ID: 1143745629

View in Genome Browser
Species Human (GRCh38)
Location 17:8992055-8992077
Sequence CCAGAGCCTGCAGTGTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143745629_1143745635 20 Left 1143745629 17:8992055-8992077 CCACAAGACACTGCAGGCTCTGG No data
Right 1143745635 17:8992098-8992120 CCCTGCCCGGCTTCCTTCTGTGG No data
1143745629_1143745637 24 Left 1143745629 17:8992055-8992077 CCACAAGACACTGCAGGCTCTGG No data
Right 1143745637 17:8992102-8992124 GCCCGGCTTCCTTCTGTGGTTGG No data
1143745629_1143745632 7 Left 1143745629 17:8992055-8992077 CCACAAGACACTGCAGGCTCTGG No data
Right 1143745632 17:8992085-8992107 CAGACTCCTCAGGCCCTGCCCGG No data
1143745629_1143745631 -3 Left 1143745629 17:8992055-8992077 CCACAAGACACTGCAGGCTCTGG No data
Right 1143745631 17:8992075-8992097 TGGTTCTGAGCAGACTCCTCAGG No data
1143745629_1143745641 28 Left 1143745629 17:8992055-8992077 CCACAAGACACTGCAGGCTCTGG No data
Right 1143745641 17:8992106-8992128 GGCTTCCTTCTGTGGTTGGTGGG No data
1143745629_1143745640 27 Left 1143745629 17:8992055-8992077 CCACAAGACACTGCAGGCTCTGG No data
Right 1143745640 17:8992105-8992127 CGGCTTCCTTCTGTGGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143745629 Original CRISPR CCAGAGCCTGCAGTGTCTTG TGG (reversed) Intergenic
No off target data available for this crispr