ID: 1143740143

View in Genome Browser
Species Human (GRCh38)
Location 17:8946542-8946564
Sequence TTGAGTAAACACACTTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143740143 Original CRISPR TTGAGTAAACACACTTAGGT TGG (reversed) Intronic
900750116 1:4390357-4390379 CTGAGAAAACTGACTTAGGTGGG - Intergenic
905939794 1:41854032-41854054 GTGAGTGAACACACTTAGTAAGG - Intronic
906926103 1:50118553-50118575 TTGATTACACACACTTGGGAAGG + Intronic
910358266 1:86387657-86387679 GTGAGTAAAAACAATTAGATTGG - Intronic
916312660 1:163414201-163414223 ATGAGTAAAGGCATTTAGGTGGG - Intergenic
919011992 1:191976397-191976419 TTCAGTAGACACACCTAGGAAGG - Intergenic
919186264 1:194154773-194154795 CTGATTAAAAACACTTAGTTTGG - Intergenic
921784654 1:219215499-219215521 GTGAGTAAACACCCTCAGGCTGG - Intergenic
924281365 1:242440413-242440435 TTTAGGAACTACACTTAGGTGGG - Intronic
1064460147 10:15527049-15527071 TTGTGTAAACATACTTCAGTGGG + Intronic
1067374278 10:45713026-45713048 TTGAGTAAACACTCTTTTCTGGG - Intergenic
1067508224 10:46874335-46874357 TTGAGTAAACACAGTTATATGGG - Intergenic
1067654027 10:48177510-48177532 TTGGGTAAACACAGTTATATGGG + Intronic
1069335897 10:67349884-67349906 TGGATTAATCACACTTAAGTGGG + Intronic
1070420321 10:76229811-76229833 TTCAGTAAACACACCCAGGTTGG - Intronic
1077361271 11:2141110-2141132 TTGCCCAAACACACTTGGGTCGG - Exonic
1080977018 11:37355487-37355509 TTTAGTAAACACACTGAACTTGG - Intergenic
1082564123 11:54655494-54655516 TTGATTAAAAAAACCTAGGTAGG + Intergenic
1083474733 11:62908648-62908670 TTGAGCCAACACAGTTAGGAAGG + Intergenic
1085676335 11:78522337-78522359 TTGAGAAAATTCACTTAGATAGG - Intronic
1086005813 11:82034181-82034203 ATGAGAAAACACACTCAGGCAGG + Intergenic
1086503393 11:87476654-87476676 TTCAGTTAAAACACATAGGTAGG + Intergenic
1087515508 11:99154628-99154650 GTGAGTAGACACACATTGGTTGG + Intronic
1087559961 11:99776115-99776137 TTGAGTAAACACTCTGTGCTAGG + Intronic
1089778069 11:120852976-120852998 TTGACTAAAAACATTTAGGAAGG - Intronic
1089786482 11:120911005-120911027 TTCAGCAACCACACATAGGTGGG + Intronic
1090468665 11:126958517-126958539 GTGAGTGAACACACCCAGGTAGG - Intronic
1091754376 12:3042071-3042093 TTTAGTGAACACATTTATGTGGG - Intergenic
1092242218 12:6842215-6842237 TTGAGTAAACAGACTCAGGGAGG + Intronic
1092289097 12:7148440-7148462 TCGGGGAAACACACTTTGGTAGG - Intronic
1093822787 12:23642722-23642744 TTGAGTAAAATCACTTGGGTGGG + Intronic
1094135908 12:27125873-27125895 TTGAGAAAACACACTTAATTTGG - Intergenic
1094185452 12:27637603-27637625 TTGAGAAAACACACTTAATTTGG - Intronic
1094815534 12:34179909-34179931 TTGAGTAAACAGGCAGAGGTTGG - Intergenic
1098329016 12:69332991-69333013 TTGGGTAAACAGACTTAACTGGG + Intergenic
1098743782 12:74208796-74208818 TAGAGAAAAAACACTAAGGTTGG + Intergenic
1100431209 12:94533406-94533428 TTGTGTAAACACAGTATGGTGGG - Intergenic
1100811333 12:98341533-98341555 TTGAGTAATTCCACTTAAGTAGG - Intergenic
1103166869 12:118777844-118777866 TTGAGCAAACACCCAAAGGTGGG - Intergenic
1111162083 13:84407854-84407876 TTGAGTAAACTCAATCAGTTTGG + Intergenic
1112385568 13:98936361-98936383 ATGAGTAAATACACTTTGGGAGG + Intronic
1115383636 14:32769612-32769634 TTGATTAAACATCATTAGGTAGG - Intronic
1117575034 14:57089020-57089042 TCTAGGGAACACACTTAGGTTGG + Intergenic
1118002156 14:61533486-61533508 TTGAGGAGACACACTGAGGAGGG + Intronic
1125600747 15:40914723-40914745 ATGAGTAAAGACACCTAGGAAGG - Intergenic
1126183314 15:45807146-45807168 GTGAATAATAACACTTAGGTAGG - Intergenic
1127961731 15:63895334-63895356 TTGAGCAAAGACACAGAGGTAGG - Intergenic
1133501912 16:6374737-6374759 TTGAGTAATCGTACATAGGTGGG + Intronic
1134877548 16:17715470-17715492 TTAAGTAAAAGCACTGAGGTTGG - Intergenic
1139013751 16:62664780-62664802 TTGAGTAAACAAAATTAGGTTGG - Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1143740143 17:8946542-8946564 TTGAGTAAACACACTTAGGTTGG - Intronic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1153700183 18:7684851-7684873 TTGGGTAAATACACCTAAGTGGG + Intronic
1153729342 18:7992507-7992529 ATCAGTAAACACACACAGGTAGG + Intronic
1155615953 18:27721634-27721656 ATGAGAAAACAGCCTTAGGTGGG - Intergenic
1155635002 18:27942126-27942148 TCCAGTATACACACTTATGTGGG - Intergenic
1156657049 18:39300916-39300938 TTTGGTAAATACACTTAGGAAGG - Intergenic
1160446541 18:78932304-78932326 TTAAGTAAGTACTCTTAGGTGGG + Intergenic
1160557267 18:79734358-79734380 TCGTGTAAACACACTGATGTGGG - Intronic
1161744649 19:6048466-6048488 TTAAGTACACACACTTAGGTAGG + Intronic
1164838704 19:31376047-31376069 TGGAGTAAACACCCAAAGGTGGG + Intergenic
931492653 2:62766059-62766081 ATGAGTAAATTCACATAGGTAGG - Intronic
932996664 2:76863434-76863456 TTGAGTAAAGAAGCTTAGGCTGG + Intronic
933824107 2:86142828-86142850 TTAAGTAAATCCACTTAGGAGGG + Intergenic
933864629 2:86505013-86505035 TTGAGAAAACACAGATAGGAAGG + Exonic
934030022 2:88035930-88035952 TTGAATAAACATACTTAGAGAGG + Intronic
935298502 2:101672127-101672149 TTTAGTGAACCCACTTAGTTAGG - Intergenic
936692317 2:114905243-114905265 TTGAGTAGACAAATTTGGGTGGG + Intronic
941475194 2:165942701-165942723 TTGAGCAAACACATTTATGGAGG - Intronic
941494521 2:166183213-166183235 TCTAGTAACCACACTTAGGAGGG - Intergenic
943190679 2:184675163-184675185 TTGTGTGAATACACATAGGTAGG - Intronic
945358066 2:208861972-208861994 TAGAGTAAACACAATCAGGTGGG + Intergenic
948116185 2:235495314-235495336 TTAAGCAAACACACTAAGGAGGG - Intronic
1170412953 20:16110050-16110072 AAGAGAAAACACACTGAGGTGGG + Intergenic
1171856403 20:30347963-30347985 TTGAGCAAACATTCTTTGGTTGG - Intergenic
1172099333 20:32475803-32475825 GTGAGCAAACACACTTTGGTTGG + Intronic
1172813764 20:37670461-37670483 TTAAGTAAACACGCTGAGGCGGG - Intergenic
1173045390 20:39504709-39504731 TTGAGCCAACAGACTTGGGTTGG + Intergenic
949174800 3:1047471-1047493 TTGAGGAAACACTCCAAGGTGGG + Intergenic
949542006 3:5039865-5039887 ATGAATAATCACATTTAGGTTGG + Intergenic
949980077 3:9497002-9497024 TTGAGGAAAAAGACTGAGGTAGG - Intergenic
951089728 3:18558340-18558362 TTAAGTAAACAGAATTATGTAGG - Intergenic
951833854 3:26959857-26959879 TTGGCTAAACACAATTAGATGGG - Intergenic
955877840 3:63512271-63512293 TTGAGAAAGCCCACTGAGGTTGG - Intronic
956029311 3:65020134-65020156 TTAAGTGAACAAACTTAGATGGG + Intergenic
956832856 3:73070379-73070401 TTTAGTAAACAAAATTAAGTGGG - Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958959228 3:100492907-100492929 TTGAGTAAACAGACCAAGTTGGG + Exonic
959596517 3:108134977-108134999 TTTAGTAAACAAATTCAGGTAGG + Intergenic
962172017 3:133111224-133111246 TTGAAAAAACAGTCTTAGGTGGG + Intronic
963756689 3:149241748-149241770 TTGTGTTAACACAATCAGGTTGG + Intergenic
964334214 3:155637769-155637791 CTGAGTAAACATACTAAAGTAGG - Intronic
964527705 3:157632628-157632650 TTGAACAAACAAACTTAGCTGGG + Intronic
964971743 3:162571686-162571708 TTCAGTAAATACATTTATGTAGG + Intergenic
966960636 3:184934548-184934570 TACAGTAAACATACTTATGTTGG - Intronic
971649067 4:29248481-29248503 TGGAGTAAACACAATTTGGGTGG - Intergenic
971714846 4:30162791-30162813 TTCAGTAAACTCACATAAGTTGG - Intergenic
972952353 4:44343151-44343173 ATGATTAAACATACTGAGGTAGG - Intronic
977604884 4:98974127-98974149 TTGAGTAAACACTCAGAAGTAGG + Intergenic
977856338 4:101899265-101899287 TTAAGTAAACACACTAAATTAGG + Intronic
979265215 4:118694522-118694544 TTGAATAAAAACACTTACATGGG - Exonic
979783467 4:124685488-124685510 TTGTGTACACATACTTTGGTGGG - Intronic
980608308 4:135122627-135122649 TAGAGTAAACAGACTTAACTGGG - Intergenic
980977839 4:139628199-139628221 TGGAATAAAGACACTTAGGAGGG - Intergenic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
985296050 4:188438495-188438517 TAGGGTAAACAGACTTAAGTGGG - Intergenic
986445184 5:7815174-7815196 TTGAATAACTATACTTAGGTTGG - Intronic
989367973 5:40677389-40677411 TTGAGTAAACATATTAAGGTGGG - Intergenic
993210065 5:84937950-84937972 TGGACTAAACTCACTTAGGCTGG - Intergenic
994337346 5:98583184-98583206 TCCAGTCAAGACACTTAGGTTGG + Intergenic
997841965 5:137249940-137249962 TTGAGGAGACACACTTGGATTGG + Intronic
998630555 5:143893282-143893304 ATGAGTAAACACAGTCAGGAAGG - Intergenic
999541164 5:152573642-152573664 TTGGGTAAATACACTTAAATTGG - Intergenic
999945283 5:156589105-156589127 TTGAGTAAAGACACATTGATTGG + Intronic
1003665165 6:8104286-8104308 TTAAGTAAACAGAGCTAGGTAGG - Intergenic
1004673221 6:17816838-17816860 TATAGTAAACATACTTAGGGTGG + Intronic
1004982291 6:21038930-21038952 TTGAATATTCACACCTAGGTAGG - Intronic
1006725026 6:36193067-36193089 TTTATTAAACTCACTTAAGTTGG + Intergenic
1011975743 6:93295693-93295715 TAGAGTAAAGACAATTATGTAGG - Intronic
1012673163 6:102082176-102082198 ATGAGTAATGACACATAGGTTGG - Intergenic
1012846533 6:104396505-104396527 TTGAGTGTACACGCTTATGTTGG + Intergenic
1013230062 6:108154486-108154508 TTGACTAAACACATTGAGGCTGG + Intronic
1013648264 6:112167419-112167441 TTTAGAAAACAAACTTAAGTGGG - Intronic
1019045746 6:169144198-169144220 ATGAGCAAACACACTTCAGTTGG + Intergenic
1019844681 7:3485787-3485809 ATAAGAAAACACACTTACGTGGG - Intronic
1021908504 7:25360661-25360683 TTAAGAAAACACACTTAGGAAGG + Intergenic
1022687671 7:32611829-32611851 CAGAGAAAACACACTGAGGTTGG - Intergenic
1027630313 7:80596144-80596166 TTGAGAACACAGACTTAGGGAGG + Intronic
1027854402 7:83490609-83490631 TTTAATAAACACACTCTGGTGGG - Intronic
1031215101 7:118880587-118880609 TAGAGTAAACACAGTTGTGTAGG + Intergenic
1038896545 8:31789691-31789713 TTGCGTAAAAACATATAGGTGGG - Intronic
1043482507 8:80667514-80667536 ATGAGTAAACACACTTCAGAGGG - Intronic
1044059733 8:87621038-87621060 TTTAGTAAACATATTTAGGAAGG - Intergenic
1044544339 8:93442959-93442981 TGTAGTAAACACACTTAAGAAGG - Intergenic
1045549706 8:103160456-103160478 TTCAGTAATCACACTGAGGCAGG - Intronic
1046850930 8:118972156-118972178 TTGAGTAAAAAAAGTTATGTTGG + Intergenic
1048900186 8:139029727-139029749 TTGAGTAAAGACACTTCTGTTGG + Intergenic
1050430390 9:5556216-5556238 TTGCATAAAGACACTGAGGTAGG + Intronic
1052025282 9:23567210-23567232 TTGAGGATTCACACTCAGGTGGG - Intergenic
1058491854 9:105510233-105510255 TTGAGTAAACCCTCTGCGGTAGG + Intronic
1189339205 X:40191878-40191900 TTGCTTAAACAAGCTTAGGTGGG - Intergenic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1196948721 X:120854330-120854352 TGGAGTATACATTCTTAGGTAGG + Intergenic
1198993626 X:142546714-142546736 TTAAGCAAAAAGACTTAGGTTGG - Intergenic
1200037077 X:153338571-153338593 TTAAGTAAAAACACTTCAGTAGG + Intronic
1202183828 Y:22162924-22162946 TTGATTAAATACACAAAGGTAGG + Intergenic
1202207531 Y:22423477-22423499 TTGATTAAATACACAAAGGTAGG - Intergenic