGAGAGAGCAAGG + Intergenic
1048219172 8:132525811-132525833 CTGGCGACACAGATAAAGCCAGG + Intergenic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1049070474 8:140351710-140351732 TTGGTATCCAAGAGAGAGCCTGG + Intronic
1049128291 8:140811940-140811962 CTGGTGTCCCTGAAAGAGCTGGG + Intronic
1049783550 8:144439843-144439865 GTGGTGACCCGCAGGGAGCCTGG - Intronic
1049954820 9:682844-682866 CGGGTCAGCCAGACAGAGCCAGG + Intronic
1052263196 9:26541312-26541334 CTGGTGTCCCTGAAAGAGACAGG + Intergenic
1052622424 9:30930625-30930647 CTGGAGTCTCACAGAGAGCCTGG + Intergenic
1052920173 9:33959121-33959143 CTGGTGACAGAGCGAGAGCAAGG + Intronic
1053136592 9:35654634-35654656 CTGATGACCCAGTGACAGCCTGG - Intergenic
1053476845 9:38388360-38388382 CTGGGGCCTGAGAGAGAGCCTGG - Intergenic
1055984757 9:82046396-82046418 ATGGTAACCAAAAGAGAGCCAGG - Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059440853 9:114306087-114306109 CTGGTGCCTCACAGAGACCCTGG + Intronic
1059762204 9:117349031-117349053 CTGGTGCCATAGAGAGAGCTAGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060608666 9:124940970-124940992 CTGGCTTCCCAGAGAGAGGCAGG - Exonic
1062044122 9:134417407-134417429 CTGATGAGCCAGAGAGGTCCTGG + Intronic
1062147618 9:134998704-134998726 TTGGTGACCCAGGGAGTGCTTGG + Intergenic
1062194275 9:135264263-135264285 CTGATGACCCACAGAGAACAGGG - Intergenic
1062486259 9:136777835-136777857 CTGGAGACCCAGGGAGAAGCTGG - Intergenic
1062648816 9:137565023-137565045 CTGGTGACCCAGGGAACGCGGGG + Intronic
1186011158 X:5134621-5134643 CGGGGGACCCAGTGTGAGCCAGG + Intergenic
1187083853 X:16021408-16021430 CAAGTCACCCAAAGAGAGCCAGG - Intergenic
1187820033 X:23277651-23277673 CTGGTGAGCCAGGGAGGACCAGG + Intergenic
1188931226 X:36113704-36113726 CTGGTGTCCCTGAAAGAGACAGG - Intronic
1190058674 X:47197130-47197152 CTGGAGCCCCTGAGATAGCCAGG - Intronic
1190913119 X:54790038-54790060 CTGTTGACCCAGAGAGGCACTGG - Intronic
1190917824 X:54823271-54823293 CTGTTGACCCAGAGAGGCACTGG + Intergenic
1192709796 X:73567892-73567914 GTGGTGACATACAGAGAGCCAGG - Intronic
1194046131 X:89005736-89005758 ATGATGACACAGAGAGAGCCTGG + Intergenic
1194352302 X:92835287-92835309 CTGTGGACCCACACAGAGCCAGG + Intergenic
1196199753 X:112872139-112872161 GTGGTGGGCCACAGAGAGCCAGG - Intergenic
1196787103 X:119430516-119430538 CTGCTGACACTGAGAGTGCCTGG - Intronic
1197545380 X:127816988-127817010 CTGGTGACCCAGTGAGAGACAGG - Intergenic
1197828203 X:130613264-130613286 CTGGTGCCACAGAATGAGCCAGG - Intergenic
1198831208 X:140752481-140752503 CTGTTCACACAGAGAAAGCCAGG - Intergenic
1199310876 X:146318100-146318122 CTGCTGACCCACAGAGACCATGG - Intergenic
1200660611 Y:5952025-5952047 CTGTGGACCCACACAGAGCCAGG + Intergenic
1202301166 Y:23416024-23416046 CTGGGGCCCAAAAGAGAGCCTGG + Intergenic
1202569645 Y:26254574-26254596 CTGGGGCCCAAAAGAGAGCCTGG - Intergenic