ID: 1143742240

View in Genome Browser
Species Human (GRCh38)
Location 17:8963292-8963314
Sequence GTGCTCAGTGGAACCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1360
Summary {0: 1, 1: 0, 2: 0, 3: 56, 4: 1303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143742238_1143742240 -4 Left 1143742238 17:8963273-8963295 CCAAGTCAGCACAGCTTGAGTGC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 1143742240 17:8963292-8963314 GTGCTCAGTGGAACCCAAGCTGG 0: 1
1: 0
2: 0
3: 56
4: 1303
1143742235_1143742240 25 Left 1143742235 17:8963244-8963266 CCCTTGGGATGAGCATCTTTGAA 0: 1
1: 0
2: 0
3: 22
4: 2124
Right 1143742240 17:8963292-8963314 GTGCTCAGTGGAACCCAAGCTGG 0: 1
1: 0
2: 0
3: 56
4: 1303
1143742236_1143742240 24 Left 1143742236 17:8963245-8963267 CCTTGGGATGAGCATCTTTGAAG 0: 1
1: 0
2: 2
3: 10
4: 157
Right 1143742240 17:8963292-8963314 GTGCTCAGTGGAACCCAAGCTGG 0: 1
1: 0
2: 0
3: 56
4: 1303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143742240 Original CRISPR GTGCTCAGTGGAACCCAAGC TGG Intronic
900089402 1:913281-913303 GAGCTCTGGGGACCCCAAGCCGG - Intergenic
901030836 1:6305885-6305907 GTGCTCAATGGTGCCCAGGCTGG - Intronic
901224073 1:7601637-7601659 GTGCTCAATGGTGCCCAGGCTGG - Intronic
901270864 1:7952368-7952390 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
901341139 1:8500509-8500531 GTGCTCAATGGTGCCCAGGCTGG + Intronic
901555492 1:10028641-10028663 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
901855692 1:12042973-12042995 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
902018543 1:13327937-13327959 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
902027616 1:13395382-13395404 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
902062493 1:13657688-13657710 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
902397113 1:16138366-16138388 GTGCTCAGGGCACTCCAAGCAGG + Exonic
902434172 1:16386642-16386664 ATGCTCAGAGGCGCCCAAGCAGG - Intronic
903081240 1:20815082-20815104 GTGCTCAATGGTGCCCAGGCTGG + Intronic
903100245 1:21023557-21023579 GTGCTCAATGGTGCCCAGGCTGG + Intronic
903103295 1:21052880-21052902 GTGCTCAATGGTGCCCAGGCTGG + Intronic
903147928 1:21387323-21387345 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
903163082 1:21503153-21503175 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
903426344 1:23257112-23257134 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
903458211 1:23503568-23503590 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
903485735 1:23688487-23688509 GTGCTCGGTGGTGCCCAGGCTGG + Intergenic
903508046 1:23852775-23852797 GTGCTCAATGGTGCCCAGGCTGG + Intronic
903519311 1:23935281-23935303 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
903531320 1:24032574-24032596 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
903633809 1:24798944-24798966 GTGCTCAATGGTGCCCAGGCTGG + Intronic
903638093 1:24834517-24834539 GTGCTCAATGGTGCCCAGGCTGG - Intronic
903748340 1:25603559-25603581 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
903894641 1:26595776-26595798 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
903921739 1:26804551-26804573 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
903961995 1:27063712-27063734 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
903993452 1:27289681-27289703 GTGCTCAATGGTGCCCAGGCTGG - Intronic
904077225 1:27852436-27852458 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
904283905 1:29441889-29441911 TTGCACAATGGAACCAAAGCTGG + Intergenic
904531964 1:31176109-31176131 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
904784891 1:32975536-32975558 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
904857439 1:33509843-33509865 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
905042112 1:34968305-34968327 GTGCTCAATGGAGCCCAGGCTGG - Intergenic
905427239 1:37895812-37895834 GTGCTCAATGGTGCCCAGGCTGG + Intronic
905477490 1:38239255-38239277 CTGCTTTGTGGAACCTAAGCGGG + Intergenic
905526961 1:38647108-38647130 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
905599278 1:39235202-39235224 GTGCTCAATGGTGCCCAGGCTGG - Intronic
905686738 1:39913712-39913734 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
905699216 1:39999342-39999364 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
906099816 1:43253078-43253100 AAGCCCAGTGGATCCCAAGCAGG + Intronic
906100950 1:43261075-43261097 GTGCACAACGGGACCCAAGCGGG - Intronic
906136049 1:43501583-43501605 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
906329855 1:44876083-44876105 GTGCTCAATGGTGCCCAGGCTGG + Intronic
906353279 1:45081610-45081632 GTGCTCAATGGCACCCAGGCTGG + Intronic
906399930 1:45497526-45497548 GTGCTCAATGGCGCCCAGGCTGG + Intronic
906427084 1:45724281-45724303 GTGCTCAATGGTGCCCAGGCTGG + Intronic
906741843 1:48192040-48192062 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
906762028 1:48384032-48384054 GTGCTCAATGGTGCCCAGGCTGG - Intronic
906770506 1:48479037-48479059 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
906956717 1:50381312-50381334 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
907053824 1:51346585-51346607 GTGCTCAGTGCTGGCCAAGCTGG - Intergenic
907089749 1:51712109-51712131 GTGCTCAATGGTGCCCAGGCTGG - Intronic
907140456 1:52181382-52181404 GTGCTCAATGGTGCCCAGGCTGG + Intronic
908370088 1:63472774-63472796 GTGCTCAATGGTGCCCAGGCTGG + Intronic
908446036 1:64200764-64200786 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
908467745 1:64414548-64414570 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
909479130 1:76113034-76113056 GTGCTCAATGGTGCCCAGGCTGG - Intronic
909641250 1:77870780-77870802 GTGCTCAATGGTGCCCAGGCTGG - Intronic
910343665 1:86215401-86215423 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
910407071 1:86900284-86900306 GTGCTCAATGGTGCCCAGGCTGG - Intronic
910777631 1:90892235-90892257 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
911325966 1:96470289-96470311 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
911351902 1:96763274-96763296 GTGCTCAATGGTGCCCAGGCTGG - Intronic
911486805 1:98513308-98513330 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
911598476 1:99823254-99823276 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
912116205 1:106412135-106412157 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
912266283 1:108160646-108160668 GTGCTCAATGGTGCCCAGGCTGG - Intronic
912298637 1:108490526-108490548 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
912303050 1:108536514-108536536 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
912316869 1:108675369-108675391 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
912669197 1:111608597-111608619 GTGCTCAATGGTGCCCAGGCTGG - Intronic
913021257 1:114791161-114791183 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
913022913 1:114805027-114805049 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
913306334 1:117430906-117430928 GTGCTCAATGGTGCCCAGGCTGG - Intronic
914002014 1:143702363-143702385 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
914231641 1:145767669-145767691 GTGCTCAATGGTGCCCAGGCTGG - Intronic
914240757 1:145851062-145851084 GTGCCCAATGAAACCCAAGAAGG - Exonic
914392071 1:147232798-147232820 GTGCTCAATGGTGCCCAGGCTGG + Intronic
914468437 1:147950629-147950651 GTGCTCAATGGTGCCCAGGCTGG - Intronic
914775389 1:150729682-150729704 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
914887891 1:151599889-151599911 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
914893951 1:151651898-151651920 GTGCTCAATGGTGCCCAGGCTGG - Intronic
914909084 1:151769771-151769793 GTGCTCAGTGTTGCCCAGGCTGG - Intronic
914987429 1:152472474-152472496 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
915113769 1:153582614-153582636 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
915208277 1:154287219-154287241 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
915502238 1:156327590-156327612 GTGCTCAATGGTGCCCAGGCTGG + Intronic
916037232 1:160932960-160932982 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
916104682 1:161422550-161422572 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
916223318 1:162465702-162465724 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
917006068 1:170418552-170418574 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
917126765 1:171694382-171694404 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
917205842 1:172571358-172571380 GTGCTCAATGGTGCCCAGGCTGG + Intronic
917376209 1:174350787-174350809 GTGCTCAATGGTGCCCAGGCTGG - Intronic
917553208 1:176057634-176057656 GTGCTCAATGGTGCCCAGGCTGG + Intronic
917848547 1:179041352-179041374 GTGCTCAATGGTGCCCAGGCTGG - Intronic
917859778 1:179135029-179135051 GTGCTCAATGGTGCCCAGGCTGG + Intronic
917889252 1:179419310-179419332 GTGCTCAATGGTGCCCAGGCTGG - Intronic
918221518 1:182440333-182440355 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
918228894 1:182510375-182510397 GTGCTCAATGGTGCCCAGGCTGG - Intronic
918255463 1:182742435-182742457 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
919079872 1:192856644-192856666 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
919423786 1:197405375-197405397 GTGCTCAATGGTGCCCAGGCTGG + Intronic
919625366 1:199905036-199905058 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
919926008 1:202192182-202192204 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
919959522 1:202452246-202452268 GTGCTCAATGGTGCCCAGGCTGG - Intronic
920152584 1:203920373-203920395 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
920451403 1:206063691-206063713 GTGCTCAGTGGCGCCCAGGCTGG + Intronic
920794828 1:209128777-209128799 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
921043809 1:211460026-211460048 GTGCTCAGTGGCGCCCAGGCTGG + Intergenic
921142798 1:212321884-212321906 GTGCTCAATGGTGCCCAGGCTGG - Intronic
921197984 1:212778698-212778720 GTGCTCAATGGTGCCCAGGCTGG + Intronic
921238498 1:213152936-213152958 GTGCTCAATGGTGCCCAGGCTGG - Intronic
921813941 1:219545305-219545327 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
921902894 1:220467214-220467236 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
922102349 1:222487298-222487320 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
922278410 1:224100516-224100538 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
922436855 1:225615342-225615364 GTGCTCAATGGTGCCCAGGCTGG + Intronic
922503959 1:226115663-226115685 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
922632697 1:227132430-227132452 GTGCTCAATGGTGCCCAGGCTGG + Intronic
922693300 1:227711548-227711570 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
922935669 1:229420307-229420329 GTGCTCAGTGCAAGGCAGGCAGG - Intergenic
922993101 1:229932262-229932284 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
923082026 1:230666811-230666833 GTGCTAAGTGGAAAAAAAGCAGG + Intronic
923136987 1:231128199-231128221 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
923267829 1:232331368-232331390 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
923589769 1:235308774-235308796 GTGCTCAATGGTGCCCAGGCTGG + Intronic
923710666 1:236386212-236386234 GTGCTCAATGGTGCCCAGGCTGG + Intronic
923793139 1:237128081-237128103 GTGCTCAATGGTGCCCAGGCTGG - Intronic
923840965 1:237669985-237670007 GTGCTCAATGGTGCCCAGGCTGG - Intronic
923901151 1:238327365-238327387 GTGCTCAGTGTTGCCCAGGCTGG - Intergenic
924765872 1:247031864-247031886 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
924925538 1:248676601-248676623 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1063084782 10:2806676-2806698 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1063459690 10:6207134-6207156 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1063744827 10:8868679-8868701 GTGCTCAATGGTACCCAGGCTGG + Intergenic
1064108774 10:12520625-12520647 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1064109209 10:12523441-12523463 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1064663718 10:17629815-17629837 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1065594522 10:27297190-27297212 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1065704533 10:28460035-28460057 GTTCTCAGTGGCTCCCAACCTGG + Intergenic
1065756321 10:28934524-28934546 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1065840252 10:29696251-29696273 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1066085209 10:31969383-31969405 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1066421942 10:35271775-35271797 ATGCACTGTGGAACCCAAGGGGG - Intronic
1066745872 10:38604018-38604040 GGGCTCAGTGGAGCCTGAGCCGG + Intergenic
1066952800 10:42137842-42137864 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1067034057 10:42900084-42900106 GTGCTCAATGTTGCCCAAGCTGG + Intergenic
1067114308 10:43422934-43422956 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1067120181 10:43465884-43465906 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1067173380 10:43925494-43925516 GTGGTCACTGCAGCCCAAGCTGG - Intergenic
1067339666 10:45391392-45391414 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1067354356 10:45511707-45511729 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1068667883 10:59696403-59696425 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1068969486 10:62947324-62947346 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1069052812 10:63812160-63812182 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1069365538 10:67691191-67691213 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1069645565 10:69993565-69993587 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1069732864 10:70630725-70630747 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1069741568 10:70688564-70688586 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1069816485 10:71198586-71198608 ATGTTCAGTGAACCCCAAGCAGG + Intergenic
1069929083 10:71870141-71870163 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1070135345 10:73689286-73689308 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1070684264 10:78469380-78469402 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1070966358 10:80533688-80533710 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1071085216 10:81862198-81862220 GTGTTCGAGGGAACCCAAGCAGG + Intergenic
1071616351 10:87080237-87080259 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1072013573 10:91323985-91324007 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1072180198 10:92974865-92974887 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1072602515 10:96942138-96942160 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1072684733 10:97529460-97529482 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1072730232 10:97841309-97841331 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1072956367 10:99891472-99891494 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1072980053 10:100092479-100092501 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1072999570 10:100276801-100276823 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1073385936 10:103128365-103128387 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1073450564 10:103606794-103606816 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1074152261 10:110767926-110767948 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1074587900 10:114786794-114786816 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1075051111 10:119182896-119182918 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1075061771 10:119261595-119261617 GTGCTCAATGGCGCCCAGGCTGG - Intronic
1075128696 10:119721646-119721668 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1075137314 10:119795774-119795796 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1075181557 10:120215738-120215760 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1075243288 10:120798241-120798263 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1075842681 10:125518068-125518090 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1076011857 10:126995337-126995359 GTGCTCAGTGTTGCCCAGGCTGG - Intronic
1076914445 10:133414862-133414884 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1077397428 11:2332046-2332068 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1077836967 11:5934305-5934327 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1078176764 11:8977672-8977694 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1079020478 11:16906624-16906646 GTGTTCAGTGGTGCCCAGGCTGG + Intronic
1079040012 11:17051245-17051267 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1079173811 11:18120757-18120779 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1079372121 11:19860727-19860749 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1079444710 11:20548048-20548070 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1080097821 11:28429656-28429678 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1080620773 11:33985853-33985875 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1080859952 11:36144228-36144250 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1081288547 11:41303386-41303408 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1081627211 11:44663230-44663252 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1081950559 11:47039199-47039221 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1082706110 11:56496852-56496874 GTGCTCAATGTTACCCAGGCTGG + Intergenic
1082844907 11:57717399-57717421 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1083042168 11:59699346-59699368 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1083091342 11:60201847-60201869 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1083114871 11:60450984-60451006 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1083154486 11:60814769-60814791 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1083208376 11:61166951-61166973 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1083382172 11:62278219-62278241 GTGCTCAATGGTGCCCATGCTGG + Intergenic
1083646317 11:64173154-64173176 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1083831934 11:65238917-65238939 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1083865345 11:65450694-65450716 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1083918115 11:65763365-65763387 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1084048803 11:66587285-66587307 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1084388693 11:68861149-68861171 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1084624566 11:70296378-70296400 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1084745836 11:71168521-71168543 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1084924927 11:72503237-72503259 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1085073619 11:73571545-73571567 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1085097697 11:73774720-73774742 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
1085116833 11:73937369-73937391 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1085139806 11:74129771-74129793 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1085292608 11:75410682-75410704 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1085360244 11:75878557-75878579 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1085443449 11:76583002-76583024 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1085480762 11:76821109-76821131 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1085492611 11:76934384-76934406 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1085513503 11:77099426-77099448 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1085563082 11:77489748-77489770 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1085754373 11:79191426-79191448 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1086017100 11:82181502-82181524 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1086061054 11:82700258-82700280 GTTATCATTGGAACCCAGGCAGG + Intergenic
1086104351 11:83132928-83132950 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1086122724 11:83317493-83317515 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1086340608 11:85844751-85844773 GTGGTCAGTGGAACTCATTCTGG + Intergenic
1086365960 11:86110238-86110260 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1086430411 11:86731865-86731887 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1086446724 11:86878562-86878584 GTGCTCAATGGGGCCCAGGCTGG + Intronic
1086697144 11:89860322-89860344 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1086709015 11:89984165-89984187 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1086792718 11:91063155-91063177 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1086814312 11:91349533-91349555 GTCCTCAGTAGAAACCAACCTGG + Intergenic
1086881371 11:92157186-92157208 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1087198438 11:95321773-95321795 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1087214640 11:95482117-95482139 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1087411148 11:97791552-97791574 CTTCTCAGTGGAAACCAGGCAGG - Intergenic
1087948426 11:104193910-104193932 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1088116393 11:106317962-106317984 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1088257006 11:107912104-107912126 GTGCTCAATGGCGCCCAGGCTGG + Intronic
1088659056 11:112027596-112027618 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1089421233 11:118332422-118332444 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1089585760 11:119508579-119508601 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1090322788 11:125862507-125862529 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1090762282 11:129848209-129848231 GTGCTCAATGGTGCCCAGGCCGG - Intronic
1090791283 11:130092418-130092440 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1090907009 11:131084841-131084863 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1090920101 11:131199299-131199321 GAGCTCCGTGGCACCCGAGCTGG - Intergenic
1091378457 12:41557-41579 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1091586092 12:1817783-1817805 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1091918749 12:4287860-4287882 GTGCTCGGAGGAACACAAGGGGG + Intronic
1092296152 12:7200586-7200608 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1092331598 12:7590841-7590863 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1092401658 12:8183680-8183702 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1092453429 12:8624658-8624680 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1092590848 12:9952474-9952496 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1092664048 12:10774358-10774380 GTGCCCAGTGGATCTCAAGTGGG - Intergenic
1092827976 12:12415245-12415267 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1092843716 12:12565709-12565731 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1093927730 12:24925889-24925911 GTGCTCAATGTTGCCCAAGCTGG + Intronic
1094103139 12:26784641-26784663 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1094209301 12:27873631-27873653 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1094670469 12:32563697-32563719 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1095068945 12:37815615-37815637 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1095570963 12:43684668-43684690 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1096039534 12:48501206-48501228 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1096044557 12:48551538-48551560 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
1096063853 12:48724365-48724387 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1096082286 12:48841760-48841782 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1096093129 12:48916296-48916318 GTGCTCAATGGCGCCCAGGCTGG - Intronic
1096167682 12:49437525-49437547 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1096224856 12:49860528-49860550 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1096440997 12:51644534-51644556 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1096556908 12:52409371-52409393 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1096856780 12:54488939-54488961 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1096951737 12:55479773-55479795 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1097003771 12:55900566-55900588 GTGCTCAGTGGAGGCCAGGAAGG - Intergenic
1097028651 12:56076433-56076455 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1097127227 12:56784373-56784395 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1097148996 12:56963146-56963168 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1097230655 12:57508357-57508379 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1097779448 12:63686457-63686479 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1098023025 12:66174716-66174738 GTGCTCAGTGTTGCCCAAGCTGG + Intergenic
1098412488 12:70201430-70201452 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1098883625 12:75941342-75941364 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1099029222 12:77504434-77504456 GTCCACAGTGGCAGCCAAGCTGG - Intergenic
1099255651 12:80308663-80308685 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1100507669 12:95236119-95236141 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1100570871 12:95842072-95842094 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1100577728 12:95908158-95908180 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1100581899 12:95946914-95946936 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1102001120 12:109558632-109558654 GCGCTCAGGGGACCCCATGCAGG - Intronic
1102089224 12:110172686-110172708 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1102186476 12:110951552-110951574 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1102268183 12:111506963-111506985 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1102294326 12:111724501-111724523 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1103020691 12:117531472-117531494 GGGCACAGTGGGACCCAAGGAGG - Intronic
1103041107 12:117696226-117696248 GACCTCAGAGAAACCCAAGCCGG - Intronic
1103234619 12:119360832-119360854 GTGCTCAATGGCGCCCAGGCTGG - Intronic
1103300005 12:119919432-119919454 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1103350263 12:120278710-120278732 GTGCTCAGTGTTGCCCAGGCTGG - Intergenic
1103456924 12:121075638-121075660 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1103536025 12:121634401-121634423 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1103591145 12:121993266-121993288 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1103641586 12:122356937-122356959 GTGCTCAATGGTACCCAGGCTGG + Intronic
1103872763 12:124102639-124102661 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1104025022 12:125019429-125019451 ATGCTCAGAGGAACCCCAGGAGG + Intronic
1104600846 12:130152342-130152364 ATGCTCAGTGGATCCCAAGACGG - Intergenic
1104712986 12:130997900-130997922 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1104861536 12:131926761-131926783 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1105248394 13:18673619-18673641 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1105367578 13:19778670-19778692 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1105527194 13:21187110-21187132 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1105555837 13:21447581-21447603 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1105692951 13:22859595-22859617 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1105808515 13:23973077-23973099 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1105921887 13:24970880-24970902 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1105976938 13:25480852-25480874 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1105980686 13:25513653-25513675 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1106403868 13:29456503-29456525 AAGCTAAGTGAAACCCAAGCAGG + Intronic
1106495121 13:30269381-30269403 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1106680031 13:31999779-31999801 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1106746693 13:32715958-32715980 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1106918460 13:34540132-34540154 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1107165719 13:37279952-37279974 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1107492993 13:40900048-40900070 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1107498752 13:40954747-40954769 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1107589025 13:41882500-41882522 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1107692356 13:42966082-42966104 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1107953470 13:45486008-45486030 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1108330116 13:49377691-49377713 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1108351203 13:49592440-49592462 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1108501847 13:51077449-51077471 GTGCTCAATGGCACCCAGGCTGG + Intergenic
1108608437 13:52063372-52063394 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1108610403 13:52079599-52079621 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1108685781 13:52817771-52817793 GTGCTCAATGTTACCCAGGCTGG + Intergenic
1109250924 13:60020114-60020136 GTGCTCAGTCTATCCCATGCTGG - Intronic
1110517355 13:76430400-76430422 GTTCTCAGTGGAACTAAAACTGG - Intergenic
1111418474 13:87977237-87977259 GTGCTCAATGGTGCCCAAGATGG - Intergenic
1112056288 13:95691751-95691773 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1112599414 13:100840436-100840458 GTGGTCAGTGTAATCCAAGGAGG + Intergenic
1113193881 13:107782352-107782374 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1113479111 13:110606982-110607004 GTGCTCAGTGGTGCCCAGGCTGG - Intergenic
1113735858 13:112678739-112678761 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1114165061 14:20212359-20212381 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1114174674 14:20309642-20309664 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1114198988 14:20505613-20505635 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1114427555 14:22636713-22636735 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1114578649 14:23736628-23736650 GTGCTCAATGTTGCCCAAGCTGG + Intergenic
1115259570 14:31437870-31437892 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1115531450 14:34331887-34331909 GTCCTCAGGGGCACCCAGGCTGG + Intronic
1115689064 14:35825281-35825303 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1115703861 14:35978329-35978351 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1115847787 14:37556233-37556255 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1117276892 14:54202918-54202940 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1117411827 14:55456968-55456990 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1117475707 14:56092649-56092671 GTTCTCACTGGAGCCCAAGTGGG + Intergenic
1117596767 14:57333389-57333411 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1117763774 14:59059363-59059385 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1118239106 14:64038538-64038560 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1118341366 14:64896377-64896399 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1118423435 14:65633318-65633340 GTGCTCAGTGGTGCCCAGGCTGG + Intronic
1118428735 14:65693203-65693225 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1118584588 14:67340973-67340995 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1119254705 14:73185302-73185324 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1119595105 14:75925747-75925769 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1119700196 14:76749927-76749949 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1119868632 14:77994222-77994244 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1120086981 14:80286297-80286319 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1120309984 14:82814984-82815006 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1120505896 14:85353166-85353188 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1120547703 14:85830349-85830371 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1120892764 14:89505574-89505596 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1121143016 14:91558043-91558065 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1121306913 14:92912389-92912411 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1121531476 14:94657723-94657745 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1122145842 14:99688448-99688470 CTGCTCAGTGGAGCCCAGGAAGG - Intronic
1122212190 14:100180588-100180610 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1122238097 14:100344382-100344404 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1122517302 14:102317902-102317924 GTGCTCAGCTGAACAAAAGCCGG + Intronic
1122568656 14:102677897-102677919 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1122957872 14:105079747-105079769 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1202848017 14_GL000009v2_random:199728-199750 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1202917495 14_GL000194v1_random:190281-190303 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1123666061 15:22610120-22610142 GTGACCAGTGGAACCGAGGCTGG + Intergenic
1124100632 15:26689695-26689717 GTGCTGGGTGGTCCCCAAGCAGG + Intronic
1124132802 15:27004644-27004666 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1124239934 15:28020401-28020423 GTCCTCAGTGGGACTCAGGCAGG - Intronic
1124245696 15:28069701-28069723 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1124319884 15:28704533-28704555 GTGACCAGTGGAACCGAGGCTGG + Intronic
1124482627 15:30090897-30090919 GTGACCAGTGGAACCGAGGCTGG - Intronic
1124520950 15:30406321-30406343 GTGACCAGTGGAACCGAGGCTGG + Intronic
1124537712 15:30559898-30559920 GTGACCAGTGGAACCGAGGCTGG - Intronic
1124564131 15:30799395-30799417 GTGACCAGTGGAACCGAGGCTGG - Intergenic
1124607779 15:31184265-31184287 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
1124619041 15:31263820-31263842 GTGCTCAGTGGAACCTTTTCAGG - Intergenic
1124754445 15:32395335-32395357 GTGACCAGTGGAACCGAGGCTGG + Intronic
1124760944 15:32447688-32447710 GTGACCAGTGGAACCGAGGCTGG + Intronic
1124777690 15:32601375-32601397 GTGACCAGTGGAACCGAGGCTGG - Intronic
1124795817 15:32777233-32777255 CTGCTAAGTGGATCACAAGCCGG - Intronic
1125459779 15:39894927-39894949 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1125566441 15:40682392-40682414 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1125651346 15:41320582-41320604 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1125861441 15:43004678-43004700 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1125862689 15:43014181-43014203 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1125868377 15:43076279-43076301 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1125878130 15:43167820-43167842 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1126125830 15:45293647-45293669 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1126295254 15:47132049-47132071 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1126517312 15:49550978-49551000 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1126571518 15:50158054-50158076 GTGCTCAGTGGTGCCCAGGCTGG + Intronic
1126799327 15:52285768-52285790 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1126902477 15:53328438-53328460 GTGTTGAGTGGAACCCCAGAGGG - Intergenic
1127072786 15:55302373-55302395 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1127153982 15:56109345-56109367 GTGCTCATTGGTGCCCAGGCTGG + Intronic
1127584140 15:60366148-60366170 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1127783081 15:62332987-62333009 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1127874196 15:63098574-63098596 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1128208158 15:65870476-65870498 CTACTCAGTGGCACCCAACCCGG + Intronic
1128380199 15:67106743-67106765 GTGCTCAGTGGCTACCACGCGGG - Intronic
1128490365 15:68136298-68136320 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1128597587 15:68965210-68965232 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1128970042 15:72100327-72100349 GTGCTCGGTGGTGCCCAGGCTGG + Intronic
1129008627 15:72396154-72396176 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1129054264 15:72807765-72807787 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1129313663 15:74728571-74728593 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1129482963 15:75842877-75842899 GTCCTCACAGGAACCCAGGCTGG + Intergenic
1130340953 15:82998867-82998889 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1130428483 15:83822891-83822913 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1130522310 15:84672566-84672588 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1130862666 15:87904794-87904816 GTGCTCTGTGGAGTCCCAGCTGG - Intronic
1130946845 15:88554175-88554197 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1131001532 15:88942407-88942429 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1131043987 15:89297457-89297479 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1131127054 15:89867311-89867333 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1131141098 15:89977750-89977772 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1131416417 15:92263351-92263373 TAGCTCAATGGAAGCCAAGCAGG - Intergenic
1131479489 15:92769016-92769038 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1131507981 15:93033061-93033083 GTGCCCAGAGGAGCCAAAGCGGG + Intergenic
1132037083 15:98493503-98493525 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1132300879 15:100774692-100774714 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1132432771 15:101774319-101774341 GTGACCAGTGGAACCGAGGCTGG + Intergenic
1132921932 16:2400459-2400481 GTGCTCAGTGGTGCCCAGGCTGG - Intergenic
1132992364 16:2802578-2802600 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1133401503 16:5490616-5490638 GTGCCCAGAGGAACCAAGGCAGG - Intergenic
1133680302 16:8114713-8114735 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1133752205 16:8733528-8733550 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1133787029 16:8981775-8981797 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
1134082884 16:11336399-11336421 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1134133547 16:11665725-11665747 GGGCTCACTGTCACCCAAGCTGG + Intergenic
1134471931 16:14533102-14533124 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1134750253 16:16619538-16619560 GTGCTCAGTGTTGCCCAGGCTGG - Intergenic
1134854410 16:17506506-17506528 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1134995207 16:18734060-18734082 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
1135639814 16:24109803-24109825 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1136155073 16:28377028-28377050 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1136160439 16:28416145-28416167 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1136165064 16:28448242-28448264 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1136197901 16:28666738-28666760 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1136202656 16:28699169-28699191 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1136208018 16:28738234-28738256 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1136214248 16:28780915-28780937 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1136258967 16:29060760-29060782 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1136425646 16:30168459-30168481 GTGCTCGGTGGTGCCCAGGCTGG + Intergenic
1136572015 16:31103932-31103954 GTGCTCTGTGGTGCCCAGGCTGG + Intergenic
1136593449 16:31231905-31231927 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1136668450 16:31836060-31836082 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1137240906 16:46653820-46653842 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1137283750 16:46999757-46999779 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1137303778 16:47180682-47180704 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1137493372 16:48951395-48951417 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1137523128 16:49210899-49210921 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1137873339 16:51971815-51971837 CTGCTCACTGGAAGTCAAGCAGG + Intergenic
1138028112 16:53538876-53538898 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1138043277 16:53697661-53697683 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1138370149 16:56520129-56520151 CTGCGCAGTGGAACCCCTGCTGG + Exonic
1138400686 16:56740722-56740744 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1138467391 16:57201655-57201677 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1138642699 16:58397503-58397525 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1138699444 16:58846743-58846765 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1139394652 16:66630637-66630659 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1139556219 16:67712586-67712608 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1139888073 16:70225153-70225175 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1140063187 16:71589138-71589160 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1141196622 16:81865787-81865809 GTGCCCAGTGGAGCCCATCCTGG - Intronic
1141196693 16:81866072-81866094 GTGCCCAGTGGAGCCCATCCTGG - Intronic
1141196836 16:81866698-81866720 GTGCCCAGTGGAGCCCATCCTGG - Intronic
1141728843 16:85808671-85808693 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1142332215 16:89462368-89462390 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1142529751 17:571842-571864 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1142533498 17:598260-598282 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1142629492 17:1215538-1215560 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1142634367 17:1247591-1247613 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1142657513 17:1403716-1403738 GTGCTCAGTGGTGCCCAGGCTGG - Intergenic
1142705372 17:1690316-1690338 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1142818447 17:2446880-2446902 GTGCTCAGTGGTGCCCAGGCTGG + Intronic
1142825224 17:2506585-2506607 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1142913312 17:3113303-3113325 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
1142940006 17:3372520-3372542 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1142949098 17:3464279-3464301 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1142963307 17:3564704-3564726 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1143115350 17:4578723-4578745 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1143277310 17:5721597-5721619 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
1143342683 17:6225963-6225985 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1143689543 17:8549987-8550009 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1143742240 17:8963292-8963314 GTGCTCAGTGGAACCCAAGCTGG + Intronic
1144509912 17:15867084-15867106 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1144536257 17:16094864-16094886 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1144788538 17:17845082-17845104 GGGCTAAGTGGAACCCACTCTGG + Intronic
1144799099 17:17912882-17912904 GTGCTCAGTGGTGCCCCGGCTGG - Intronic
1144860301 17:18297722-18297744 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1145022160 17:19441119-19441141 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1145047404 17:19628590-19628612 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1145174017 17:20684703-20684725 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1145418002 17:22740808-22740830 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1145717075 17:27033412-27033434 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1145733534 17:27211690-27211712 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1145862702 17:28223365-28223387 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1145896025 17:28458482-28458504 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1145920373 17:28604951-28604973 GTGCTCAGTGGTGCCCAGGCTGG - Intronic
1145927716 17:28659937-28659959 GTGCTCAGTGTTGCCCAGGCTGG - Intronic
1146048986 17:29533537-29533559 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1146155767 17:30523031-30523053 GTGCTCAATGGTGCCCAGGCTGG + Exonic
1146187760 17:30736433-30736455 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1146216541 17:30981056-30981078 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1146444621 17:32923517-32923539 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1147172498 17:38630530-38630552 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1147278312 17:39337285-39337307 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1147622229 17:41875741-41875763 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1147784951 17:42972621-42972643 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1148016209 17:44524324-44524346 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1148269698 17:46253445-46253467 GTGCTCAGTGGTGCCCAGGCTGG - Intergenic
1148404151 17:47397311-47397333 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1148406346 17:47420246-47420268 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1149547513 17:57514950-57514972 GTGCTCTGTGTAAGGCAAGCAGG - Intronic
1149625219 17:58074909-58074931 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1149632914 17:58142128-58142150 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1149793510 17:59499753-59499775 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1150213798 17:63456112-63456134 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1150380525 17:64716322-64716344 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1150527229 17:65937115-65937137 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1150621112 17:66808263-66808285 CTGCTAAGTGGAACCCAGGTGGG - Exonic
1150894740 17:69196709-69196731 GTGCTCAGTGTTGCCCAGGCTGG - Intronic
1152019993 17:77775966-77775988 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1152129029 17:78465229-78465251 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1152672583 17:81617956-81617978 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1152696334 17:81798557-81798579 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1153007756 18:512717-512739 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1153221839 18:2868492-2868514 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1153605577 18:6828047-6828069 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1153633950 18:7098148-7098170 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1153646918 18:7203931-7203953 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1154158052 18:11959351-11959373 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1154265043 18:12873587-12873609 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1154278763 18:12981400-12981422 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1154290067 18:13098876-13098898 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1154398449 18:14011547-14011569 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
1154990404 18:21593287-21593309 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1155847195 18:30722967-30722989 GTTCTCAGTGGCCTCCAAGCAGG + Intergenic
1155956343 18:31959829-31959851 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1156299636 18:35825160-35825182 GGGGACAGAGGAACCCAAGCTGG + Intergenic
1156326457 18:36078347-36078369 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1156604414 18:38649239-38649261 AAGATAAGTGGAACCCAAGCAGG + Intergenic
1157629594 18:49081200-49081222 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1157677557 18:49578719-49578741 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1158148439 18:54342760-54342782 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1158459454 18:57633568-57633590 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1159340561 18:67127373-67127395 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1160182108 18:76645230-76645252 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1160228509 18:77029107-77029129 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1160522740 18:79518091-79518113 GTGCTCAGTGGGTCTCCAGCTGG + Intronic
1160916696 19:1499945-1499967 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1161013705 19:1972505-1972527 GAAGTCAGTGGATCCCAAGCAGG - Intronic
1161067809 19:2247204-2247226 TGGCCCAGTGGAGCCCAAGCAGG - Intronic
1161595057 19:5146909-5146931 GGTCTCAGTGTCACCCAAGCTGG - Intronic
1161685663 19:5701630-5701652 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1161790106 19:6355122-6355144 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1162163765 19:8739077-8739099 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1162278860 19:9679640-9679662 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1162694963 19:12467440-12467462 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1163142934 19:15362657-15362679 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1163542113 19:17917897-17917919 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1163558626 19:18006323-18006345 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1163896578 19:20064945-20064967 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1163913012 19:20214196-20214218 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1163921664 19:20296062-20296084 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1163945618 19:20530924-20530946 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1164040306 19:21487434-21487456 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1164047121 19:21551942-21551964 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1164064930 19:21707651-21707673 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1164066325 19:21720648-21720670 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1164071722 19:21775493-21775515 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1164081939 19:21866564-21866586 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1164106223 19:22108420-22108442 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1164168228 19:22700985-22701007 GTGCTCAGTGTTGCCCAGGCTGG - Intergenic
1164168648 19:22703551-22703573 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1164186308 19:22872095-22872117 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1164256748 19:23534028-23534050 GTGCTCAGTGTTGCCCAGGCTGG - Intronic
1164260929 19:23568174-23568196 GTGCTCAGTGTTGCCCAGGCTGG + Intronic
1164263820 19:23594458-23594480 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1164298616 19:23937841-23937863 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1165193203 19:34080289-34080311 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1165199264 19:34132171-34132193 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1165295538 19:34922708-34922730 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1165540717 19:36490773-36490795 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1165727829 19:38124698-38124720 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1165842763 19:38798508-38798530 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1165852286 19:38856379-38856401 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
1166028750 19:40109413-40109435 GTGCTCAATGGTGCCCATGCTGG - Intergenic
1166029652 19:40117479-40117501 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1166115164 19:40648865-40648887 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1166163217 19:40967120-40967142 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1166418143 19:42610967-42610989 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1166640109 19:44488563-44488585 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1166832630 19:45647852-45647874 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1166999558 19:46737940-46737962 TTGCACAGGGGGACCCAAGCGGG + Intronic
1167038689 19:47009418-47009440 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1167540777 19:50086054-50086076 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1167547998 19:50140731-50140753 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1167588815 19:50391394-50391416 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1167897618 19:52594014-52594036 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1167907728 19:52676280-52676302 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1167924393 19:52811191-52811213 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1167937334 19:52919457-52919479 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1167971171 19:53188276-53188298 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1167975400 19:53222569-53222591 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1167980370 19:53270366-53270388 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1168658187 19:58146850-58146872 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1168700112 19:58432994-58433016 GTGCTCAGCTGAACCGATGCTGG - Exonic
924970847 2:126504-126526 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
925035746 2:684193-684215 GTGCTCAGTGGTACCCTTGGTGG - Intergenic
925400603 2:3569689-3569711 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
925403744 2:3591942-3591964 GTGCTCAGTGGTGCCCAGGCTGG - Intergenic
926215654 2:10903564-10903586 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
927705631 2:25294839-25294861 GAGCTCAGCTGAGCCCAAGCTGG - Intronic
927757963 2:25723859-25723881 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
927777157 2:25911303-25911325 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
927833446 2:26371557-26371579 GTGCTCAATGGCGCCCAGGCTGG - Intronic
927978615 2:27359054-27359076 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
928003347 2:27541085-27541107 GTGCTCAATGGTGCCCAGGCTGG - Intronic
928005558 2:27558597-27558619 GTGCTCAATGGTGCCCAGGCTGG - Intronic
928542311 2:32294763-32294785 GTGCTCAATGGTGCCCAGGCTGG - Intronic
928585632 2:32755279-32755301 GTGCTCAATGGTGCCCAGGCTGG - Intronic
928687285 2:33761883-33761905 GTGCTCAGTGCTGCCCAGGCTGG - Intergenic
928888706 2:36179615-36179637 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
929062145 2:37933468-37933490 GTGCTCAATGGTGCCCAGGCTGG - Intronic
929110551 2:38402995-38403017 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
929238441 2:39628886-39628908 GTGCTCAATGGCACCCAGGCTGG - Intergenic
929415879 2:41746377-41746399 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
929445121 2:41995347-41995369 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
929516385 2:42606776-42606798 GTGCTCAATGGTGCCCAGGCTGG - Intronic
929545787 2:42854600-42854622 GTGCTCAGGGGAGGACAAGCAGG + Intergenic
929577884 2:43063704-43063726 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
929650911 2:43678406-43678428 GTGCTCAATGGTGCCCAGGCTGG - Intronic
929690421 2:44068030-44068052 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
929739410 2:44587777-44587799 GTGCTCAATGGTGCCCAGGCTGG + Intronic
930079491 2:47434222-47434244 GTGCTCAATGGTGCCCAGGCTGG - Intronic
930202407 2:48557631-48557653 GTGCTCAATGGTGCCCAGGCTGG - Intronic
930208942 2:48615169-48615191 GTGCTCAATGGTGCCCAGGCTGG - Intronic
930338574 2:50083020-50083042 AAGCTCAGTGAAACCCAAACAGG - Intronic
930396494 2:50828925-50828947 GTGCTCAATGGTGCCCAGGCTGG - Intronic
930665691 2:54096529-54096551 GTGCTCAGTGGTGCCCAGGCTGG - Intronic
930703841 2:54485490-54485512 GTGCTCAATGGTGCCCAGGCTGG + Intronic
930834071 2:55774438-55774460 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
931576291 2:63722028-63722050 GTGCTCAATGGTGCCCAGGCTGG + Intronic
931584137 2:63808641-63808663 GTGCTCAATGGTGCCCAGGCTGG + Intronic
931604857 2:64042158-64042180 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
931656426 2:64512916-64512938 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
931751964 2:65338597-65338619 GTGCTCAATGGTGCCCAGGCTGG + Intronic
931783833 2:65601538-65601560 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
932275863 2:70451823-70451845 ATTCCCAGTGGGACCCAAGCAGG + Intronic
932367149 2:71160753-71160775 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
932710935 2:74062117-74062139 GTGCTCAATGGTGCCCAGGCTGG - Intronic
932807651 2:74796726-74796748 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
932903370 2:75724893-75724915 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
933734856 2:85487363-85487385 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
934188326 2:89764744-89764766 GGGCTCAGTGGAGCCTTAGCCGG - Intergenic
934308275 2:91843211-91843233 GGGCTCAGTGGAGCCTGAGCCGG + Intergenic
934548971 2:95243149-95243171 GTGCTCAGTGGTGCCCAGGCTGG + Intronic
934703334 2:96461091-96461113 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
935630939 2:105211611-105211633 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
935636103 2:105250953-105250975 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
935701041 2:105812220-105812242 GTGCACAGTGGTTCCCAGGCAGG - Intronic
936158310 2:110064339-110064361 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
936186352 2:110306987-110307009 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
936345518 2:111672375-111672397 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
937168871 2:119844949-119844971 GTGCTCAATGGTGCCCAGGCTGG - Intronic
937437486 2:121892364-121892386 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
937947372 2:127352998-127353020 GTGCTCAATGGTGCCCAGGCTGG + Intronic
938006289 2:127789397-127789419 GTGCTCAATGGTGCCCAGGCTGG - Intronic
938720535 2:134063711-134063733 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
938822068 2:134969046-134969068 GTGCTCAATGGTGCCCAGGCTGG - Intronic
938829231 2:135034504-135034526 GTGCTCAATGGTGCCCAGGCTGG - Intronic
939477175 2:142702217-142702239 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
940299030 2:152160028-152160050 GTGCTCAATGGTGCCCAGGCTGG + Intronic
940635474 2:156293161-156293183 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
940643146 2:156367860-156367882 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
940652525 2:156452250-156452272 GTGCTCAATGGTGCCCAGGCTGG - Intronic
941024110 2:160439751-160439773 GTGCTCAGTGGTGCCCAGGCTGG - Intronic
941197471 2:162470006-162470028 GTGCTCAATGGTGCCCAGGCTGG + Intronic
941603316 2:167564559-167564581 GTGCTCGGTGGTGCCCAGGCTGG - Intergenic
941768615 2:169326515-169326537 GTGCTCAATGGTGCCCAGGCTGG + Intronic
941786516 2:169505254-169505276 GTGCTCAATGGTGCCCAGGCTGG + Exonic
941814927 2:169787068-169787090 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
941847651 2:170149337-170149359 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
942021137 2:171867329-171867351 GTGCTCAATGGTGCCCAGGCTGG - Intronic
942024573 2:171899538-171899560 GTGCTCAATGGTGCCCAGGCTGG + Intronic
942096055 2:172537471-172537493 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
942312583 2:174669174-174669196 CTGCTGAGTGGTACCCAGGCTGG + Intronic
942621146 2:177845727-177845749 GTGCTCAATGGTGCCCAGGCTGG - Intronic
942630018 2:177945119-177945141 GTGCTCAATGGTGCCCAGGCTGG + Intronic
942913712 2:181277364-181277386 TTGGTCAGTGGCACTCAAGCTGG - Intergenic
943297302 2:186154707-186154729 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
943323329 2:186472548-186472570 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
943740135 2:191398962-191398984 GTGCTCAATGGTGCCCAGGCTGG - Intronic
943773266 2:191741516-191741538 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
944060589 2:195567482-195567504 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
944255216 2:197618385-197618407 GTGCTCAATGGTGCCCAGGCTGG + Intronic
944283673 2:197923854-197923876 GTGCTCAATGGTGCCCAGGCTGG - Intronic
944533164 2:200684448-200684470 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
944598989 2:201284372-201284394 GTGCTCAATGGTGCCCAGGCTGG - Intronic
944674716 2:202025662-202025684 GGGCTCAGTGGATCCCAAAAGGG + Intergenic
944733177 2:202535781-202535803 GTGCTCAATGGTGCCCAGGCTGG - Intronic
944751693 2:202715778-202715800 GTGCTCAATGGTGCCCAGGCTGG - Intronic
944797838 2:203206718-203206740 GTGCTCAATGGTGCCCAGGCTGG + Intronic
944815694 2:203373159-203373181 GTGCTCAATGGTGCCCAGGCTGG - Intronic
945090484 2:206172295-206172317 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
945110764 2:206357451-206357473 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
945232835 2:207610097-207610119 GTGCTCAATGGTGCCCAGGCTGG + Exonic
945970556 2:216227251-216227273 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
946049697 2:216852252-216852274 GAGCCCAGTGGATCCCAGGCTGG + Intergenic
946304076 2:218846199-218846221 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
946318023 2:218931098-218931120 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
946742469 2:222815856-222815878 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
947402231 2:229742478-229742500 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
947797690 2:232905401-232905423 GTGCTCAATGGTGCCCAGGCTGG + Intronic
947901508 2:233724895-233724917 GTGCTCAATGGTGCCCAGGCTGG - Intronic
948000338 2:234562465-234562487 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
948390237 2:237606692-237606714 GTGCTCAGAAGGACCCAGGCTGG - Intergenic
948615759 2:239197881-239197903 GTGCTGAGTGTCACCCAGGCTGG + Intronic
948651765 2:239450074-239450096 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
1169085546 20:2823366-2823388 GTGCTCAGTGGTGTCCAGGCTGG + Intergenic
1169108969 20:3019770-3019792 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1169246776 20:4032149-4032171 GTGCTCAGTGGTGTCCAGGCTGG + Intergenic
1169370715 20:5027184-5027206 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1169441875 20:5639697-5639719 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1169449774 20:5701651-5701673 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1169718170 20:8644094-8644116 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1170645599 20:18194205-18194227 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1170664642 20:18375991-18376013 GTGCTCAATGTTGCCCAAGCTGG - Intergenic
1170811737 20:19679199-19679221 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1171366248 20:24626772-24626794 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1171496713 20:25561336-25561358 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1171848596 20:30292348-30292370 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1171861129 20:30404517-30404539 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1171900003 20:30847635-30847657 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1171951517 20:31426599-31426621 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1171957610 20:31472099-31472121 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1172051740 20:32122865-32122887 GTGCTCAATGGCGCCCAGGCTGG - Intronic
1172058938 20:32175631-32175653 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1172068663 20:32239902-32239924 GTGTTCAAAGGAACCAAAGCTGG + Intergenic
1172141061 20:32723433-32723455 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1172199504 20:33115262-33115284 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1172209330 20:33185891-33185913 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1172279188 20:33698788-33698810 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1172279839 20:33701068-33701090 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1172348435 20:34222927-34222949 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1172379360 20:34475351-34475373 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1172401839 20:34658292-34658314 GTGCTCAGTGGTGCCCAGGCTGG + Intronic
1172465433 20:35153162-35153184 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1172575158 20:36002093-36002115 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1172717865 20:36977351-36977373 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1172720864 20:36999791-36999813 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1172722669 20:37012162-37012184 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1172728775 20:37069137-37069159 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1172735712 20:37125519-37125541 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1172918686 20:38462237-38462259 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1173273281 20:41555948-41555970 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1173473109 20:43338726-43338748 GTGCTCAGTGTTGCCCAGGCTGG - Intergenic
1173769705 20:45646474-45646496 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1174020765 20:47526457-47526479 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1174284220 20:49460927-49460949 GTGCTCAGTGGAACAAGGGCGGG - Intronic
1174295377 20:49541805-49541827 TTGCTCTGTGGAAGCGAAGCCGG + Intronic
1174344747 20:49921749-49921771 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1174835727 20:53854115-53854137 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1175361566 20:58414921-58414943 GTGCTCGGTGGTGCCCAGGCTGG - Intronic
1175613421 20:60371651-60371673 GTCCTCTGTGGAAGCCAAGGAGG - Intergenic
1175776029 20:61654121-61654143 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1176348545 21:5771503-5771525 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1176355359 21:5892087-5892109 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1176496282 21:7552952-7552974 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1176542866 21:8169573-8169595 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1176561817 21:8352618-8352640 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1176656795 21:9594220-9594242 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1177134305 21:17292789-17292811 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1177788405 21:25696084-25696106 GTGCTCAGTGTTGCCCAGGCTGG - Intronic
1178075405 21:29010967-29010989 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1178158321 21:29880966-29880988 TTGTTCAGTGGCACCCAACCTGG - Intronic
1178162738 21:29938676-29938698 TTGCTCAGTGGCAGGCAAGCGGG + Intronic
1179195099 21:39156928-39156950 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1179969058 21:44824381-44824403 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1180535359 22:16390290-16390312 GGGCTCAGTGGAGCCTGAGCCGG + Intergenic
1180672001 22:17560918-17560940 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1180739390 22:18042083-18042105 GTGCTCAATGGTACCCAGGCTGG - Intergenic
1180830146 22:18900930-18900952 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1181301644 22:21884477-21884499 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1181427614 22:22854538-22854560 GTCCTCACTGCAGCCCAAGCAGG - Intronic
1181585997 22:23854115-23854137 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1181598780 22:23936740-23936762 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1182199258 22:28553086-28553108 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1182331022 22:29552084-29552106 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1182343743 22:29644617-29644639 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1182377506 22:29858663-29858685 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1182538771 22:31026578-31026600 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1182616957 22:31593692-31593714 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1182976421 22:34626671-34626693 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1182982548 22:34684971-34684993 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1183037553 22:35151589-35151611 GTGCTCAGTGGAAGACAGGCTGG - Intergenic
1183183606 22:36278553-36278575 TAGCTCAGTGGATCCCAAACAGG + Intergenic
1183185667 22:36290446-36290468 GTGCTCAATGGAGCCCAGGCTGG + Intronic
1183434643 22:37786526-37786548 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1183595102 22:38806594-38806616 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1183871839 22:40746091-40746113 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1183882185 22:40842704-40842726 ATGCTCACTGAATCCCAAGCAGG + Intronic
1183995851 22:41631824-41631846 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1184066418 22:42124239-42124261 CTGCTCAGTTGGACCCACGCTGG - Intergenic
1184068886 22:42136391-42136413 CTGCTCAGTTGGACCCACGCTGG - Intergenic
1184169557 22:42750943-42750965 GTGCTCAGTGGCGCCCAGGCTGG - Intergenic
1184202505 22:42980786-42980808 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1184477305 22:44728710-44728732 GCTCCCAGTGGAACCCAAGCAGG - Intronic
1184671925 22:46017351-46017373 GTGCTCAGTGAATGCCAAGTAGG - Intergenic
1185176960 22:49333353-49333375 GTGCACAGAGAAACCCAGGCAGG - Intergenic
1203247732 22_KI270733v1_random:85816-85838 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1203280235 22_KI270734v1_random:126201-126223 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
949096815 3:96192-96214 CTTCTCAGTGGAACACAAGAGGG - Intergenic
949330528 3:2916998-2917020 GTGCTCAATGGTGCCCAGGCTGG - Intronic
949535222 3:4989903-4989925 GGTCTCAGGGGAATCCAAGCAGG + Intergenic
949551259 3:5114350-5114372 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
949565742 3:5243176-5243198 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
949853219 3:8439351-8439373 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
949988648 3:9559696-9559718 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
949989808 3:9569748-9569770 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
950044364 3:9940364-9940386 GTGCTCAATGGTGCCCAGGCTGG - Intronic
950060713 3:10069761-10069783 GTGCTCAATGGTGCCCAGGCTGG + Intronic
950412831 3:12850218-12850240 GTGCTCAGTGGTGCCCAGGCTGG - Intronic
950742284 3:15061515-15061537 GTGCTCAATGGTGCCCAGGCTGG + Intronic
950755021 3:15163837-15163859 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
950764816 3:15265899-15265921 GTGCCCAGTGGTGCCCATGCGGG - Intronic
950819405 3:15742036-15742058 GTGCTCAATGGTGCCCAGGCTGG + Intronic
950949280 3:16980832-16980854 GTGCTCAATGGTGCCCAGGCTGG - Intronic
951290595 3:20867487-20867509 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
951550642 3:23872069-23872091 GTGCTCAATGGTGCCCAGGCTGG - Intronic
952308767 3:32169390-32169412 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
952364597 3:32663774-32663796 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
953037680 3:39227361-39227383 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
953425888 3:42797247-42797269 GTGCTCAGTGGTGCCCAGGCTGG + Intronic
953922709 3:46963755-46963777 GTGCTCAATGGTGCCCAGGCTGG + Intronic
953959414 3:47256059-47256081 GTGCTCAATGGTGCCCAGGCTGG + Intronic
954059181 3:48055503-48055525 GTGCTCAATGGTGCCCAGGCTGG + Intronic
954162624 3:48733806-48733828 GTGCTCAATGGTGCCCAGGCTGG + Intronic
954331923 3:49895807-49895829 GTGCTCTGTGGGACCCCATCTGG + Exonic
954356381 3:50085544-50085566 GTGCTCAATGGTGCCCAGGCTGG - Intronic
954523216 3:51248492-51248514 GTGCTCAATGGCGCCCAGGCTGG + Intronic
954529887 3:51309280-51309302 GTGCTCAATGGTGCCCAGGCTGG - Intronic
955363218 3:58291075-58291097 GTGCTCAATGGTGCCCAGGCTGG - Intronic
955395026 3:58550828-58550850 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
955410766 3:58654034-58654056 GGGCTAAGTGGAGCCCAGGCAGG - Intronic
955435046 3:58891121-58891143 GTGCTCAATGGTGCCCAGGCTGG - Intronic
955674673 3:61435425-61435447 GTGCTCAATGGTGCCCAAGCTGG - Intergenic
955699917 3:61672416-61672438 GTGCTCAATGGTGCCCAGGCTGG - Intronic
957035341 3:75289008-75289030 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
957316912 3:78584016-78584038 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
957459507 3:80497952-80497974 GTGCTCTGTGGAGCCCATGGGGG - Intergenic
957620020 3:82584167-82584189 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
958482270 3:94657769-94657791 GGGCTCGGAGGATCCCAAGCAGG + Intergenic
958809034 3:98838743-98838765 GTGCTCAATGGTGCCCAGGCTGG - Intronic
958912221 3:100006673-100006695 GGGCTGAGTGCAACCCAAGCTGG - Intronic
958957607 3:100478672-100478694 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
959201819 3:103255597-103255619 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
959415870 3:106075485-106075507 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
959586139 3:108026576-108026598 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
959683663 3:109123672-109123694 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
960030224 3:113047239-113047261 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
960388532 3:117050345-117050367 GTGCTCAATGGTGCCCAGGCTGG + Intronic
960526813 3:118719083-118719105 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
960697957 3:120414080-120414102 GTGCTCAATGGTGCCCAGGCTGG + Intronic
960817444 3:121688485-121688507 GTGCTCAATGGTGCCCAGGCTGG + Intronic
960861894 3:122163991-122164013 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
960866182 3:122202115-122202137 GTGCTCAATGGTGCCCAGGCTGG - Intronic
960920881 3:122746952-122746974 GTGCTCAATGGTGCCCAGGCTGG + Intronic
960924536 3:122781251-122781273 GTGCTCAATGGTGCCCAGGCTGG - Intronic
961120878 3:124368758-124368780 GTGCTCAATGGTGCCCAGGCTGG - Intronic
961164009 3:124751044-124751066 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
961704309 3:128772889-128772911 GTGCTCAGTGTTGCCCAGGCTGG + Intronic
961729091 3:128953904-128953926 GTGCTCAATGGTGCCCAGGCTGG + Intronic
961784617 3:129340494-129340516 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
961962299 3:130867589-130867611 GTGCTCAATGGTGCCCAGGCTGG + Intronic
962113183 3:132471942-132471964 GTGCTCAATGGTGCCCAGGCTGG - Intronic
962572061 3:136722991-136723013 GTGCTCAATGGTGCCCAGGCTGG + Intronic
962623173 3:137198976-137198998 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
962761714 3:138521107-138521129 GTGCTCAATGCTGCCCAAGCTGG + Intronic
963249201 3:143087284-143087306 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
963498268 3:146096186-146096208 GTGCTCAATGGTGCCCAGGCTGG + Intronic
963911728 3:150821532-150821554 GTGCTCAGTGGTGCCCAGGCTGG - Intergenic
964765848 3:160178371-160178393 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
965328134 3:167333628-167333650 GTGTTCAGTGGAATCAAAGCAGG + Intronic
965649957 3:170923299-170923321 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
966015642 3:175133418-175133440 GTGCTCAATGGTGCCCAGGCTGG - Intronic
966253565 3:177892275-177892297 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
966375480 3:179291404-179291426 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
966420314 3:179728678-179728700 GTGCTCAATGGTGCCCAGGCTGG - Intronic
967175980 3:186863840-186863862 GTGCTCAGTGGTGTCCAGGCTGG + Intergenic
967177389 3:186873558-186873580 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
967946801 3:194810549-194810571 GTGCTCAGTGCAACTAAATCTGG - Intergenic
968201944 3:196762393-196762415 GTGCTCAATGGTGCCCAGGCTGG - Intronic
968226130 3:196973497-196973519 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
968299652 3:197602889-197602911 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
968411542 4:395289-395311 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
968429971 4:551108-551130 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
968507044 4:975643-975665 GTGCTCAATGGTGCCCAGGCTGG + Intronic
968852917 4:3095223-3095245 GTGCTCAGTGTTGCCCAGGCTGG - Intronic
968924414 4:3539405-3539427 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
969311401 4:6354798-6354820 GTGGGCGGAGGAACCCAAGCTGG - Intronic
969404060 4:6977420-6977442 GTGCTCAATGGTGCCCAGGCTGG + Intronic
969799481 4:9551612-9551634 GTGCTCAGTGGAACAGGTGCTGG + Intergenic
969860713 4:10033537-10033559 ATGCTCAGAGGAAGCCAGGCTGG - Intronic
970216210 4:13761781-13761803 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
970409126 4:15790475-15790497 GTGCTCGGTGGTGCCCAGGCTGG + Intronic
970472850 4:16393997-16394019 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
970663217 4:18309179-18309201 GTGCTGCGTGGAACCTGAGCCGG + Intergenic
971282165 4:25249916-25249938 GTGCTCAGTGTTGCCCAGGCTGG - Intronic
972288170 4:37668515-37668537 GTGCTCAATGGTGCCCAGGCTGG + Intronic
972304628 4:37820130-37820152 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
972552750 4:40148147-40148169 GTGCTCATTGGTGCCCAGGCTGG - Intronic
972654031 4:41048962-41048984 GTGCTCAATGTTACCCAGGCTGG + Intronic
973108982 4:46377034-46377056 GTGCTCAATGGTGCCCAGGCTGG + Intronic
973281626 4:48364572-48364594 GTGCTCAATGGTGCCCAGGCTGG - Intronic
973593304 4:52464403-52464425 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
973673287 4:53239057-53239079 GTGCTCAATGGTGCCCAGGCTGG - Intronic
973675335 4:53256573-53256595 GTGCTCAATGGTGCCCAGGCTGG - Intronic
973753639 4:54049829-54049851 GTGTTCAATGGAACCTAAGACGG - Intronic
974021328 4:56693984-56694006 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
974076491 4:57172837-57172859 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
974082071 4:57224100-57224122 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
975042351 4:69761658-69761680 GTGCTCAATGGTGCCCAGGCTGG + Intronic
975633352 4:76423037-76423059 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
975685468 4:76916351-76916373 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
975793810 4:77984460-77984482 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
975848263 4:78547638-78547660 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
976264966 4:83181776-83181798 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
976340980 4:83944358-83944380 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
976607305 4:86995611-86995633 GTGCTCAATGGTGCCCAGGCTGG + Intronic
977205008 4:94157573-94157595 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
978013958 4:103720901-103720923 GTGCTCGGTGGATTGCAAGCTGG + Intergenic
978409017 4:108409122-108409144 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
978820371 4:112958290-112958312 GTGCTCAATGGTGCCCAGGCTGG - Intronic
978947421 4:114516201-114516223 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
979622261 4:122811491-122811513 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
979641743 4:123016818-123016840 GTGCTCAATGGTGCCCAGGCTGG - Intronic
980056634 4:128084320-128084342 GTGCTCAATGGTGCCCAGGCTGG - Intronic
980895046 4:138853768-138853790 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
981677361 4:147357575-147357597 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
981970305 4:150659016-150659038 GTGCTCAATGGTGCCCAGGCTGG + Intronic
981994730 4:150963484-150963506 GTGCTCAATGGTGCCCAGGCTGG + Intronic
982026276 4:151255723-151255745 GTGCTCAATGGTGCCCAGGCTGG - Intronic
982040297 4:151390470-151390492 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
982053743 4:151527220-151527242 GTGCTCAATGGTGCCCAGGCTGG - Intronic
982709824 4:158747173-158747195 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
982784081 4:159522760-159522782 GTGCTCAATGGTGCCCAAGATGG + Intergenic
982821043 4:159940351-159940373 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
983218257 4:165020644-165020666 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
983400222 4:167254278-167254300 GTGCTCAGCAAAACCCAAGATGG + Intergenic
983604447 4:169569791-169569813 GTGCTCAATGGTGCCCAGGCTGG + Intronic
983652125 4:170046053-170046075 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
984005063 4:174295684-174295706 GTGCTCAATGGTGCCCAGGCTGG - Intronic
984037773 4:174691691-174691713 GTGCTCAATGGTGCCCAGGCTGG + Intronic
984728247 4:183041346-183041368 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
984804352 4:183737485-183737507 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
984977308 4:185241174-185241196 GTGCTCAATGGTGCCCAGGCTGG - Intronic
985216288 4:187657792-187657814 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
985247329 4:187991642-187991664 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
985524595 5:395547-395569 GTGCCCAGTGGCAGCCGAGCAGG + Intronic
985552953 5:542538-542560 GGGCTCAGTGGGCCCCAGGCAGG - Intergenic
985553194 5:543518-543540 GGGCTCAGTGGGCCCCAGGCAGG + Intergenic
985736325 5:1585709-1585731 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
985754488 5:1704919-1704941 GTGCCCAGTGTGACCCCAGCTGG - Intergenic
986053830 5:4116119-4116141 GTGTTCGGTGGAAACCAAGAAGG + Intergenic
987079937 5:14417545-14417567 GTGCTCAGTGGACTCCCAACAGG + Intronic
987268115 5:16277556-16277578 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
987469183 5:18309283-18309305 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
988760792 5:34307406-34307428 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
989021622 5:37013904-37013926 GTGCTCAATGGTGCCCAGGCTGG - Intronic
989048338 5:37295346-37295368 GTGCTCAATGGTGCCCAGGCTGG + Intronic
989061703 5:37416207-37416229 GTGCTCAGTGGTGCCCAGGCTGG - Intronic
989076121 5:37564222-37564244 GTGCTCAATGGTGCCCAGGCTGG - Intronic
989211671 5:38862860-38862882 GTGCTCAATGGTGCCCAGGCTGG - Intronic
989252551 5:39333911-39333933 GTGCTCAATGGTGCCCAGGCTGG + Intronic
989574647 5:42978995-42979017 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
989574931 5:42980132-42980154 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
989633375 5:43510740-43510762 GTGCTCAATGGTGCCCAGGCTGG + Intronic
989634745 5:43521800-43521822 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
989640571 5:43578845-43578867 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
990427130 5:55697258-55697280 GTGCTCAATGGCGCCCAGGCTGG - Intronic
990459209 5:56015669-56015691 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
990462131 5:56039292-56039314 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
990498490 5:56372234-56372256 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
990871137 5:60431769-60431791 GTGCTCAGTGGTGCCCAGGCTGG - Intronic
991073936 5:62514288-62514310 GTGCTCAATGGTGCCCAGGCTGG - Intronic
991127477 5:63084323-63084345 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
991373129 5:65939846-65939868 GTGCTCAATGGTGCCCAGGCTGG + Intronic
991377155 5:65977853-65977875 GTGCTCAATGGTGCCCAGGCTGG - Intronic
991672709 5:69063392-69063414 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
991723778 5:69516193-69516215 GTGCTCAATGGTGCCCAGGCTGG - Intronic
991907426 5:71526135-71526157 GTGCTCAATGGTGCCCAGGCTGG - Intronic
991910225 5:71552516-71552538 GTGCTCAATGGTGCCCAGGCTGG - Intronic
992391798 5:76336589-76336611 GTGCTCGGTGGTGCCCAGGCTGG - Intronic
992442868 5:76811904-76811926 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
992463913 5:76985590-76985612 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
992470228 5:77044276-77044298 GTGCTCAATGGTGCCCAGGCTGG - Intronic
992574348 5:78096310-78096332 GTGCTCAATGGTGCCCAGGCTGG + Intronic
992600290 5:78391703-78391725 GTGCTCAATGGCGCCCAGGCTGG - Intronic
992964315 5:81984123-81984145 GTGCTCAATGGTGCCCAGGCTGG - Intronic
992977894 5:82139141-82139163 GTGCTCAATGGTGCCCAGGCTGG + Intronic
993496504 5:88615529-88615551 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
993658000 5:90596486-90596508 GTGCTCAATGGTGCCCAGGCTGG - Intronic
995123725 5:108559826-108559848 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
995193180 5:109340939-109340961 GTGCTCAATGGTGCCCAGGCTGG + Intronic
995515857 5:112954509-112954531 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
995895082 5:117002590-117002612 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
995942468 5:117600480-117600502 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
996070179 5:119123000-119123022 GTGCTCAATGGTGCCCAGGCTGG - Intronic
997321748 5:132983627-132983649 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
997565410 5:134882539-134882561 GTGCTCAATGGTGCCCAGGCTGG - Intronic
997875083 5:137538775-137538797 GTGCTCAATGGCGCCCAGGCTGG - Intronic
998021980 5:138777554-138777576 GTGCTCAATGGTGCCCAGGCTGG - Intronic
998053523 5:139055970-139055992 GTGCTCAATGGTGCCCAGGCTGG + Intronic
998067328 5:139170166-139170188 GTGCTCAATGGTGCCCAGGCTGG + Intronic
998239597 5:140428332-140428354 GTGCTCAATGGTGCCCAGGCTGG - Intronic
998394780 5:141811655-141811677 GGGCCCAGTGGAACCCATGGGGG + Intergenic
998432315 5:142077039-142077061 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
999181242 5:149671092-149671114 GTGCTCAATGGTGCCCAAGCTGG - Intergenic
999604292 5:153297478-153297500 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
999986895 5:157013842-157013864 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1000032831 5:157419248-157419270 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1000159039 5:158582097-158582119 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1001078022 5:168644129-168644151 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1001394364 5:171404832-171404854 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1002008145 5:176252836-176252858 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1002013526 5:176304486-176304508 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1002031437 5:176433421-176433443 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1002115643 5:176960930-176960952 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1002529493 5:179835382-179835404 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1002658348 5:180771505-180771527 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1002885390 6:1289375-1289397 GTGCCTGGTGGGACCCAAGCTGG - Intergenic
1002937820 6:1688391-1688413 GTGCTGTGTGGAATACAAGCTGG + Intronic
1003319573 6:5038582-5038604 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1004415103 6:15416384-15416406 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1004448937 6:15727013-15727035 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1004664368 6:17736174-17736196 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1004874238 6:19938999-19939021 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1005063708 6:21798067-21798089 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1005158636 6:22836033-22836055 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1005607168 6:27486146-27486168 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1005624783 6:27653201-27653223 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
1005644829 6:27828172-27828194 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
1005837085 6:29718197-29718219 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1005865237 6:29932363-29932385 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1005929714 6:30474781-30474803 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1006004889 6:30993796-30993818 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1006065205 6:31456199-31456221 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1006128640 6:31855063-31855085 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1006149157 6:31976740-31976762 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1006210029 6:32385789-32385811 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1006232543 6:32596494-32596516 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1006282004 6:33060449-33060471 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1006305297 6:33215005-33215027 GTGCTCTGTGACTCCCAAGCAGG + Intergenic
1006346421 6:33486259-33486281 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1006403945 6:33833241-33833263 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1006546541 6:34786124-34786146 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1006617450 6:35340034-35340056 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1006623437 6:35383329-35383351 GTGCTCGGTGGTGCCCAGGCTGG + Intronic
1007522894 6:42466054-42466076 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1008112320 6:47506498-47506520 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1008184446 6:48371757-48371779 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1008553865 6:52656616-52656638 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1008624865 6:53305900-53305922 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1008841719 6:55910682-55910704 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1008919129 6:56824308-56824330 GTGCTCAATGGTACCCAGGCTGG + Intronic
1008926732 6:56895713-56895735 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1010030595 6:71267091-71267113 GTGCTCAATGGTACCCAGGCTGG - Intergenic
1010264532 6:73851649-73851671 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1010400713 6:75442450-75442472 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1010513038 6:76743953-76743975 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1011148763 6:84245310-84245332 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1011476223 6:87751780-87751802 GTGCTCAATGGTGCCCAGGCGGG - Intergenic
1011587967 6:88946943-88946965 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1012428584 6:99141676-99141698 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1012983810 6:105854593-105854615 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1013190804 6:107803043-107803065 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1013204450 6:107934020-107934042 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1013243790 6:108269514-108269536 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1013325884 6:109046382-109046404 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1013681425 6:112528863-112528885 GTGCTCAGTGGTGCCCAGGCTGG - Intergenic
1014557253 6:122850004-122850026 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1014764356 6:125389823-125389845 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1015220734 6:130801940-130801962 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1015643802 6:135364588-135364610 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1016758896 6:147716158-147716180 GTGCTAAGGGCAACCCATGCTGG - Intronic
1016802311 6:148179444-148179466 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
1016973715 6:149786975-149786997 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1017215296 6:151900091-151900113 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1017437989 6:154435755-154435777 GTGCTGAGTGCCACCCAGGCTGG - Intronic
1017465058 6:154686975-154686997 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1017493957 6:154967079-154967101 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1017844156 6:158241441-158241463 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1017851639 6:158309587-158309609 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1018009306 6:159655307-159655329 GAGCTCACTGGCCCCCAAGCAGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018295206 6:162338551-162338573 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1019438981 7:1037544-1037566 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1019445629 7:1069648-1069670 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1019459250 7:1147658-1147680 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1019668897 7:2267611-2267633 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1019674321 7:2302401-2302423 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1019715126 7:2534982-2535004 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1019981238 7:4623648-4623670 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1020285021 7:6672125-6672147 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1020326138 7:6975832-6975854 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1020498781 7:8890258-8890280 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1020831601 7:13102253-13102275 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1021120523 7:16790733-16790755 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1021440115 7:20668021-20668043 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1021647270 7:22800546-22800568 GTGCTCAATGGTGCCCAGGCGGG + Intergenic
1021672583 7:23047070-23047092 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1021735200 7:23636163-23636185 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1022005284 7:26261564-26261586 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1022273994 7:28838491-28838513 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1023044073 7:36196711-36196733 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1023160469 7:37292247-37292269 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1024309731 7:47959121-47959143 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1024538583 7:50459256-50459278 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1024625709 7:51207729-51207751 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1024931397 7:54668433-54668455 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1024989321 7:55220886-55220908 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1025000469 7:55311515-55311537 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1025102762 7:56150058-56150080 GTGCTCAATGGTGCCCAAGATGG + Intergenic
1025573110 7:62600345-62600367 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1025778229 7:64577172-64577194 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1025793559 7:64717623-64717645 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1025796130 7:64739262-64739284 GTGCTCGGTGGTGCCCAGGCTGG - Intergenic
1025800718 7:64784410-64784432 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1025803783 7:64810154-64810176 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1025979635 7:66394768-66394790 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1026007922 7:66614368-66614390 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1026783562 7:73285020-73285042 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1026862196 7:73797778-73797800 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1026868099 7:73835512-73835534 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1027183060 7:75953015-75953037 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1027370955 7:77508711-77508733 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1027374101 7:77534556-77534578 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1027601030 7:80241369-80241391 CTGATTAGTGGAACCCAAACTGG + Intergenic
1028227568 7:88267090-88267112 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1028685734 7:93586782-93586804 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1029279336 7:99426489-99426511 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1029334700 7:99888906-99888928 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1029430245 7:100524262-100524284 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1029469085 7:100742563-100742585 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1029569429 7:101359992-101360014 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1030036431 7:105411441-105411463 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1030602635 7:111609609-111609631 GTGCTCGGTGGTGCCCAGGCTGG + Intergenic
1030692588 7:112551315-112551337 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1030725593 7:112922255-112922277 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1031461328 7:122053006-122053028 CTGCTCAATGGAACCCATGCAGG - Intronic
1032290977 7:130590555-130590577 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1032569434 7:132984362-132984384 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1032589282 7:133177276-133177298 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1032664272 7:134019840-134019862 GAGCTCAGTGGAAATCAAGGGGG - Intronic
1032710553 7:134457106-134457128 GGGCTCAGTGTCACCCAGGCTGG - Intronic
1033219855 7:139520744-139520766 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1033323648 7:140361849-140361871 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1033333008 7:140431278-140431300 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1034034250 7:147802472-147802494 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1034233866 7:149553843-149553865 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1034322399 7:150198143-150198165 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1034638966 7:152586929-152586951 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1034723659 7:153315855-153315877 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1034961932 7:155368130-155368152 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1035044689 7:155955977-155955999 GTGCACAGTGAAACCCAACGTGG + Intergenic
1035601873 8:902006-902028 GTGGTCAGGGGAACCCAGGGGGG + Intergenic
1036095883 8:5725018-5725040 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1036483085 8:9154583-9154605 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1037756379 8:21712703-21712725 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1037881409 8:22575152-22575174 GTGCTGGGAGGAACCCCAGCAGG - Exonic
1038397337 8:27257020-27257042 GTGCTCAGTGGTTTCCAAGAGGG + Intronic
1038559344 8:28557772-28557794 GTGCTAAGTGGAACAAAAGAAGG - Intronic
1038594998 8:28880558-28880580 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1039072382 8:33658919-33658941 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1039153506 8:34529892-34529914 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1039201120 8:35094771-35094793 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1039651050 8:39339828-39339850 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1039881304 8:41626962-41626984 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1040052965 8:43033671-43033693 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1040070126 8:43180789-43180811 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1040785384 8:51158750-51158772 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1040818534 8:51533784-51533806 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1041270598 8:56105307-56105329 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1041287106 8:56272679-56272701 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1041357936 8:57021533-57021555 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1041363040 8:57071977-57071999 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1041513693 8:58676945-58676967 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1041677398 8:60549336-60549358 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1041796773 8:61753778-61753800 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1041920964 8:63180670-63180692 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1042133904 8:65616432-65616454 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1042139222 8:65662397-65662419 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1042195955 8:66231962-66231984 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1042475570 8:69245316-69245338 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1043961714 8:86424501-86424523 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1044223570 8:89698447-89698469 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1044281721 8:90364269-90364291 TTGCTCAGTGGACTCCAAGCAGG - Intergenic
1044507512 8:93038911-93038933 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1045120562 8:99029470-99029492 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1045298805 8:100893215-100893237 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1046599163 8:116297354-116297376 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
1046636156 8:116678292-116678314 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1047388708 8:124432527-124432549 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1048368266 8:133757206-133757228 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1048985773 8:139733960-139733982 GAGGGCAGTGGAACCCAGGCAGG - Intronic
1049177528 8:141202846-141202868 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1049781432 8:144430750-144430772 GTGTTGAGAGGAGCCCAAGCTGG - Intronic
1049892514 9:83611-83633 GTGCTCAATGGGGCCCAGGCTGG - Intergenic
1049976109 9:862198-862220 GTGCTCAGTGTTGCCCAGGCTGG - Intronic
1050534810 9:6622541-6622563 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1050557176 9:6799261-6799283 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1050558058 9:6807187-6807209 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1050571979 9:6949537-6949559 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1051257948 9:15233655-15233677 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1051276748 9:15406125-15406147 GTGCTCGGTGGTGCCCAGGCTGG + Intergenic
1051430749 9:16978027-16978049 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1051662000 9:19434469-19434491 GTGCTCAATGGCGCCCAGGCTGG - Intronic
1052880936 9:33600587-33600609 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1053048004 9:34936368-34936390 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1053467896 9:38324324-38324346 GTGCTCGGTGGTGCCCAGGCTGG + Intergenic
1055134051 9:72806960-72806982 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1055137657 9:72842068-72842090 GTGCTCAATGGTGCCCAGGCAGG - Intergenic
1055241977 9:74197144-74197166 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1055585936 9:77760506-77760528 GTGCTCAATGGTGCCCAAGATGG + Intronic
1055948156 9:81709839-81709861 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1056152386 9:83803552-83803574 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1056336328 9:85573403-85573425 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1056409481 9:86311919-86311941 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1056624978 9:88245639-88245661 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1056670756 9:88625781-88625803 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1056938468 9:90936080-90936102 GTGATCTGGGAAACCCAAGCAGG + Intergenic
1056951698 9:91045226-91045248 GTGCTCACAGGAACCAGAGCTGG + Intergenic
1056990943 9:91410134-91410156 GTCCTCAGTAGAACACACGCAGG - Exonic
1057087948 9:92228032-92228054 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1057155219 9:92832155-92832177 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
1057341713 9:94208155-94208177 ATGCTCTGTGAACCCCAAGCAGG - Intergenic
1057751378 9:97796144-97796166 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1058018735 9:100067490-100067512 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1058660070 9:107258204-107258226 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1058722399 9:107775655-107775677 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1058972738 9:110097857-110097879 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1059120664 9:111640225-111640247 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1059707899 9:116841073-116841095 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1060041417 9:120304638-120304660 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1060127180 9:121059453-121059475 TGGCTCAGTGGAACCAAAGAAGG - Intergenic
1060334697 9:122711088-122711110 GTGCTCAATGGCGCCCAGGCTGG + Intergenic
1060349978 9:122851796-122851818 GTGCTCAATGGCGCCCAGGCTGG + Intronic
1060351671 9:122866704-122866726 GTGCTCAGTGGTGCCCAGGCTGG + Intronic
1060369770 9:123057749-123057771 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1060669899 9:125459511-125459533 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1060682224 9:125576818-125576840 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1060686935 9:125623095-125623117 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1060703993 9:125781216-125781238 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1060924731 9:127448235-127448257 GTGCTCAGTGAGACCCAAGATGG - Intronic
1061142976 9:128779817-128779839 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1061427254 9:130507052-130507074 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1061635712 9:131907517-131907539 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1061929860 9:133826932-133826954 GCGCTCTGTGGCACCCAATCCGG + Intronic
1203464135 Un_GL000220v1:69051-69073 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1203562518 Un_KI270744v1:71074-71096 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1203634508 Un_KI270750v1:97704-97726 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1185584514 X:1235064-1235086 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1186245265 X:7610021-7610043 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1186786778 X:12962941-12962963 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1186923066 X:14303156-14303178 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1187183814 X:16965806-16965828 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1187184432 X:16969422-16969444 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1187424325 X:19163386-19163408 CTTCTCAGTTGAACCCCAGCAGG + Intergenic
1187552439 X:20319298-20319320 GAGCACAGTGAGACCCAAGCTGG - Intergenic
1188368091 X:29334972-29334994 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1188476976 X:30601790-30601812 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1188492809 X:30754466-30754488 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1189056973 X:37707902-37707924 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1189210091 X:39277188-39277210 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1189342025 X:40211468-40211490 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1189505754 X:41611998-41612020 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1189570143 X:42286314-42286336 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1189587378 X:42474680-42474702 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1189589859 X:42499234-42499256 GTCCTCACTGGAACTCAAGAAGG - Intergenic
1189685535 X:43560140-43560162 GGGCTCTGTGGACCCAAAGCTGG + Intergenic
1189838184 X:45041948-45041970 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1189955690 X:46275008-46275030 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1189968719 X:46396695-46396717 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1190171396 X:48114941-48114963 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1190241501 X:48660264-48660286 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1190681041 X:52827484-52827506 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1190778850 X:53577821-53577843 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1190820192 X:53966531-53966553 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1190839279 X:54129716-54129738 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1190870031 X:54416961-54416983 GTGGACACTGGAACCAAAGCAGG - Intergenic
1190891629 X:54573242-54573264 GTGCTCAATGGCGCCCAGGCTGG - Intergenic
1191835250 X:65456741-65456763 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1192106879 X:68326165-68326187 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1192324724 X:70122742-70122764 GTGCTCAGTGTTGCCCAGGCTGG + Intergenic
1192353010 X:70372339-70372361 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1192386691 X:70679238-70679260 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1192464195 X:71342226-71342248 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1192477120 X:71452757-71452779 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1192567586 X:72178243-72178265 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1192813623 X:74569512-74569534 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1192970013 X:76218917-76218939 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1193067956 X:77279000-77279022 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1193114966 X:77766916-77766938 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1193132530 X:77932601-77932623 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1193164738 X:78266136-78266158 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1193372239 X:80712448-80712470 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1195257647 X:103104976-103104998 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1196778433 X:119361695-119361717 GTGCTCAGTGGTGCCCAGGCTGG + Intergenic
1197199193 X:123733826-123733848 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1197452830 X:126641053-126641075 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1197735808 X:129850081-129850103 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1197832447 X:130658532-130658554 GAGCTCAGTGAACCCCAAGCAGG + Intronic
1198246746 X:134838993-134839015 GTGCTCAATGGTGCCCAGGCTGG + Intronic
1198260324 X:134960038-134960060 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1198476682 X:137001364-137001386 GTGCTCAATGGTGCCCAGGCTGG - Intergenic
1199230861 X:145435926-145435948 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1199452824 X:147993113-147993135 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1199586324 X:149420427-149420449 GTGCTCAATGGTGCCCAGGCTGG + Intergenic
1200111486 X:153743141-153743163 GGGCTCAGTGGAGCCTGAGCCGG + Intronic
1200324688 X:155224298-155224320 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1200387526 X:155908255-155908277 GTGCTCAATGGTGCCCAGGCTGG - Intronic
1200527716 Y:4295297-4295319 GTGCTCAATGTTACCCAGGCTGG + Intergenic
1201294886 Y:12454157-12454179 GTGCTCAGTGTTGCCCAGGCTGG - Intergenic
1201335692 Y:12878432-12878454 GTGCTCAATGGTGCCCAGGCTGG + Intergenic