ID: 1143747228

View in Genome Browser
Species Human (GRCh38)
Location 17:9003452-9003474
Sequence CGGCGAGCCCCAGCCTGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143747213_1143747228 29 Left 1143747213 17:9003400-9003422 CCAGAGCCCCAGCCCCGCGTCCT No data
Right 1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG No data
1143747215_1143747228 22 Left 1143747215 17:9003407-9003429 CCCAGCCCCGCGTCCTGCGCACT No data
Right 1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG No data
1143747221_1143747228 9 Left 1143747221 17:9003420-9003442 CCTGCGCACTTGGCGCGCTCTGG No data
Right 1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG No data
1143747220_1143747228 15 Left 1143747220 17:9003414-9003436 CCGCGTCCTGCGCACTTGGCGCG No data
Right 1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG No data
1143747218_1143747228 17 Left 1143747218 17:9003412-9003434 CCCCGCGTCCTGCGCACTTGGCG No data
Right 1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG No data
1143747216_1143747228 21 Left 1143747216 17:9003408-9003430 CCAGCCCCGCGTCCTGCGCACTT No data
Right 1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG No data
1143747219_1143747228 16 Left 1143747219 17:9003413-9003435 CCCGCGTCCTGCGCACTTGGCGC No data
Right 1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG No data
1143747214_1143747228 23 Left 1143747214 17:9003406-9003428 CCCCAGCCCCGCGTCCTGCGCAC No data
Right 1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143747228 Original CRISPR CGGCGAGCCCCAGCCTGCTC CGG Intergenic
No off target data available for this crispr