ID: 1143747274

View in Genome Browser
Species Human (GRCh38)
Location 17:9003595-9003617
Sequence GCCCGGGGCGCGGGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143747274_1143747282 -2 Left 1143747274 17:9003595-9003617 CCTGCCGCGCCCGCGCCCCGGGC No data
Right 1143747282 17:9003616-9003638 GCCACCCCGCCCGGCCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143747274 Original CRISPR GCCCGGGGCGCGGGCGCGGC AGG (reversed) Intergenic
No off target data available for this crispr